diff --git a/.gitignore b/.gitignore
index 7e99e367f8443d86e5e8825b9fda39dfbb39630d..09bf5d65f59f67ea5457404e72300a693093ada1 100644
--- a/.gitignore
+++ b/.gitignore
@@ -1 +1,2 @@
-*.pyc
\ No newline at end of file
+*.pyc
+__pycache__/
\ No newline at end of file
diff --git a/RotTable.py b/RotTable.py
index 9a4d2e7b0198f228401b843ca847662948c3ca1a..912cbb001760b2ced0c934ca28b8f7aefec53628 100644
--- a/RotTable.py
+++ b/RotTable.py
@@ -40,9 +40,21 @@ class RotTable:
"TA": "TA",\
"TC": "GA",\
"TG": "CA",\
- "TT": "AA",\
+ "TT": "AA"\
}
+ __SOUS_CORRESPONDANCE = {\
+ "AA": "TT",\
+ "AC": "GT",\
+ "AG": "CT",\
+ "AT": "AT",\
+ "CA": "TG",\
+ "CC": "GG",\
+ "CG": "CG",\
+ "GA": "TC",\
+ "GC": "GC",\
+ "TA": "TA"\
+ }
# get the angles in each axis (x, y, z), considering the deviation
def __init__(self):
self.rot_table = {}
@@ -53,9 +65,11 @@ class RotTable:
# get a random deviation, considering the "limits" given in the last 3 columns
# of __ORIGINAL_ROT_TABLE
def alea(self):
- for dinucleotide in RotTable.__ORIGINAL_ROT_TABLE:
+ for dinucleotide in RotTable.__SOUS_CORRESPONDANCE:
for i in range(2):
- self.rot_table[dinucleotide][i] += numpy.random.uniform(low = -RotTable.__ORIGINAL_ROT_TABLE[dinucleotide][i+3], high= RotTable.__ORIGINAL_ROT_TABLE[dinucleotide][i+3])
+ delta = numpy.random.uniform(low = -RotTable.__ORIGINAL_ROT_TABLE[dinucleotide][i+3], high= RotTable.__ORIGINAL_ROT_TABLE[dinucleotide][i+3])
+ self.rot_table[dinucleotide][i] += delta
+ self.rot_table[RotTable.__SOUS_CORRESPONDANCE[dinucleotide]][i] += delta
# return __ORIGINAL_ROT_TABLE
def orta(self):
@@ -86,6 +100,5 @@ class RotTable:
###################
table1 = RotTable()
-print(table1.orta())
-print(table1.rot_table["AA"])
+# print(table1.rot_table)
diff --git a/__pycache__/croisement.cpython-37.pyc b/__pycache__/croisement.cpython-37.pyc
deleted file mode 100644
index 3c0b7814b5726496f728cff297117c1679b51da0..0000000000000000000000000000000000000000
Binary files a/__pycache__/croisement.cpython-37.pyc and /dev/null differ
diff --git a/__pycache__/population.cpython-37.pyc b/__pycache__/population.cpython-37.pyc
deleted file mode 100644
index cd1f744dd32f7a248c3ae2481fa0bd1243989c5a..0000000000000000000000000000000000000000
Binary files a/__pycache__/population.cpython-37.pyc and /dev/null differ
diff --git a/algogenetique.py b/algogenetique.py
index 9e681de9dd01d77569355a0ae01139ec8828adbc..fcdb9895d145935e45c1685b2fc0f4ddce2fe373 100644
--- a/algogenetique.py
+++ b/algogenetique.py
@@ -3,19 +3,22 @@ import math
import numpy
import RotTable
from individu import Individu
-from population import Population
+from population import Population, afficher
import croisement
from Traj3D import *
from random import random
import matplotlib.pyplot as plt
+
def main(N,tmax,pmutation, proportion,brin="plasmid_8k.fasta"):
'''lineList = [line.rstrip('\n') for line in open(brin)]
brin = ''.join(lineList[1:])'''
L=[]
People=Population(N)
+ afficher(People)
for i in range(tmax):
+ print("\n \n NOUVELLE GENERATION \n \n")
max=0
best=None
for individu in People.indiv:
diff --git a/croisement.py b/croisement.py
index 2bdb485cc5acfb57439e45e856e88296edb25876..96f85a8a89e1dcaa97cbed0f06233942ee36f211 100644
--- a/croisement.py
+++ b/croisement.py
@@ -18,7 +18,7 @@ ROT_TABLE = {\
"TA": [36, 0.9, 0, 1.1, 2, 0],\
"TC": [36.9, 5.3, -120, 0.9, 6, 0],\
"TG": [34.5, 3.5, 64, 0.9, 34, 0],\
- "TT": [35.62, 7.2, 154, 0.06, 0.6, 0]\
+ "TT": [35.62, 7.2, -154, 0.06, 0.6, 0]\
}
@@ -26,30 +26,71 @@ def croisement_un_point(parent1, parent2):
enfant1 = Individu(RotTable())
enfant2 = Individu(RotTable())
comp = 0
- point_crois= numpy.random.random_integers(0,16)
+ point_crois= numpy.random.random_integers(0,8)
for doublet in ROT_TABLE:
+ if doublet == "GA":
+ break
if comp < point_crois:
enfant1.table.rot_table[doublet] = parent1.table.rot_table[doublet]
+ correspondent_doublet1 = enfant1.table.corr()[doublet]
+ enfant1.table.rot_table[correspondent_doublet1] = parent1.table.rot_table[correspondent_doublet1]
+ enfant1.table.rot_table[correspondent_doublet1][2] *= -1
