from RotTable import RotTable from Traj3D import Traj3D import numpy as np from math import sqrt, inf from random import random, choice P1 = 0.015 class Individu(): ''' Un individu est caractérisé par sa table de rotations (individu.table)''' def __init__(self, table): self.table = table lineList = [line.rstrip('\n') for line in open("plasmid_8k.fasta")] self.brin = ''.join(lineList[1:]) #self.brin = "AAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCCAGTAAACGAAAAAACCGCCTGGGGAGGCGGTTTAGTCGAA" # (sequence used for test) self.score = None self.distance = None def evaluate(self): ''' Evalue le score d'un individu sur un nombre numb_ajout de points''' # The last numb_ajout dinucleotides of the "ribbon" are joined at its beginning, # and the first numb_ajout dinucleotides are joined at the end of it. # This "new parts" of the sequence will be compared with the real beginning and end of the the ribbon. # If they coincide, then the chromosome is circular traj = Traj3D() # number of dinucleotides which will be compared numb_ajout = 10 # the first and the last numb_ajout dinucleotides respectively first_seq = self.brin[0:numb_ajout] last_seq = self.brin[-numb_ajout:] # creation of the "new ribbon" traj.compute(last_seq + self.brin + first_seq, self.table) traj_array = traj.getTraj() list_distance = [] begining = traj_array[0:2*numb_ajout] end = traj_array[-2*numb_ajout:] # score calculation, comparing the new ribbon with the real sequence, # according to the distance of the correspondent dinucleotides for i in range(numb_ajout): nuc_coordonate_beg = begining[i] nuc_coordonate_end = end[i] distance_nuc = np.linalg.norm(nuc_coordonate_beg - nuc_coordonate_end, ord=2) list_distance += [distance_nuc] self.score = max(list_distance) self.distance = np.linalg.norm(traj_array[numb_ajout] - traj_array[-(numb_ajout+1)], ord=2) def mutation(self, proba = P1): # each dinucleotide has a probability "proba" to mutate table_rotations = self.table.rot_table for doublet in sorted(table_rotations.keys()) : for coord in range(3): tir = random() if tir < proba : table_rotations[doublet][coord] =np.random.uniform(low = self.table.orta()[doublet][coord] - self.table.orta()[doublet][coord + 3], high = self.table.orta()[doublet][coord] + self.table.orta()[doublet][coord + 3]) doublet2 = self.table.corr()[doublet] if coord == 0 or coord == 1 : table_rotations[doublet2][coord] = table_rotations[doublet][coord] else : #sur l'axe z il y a un moins table_rotations[doublet2][coord] = - table_rotations[doublet][coord] def mutation_with_numbers(self, proba = P1, number_of_mutations = 1): # each individual has a probability "proba" to be mutated # if it mutates, then a number "number_of_mutations" of chromosomes will be randomly mutated table_rotations = self.table.rot_table table_rotation_not_seen = [i for i in sorted(table_rotations.keys())] table_rotation_not_seen = table_rotation_not_seen[:8] tir = random() if tir < proba : for i in range(0,number_of_mutations): doublet = choice(table_rotation_not_seen) table_rotation_not_seen.remove(doublet) for coord in range(3): table_rotations[doublet][coord] =np.random.uniform(low = self.table.orta()[doublet][coord] - self.table.orta()[doublet][coord + 3], high = self.table.orta()[doublet][coord] + self.table.orta()[doublet][coord + 3]) doublet2 = self.table.corr()[doublet] if coord == 0 or coord == 1 : table_rotations[doublet2][coord] = table_rotations[doublet][coord] else : #sur l'axe z il y a un moins table_rotations[doublet2][coord] = - table_rotations[doublet][coord] def mutation_close_values(self, proba = P1, number_of_mutations = 1): # each individual has a probability "proba" to be mutated # if it mutates, then a number "number_of_mutations" of chromosomes will be randomly mutated # according to the normal distribution around the current value of the dinucleotide table_rotations = self.table.rot_table table_rotation_not_seen = [i for i in sorted(table_rotations.keys())] table_rotation_not_seen = table_rotation_not_seen[:8] tir = random() if tir < proba : for i in range(0,number_of_mutations): doublet = choice(table_rotation_not_seen) table_rotation_not_seen.remove(doublet) for coord in range(3): value = table_rotations[doublet][coord] + np.random.normal(0, self.table.orta()[doublet][coord + 3]/10) if value > self.table.orta()[doublet][coord] + self.table.orta()[doublet][coord + 3]: value = self.table.orta()[doublet][coord] + self.table.orta()[doublet][coord + 3] elif value < self.table.orta()[doublet][coord] - self.table.orta()[doublet][coord + 3]: value = self.table.orta()[doublet][coord] - self.table.orta()[doublet][coord + 3] table_rotations[doublet][coord] = value doublet2 = self.table.corr()[doublet] if coord == 0 or coord == 1 : table_rotations[doublet2][coord] = table_rotations[doublet][coord] else : #sur l'axe z il y a un moins table_rotations[doublet2][coord] = - table_rotations[doublet][coord]