+
enfant2.table.rot_table[doublet] = parent2.table.rot_table[doublet]
+ correspondent_doublet2 = enfant2.table.corr()[doublet]
+ enfant2.table.rot_table[correspondent_doublet2] = parent2.table.rot_table[correspondent_doublet2]
+ enfant2.table.rot_table[correspondent_doublet2][2] *= -1
+
else :
enfant1.table.rot_table[doublet] = parent2.table.rot_table[doublet]
+ correspondent_doublet1 = enfant1.table.corr()[doublet]
+ enfant1.table.rot_table[correspondent_doublet1] = parent2.table.rot_table[correspondent_doublet1]
+ enfant1.table.rot_table[correspondent_doublet1][2] *= -1
+
enfant2.table.rot_table[doublet] = parent1.table.rot_table[doublet]
+ correspondent_doublet2 = enfant2.table.corr()[doublet]
+ enfant2.table.rot_table[correspondent_doublet2] = parent1.table.rot_table[correspondent_doublet1]
+ enfant2.table.rot_table[correspondent_doublet2][2] *= -1
+
comp += 1
return enfant1, enfant2
def croisement_deux_points(parent1, parent2):
- enfant1 = RotTable()
- enfant2 = RotTable()
+ enfant1 = Individu(RotTable())
+ enfant2 = Individu(RotTable())
comp = 0
- point_crois1= numpy.random.random_integers(0,16)
- point_crois2= numpy.random.random_integers(0,16)
+ point_crois1= numpy.random.random_integers(0,8)
+ point_crois2= numpy.random.random_integers(0,8)
for doublet in ROT_TABLE:
if comp < min(point_crois1,point_crois2) or comp > max(point_crois1,point_crois2):
- enfant1.rot_table[doublet] = parent1.rot_table[doublet]
- enfant2.rot_table[doublet] = parent2.rot_table[doublet]
+ enfant1.table.rot_table[doublet] = parent1.table.rot_table[doublet]
+ correspondent_doublet1 = enfant1.table.corr()[doublet]
+ enfant1.table.rot_table[correspondent_doublet1] = parent1.table.rot_table[correspondent_doublet1]
+ enfant1.table.rot_table[correspondent_doublet1][2] *= -1
+
+ enfant2.table.rot_table[doublet] = parent2.table.rot_table[doublet]
+ correspondent_doublet2 = enfant2.table.corr()[doublet]
+ enfant2.table.rot_table[correspondent_doublet2] = parent2.table.rot_table[correspondent_doublet2]
+ enfant2.table.rot_table[correspondent_doublet2][2] *= -1
+
else :
- enfant1.rot_table[doublet] = parent2.rot_table[doublet]
- enfant2.rot_table[doublet] = parent1.rot_table[doublet]
+ enfant1.table.rot_table[doublet] = parent2.table.rot_table[doublet]
+ correspondent_doublet1 = enfant1.table.corr()[doublet]
+ enfant1.table.rot_table[correspondent_doublet1] = parent2.table.rot_table[correspondent_doublet1]
+ enfant1.table.rot_table[correspondent_doublet1][2] *= -1
+
+ enfant2.table.rot_table[doublet] = parent1.table.rot_table[doublet]
+ correspondent_doublet2 = enfant2.table.corr()[doublet]
+ enfant2.table.rot_table[correspondent_doublet2] = parent1.table.rot_table[correspondent_doublet1]
+ enfant2.table.rot_table[correspondent_doublet2][2] *= -1
comp += 1
- return enfant1, enfant2
\ No newline at end of file
+ return enfant1, enfant2
+
+# parent1 = Individu(RotTable())
+# parent2 = Individu(RotTable())
+# print("parent1: ", parent1.table.rot_table)
+# print("parent2: ", parent2.table.rot_table)
+# enfant1, enfant2 = croisement_un_point(parent1, parent2)
+# print("enfant1: ", enfant1.table.rot_table)
+# print("enfant2: ", enfant2.table.rot_table)
\ No newline at end of file
diff --git a/individu.py b/individu.py
index 5116b5ef465663be26bc96913278830ccde2ad96..3ef8ae652a28fe19037ae25fad68465ad44a22bb 100644
--- a/individu.py
+++ b/individu.py
@@ -57,4 +57,4 @@ class Individu():
# table = RotTable()
# test = Individu(table)
# test.evaluate("AAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCCAGTAAACGAAAAAACCGCCTGGGGAGGCGGTTTAGTCGAA")
-# print(test.score)
+# print(test.score)
\ No newline at end of file
diff --git a/population.py b/population.py
index c16d0101e1233c9ff230563b1ca492f6bf6656fa..7268915b15f592aa862b42b3c6decc53c587020e 100644
--- a/population.py
+++ b/population.py
@@ -142,6 +142,7 @@ def afficher(popu):
for individu in popu.indiv :
print("\n individu \n")
print(individu.table.rot_table)
+ print ("score", individu.score)
def test():
popu = Population(4)