genome.wustl.edu.TCGA-A1-A0SD.indel.0e81f9c986154ce89e59240c3f09534f.txt 83.1 KB
Newer Older
Pradat Yoann's avatar
Pradat Yoann committed
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99
Hugo_Symbol	Entrez_Gene_Id	NCBI_Build	Chromosome	Start_Position	End_Position	Variant_Quality	Filter	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	HGVSc	HGVSp	HGVSp_Short	Transcript_ID	all_effects	Location	Gene	Feature	Feature_type	CANONICAL	cDNA_position	CDS_position	Protein_position	Amino_acids	Codons	Existing_variation	Consequence	IMPACT	CLIN_SIG	STRAND	SYMBOL_SOURCE	HGNC_ID	BIOTYPE	CCDS	ENSP	SWISSPROT	TREMBL	UNIPARC	EXON	INTRON	AF	AA_AF	EA_AF	gnomAD_AF	MAX_AF	MAX_AF_POPS	n_GT	n_SS	n_TIR	n_TAR	n_DP	n_DP4	n_AD	n_depth	n_ref_count	n_alt_count	t_GT	t_SS	t_TIR	t_TAR	t_DP	t_DP4	t_AD	t_depth	t_ref_count	t_alt_count	Tumor_Sample	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Tumor_Sample_Site
IFNLR1	163702	GRCh37	1	24486218	24486219			Intron	INS	-	-	TTG	rs112101640	-	-	c.511-96_511-95insCAA			ENST00000327535	IFNLR1,intron_variant,,ENST00000327535,NM_170743.3,NM_173064.2;IFNLR1,intron_variant,,ENST00000327575,NM_173065.2;IFNLR1,intron_variant,,ENST00000374419,;IFNLR1,intron_variant,,ENST00000374421,;IFNLR1,downstream_gene_variant,,ENST00000374418,;	1:24486218-24486219	ENSG00000185436	ENST00000327535.1	Transcript	YES	-	-	-	-	-	rs112101640	intron_variant	MODIFIER		-1	HGNC	18584	protein_coding	CCDS248.1	ENSP00000327824	Q8IU57	A4QPA4	UPI000004D3FC		4/6							0/0				24.0			24.0	24.0	0.0	0/1	2			22.0	0,22,0,6		22.0	22.0	6.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ARID1A	8289	GRCh37	1	27107273	27107274			3'UTR	DEL	GT	GT	-	rs1553153821	GT	GT	c.*35_*36del			ENST00000324856	ARID1A,3_prime_UTR_variant,,ENST00000324856,NM_006015.4;ARID1A,3_prime_UTR_variant,,ENST00000457599,NM_139135.2;ARID1A,3_prime_UTR_variant,,ENST00000430799,;ARID1A,3_prime_UTR_variant,,ENST00000540690,;ARID1A,downstream_gene_variant,,ENST00000374152,;ARID1A,3_prime_UTR_variant,,ENST00000466382,;ARID1A,3_prime_UTR_variant,,ENST00000532781,;	1:27107273-27107274	ENSG00000117713	ENST00000324856.7	Transcript	YES	7255-7256	-	-	-	-	rs1553153821	3_prime_UTR_variant	MODIFIER		1	HGNC	11110	protein_coding	CCDS285.1	ENSP00000320485	O14497	Q96T01,Q96SY8,Q96SM7,E9PQW6,C1KEN7,A4FU79	UPI0000167B91	20/20					4.576e-05	9.595e-05	gnomAD_NFE	0/0		0,0	21,21	26.0		0.0	26.0	21.0	0.0	0/1	2	3,3	14,14	18.0	4,14,2,1	4.0	18.0	14.0	3.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
IGSF3	3321	GRCh37	1	117122285	117122286			In_Frame_Ins	INS	-	-	TCC	rs576658823	-	-	c.3122_3123insGGA	p.Asp1040_Asp1041insGlu	p.D1040_D1041insE	ENST00000369483	IGSF3,inframe_insertion,p.Asp1020_Asp1021insGlu,ENST00000369486,NM_001007237.2;IGSF3,inframe_insertion,p.Asp1040_Asp1041insGlu,ENST00000369483,NM_001542.3;IGSF3,inframe_insertion,p.Asp1040_Asp1041insGlu,ENST00000318837,;	1:117122285-117122286	ENSG00000143061	ENST00000369483.1	Transcript	YES	3827-3828	3122-3123	1041	D/ED	gac/gaGGAc	rs576658823,COSV59586221	inframe_insertion	MODERATE		-1	HGNC	5950	protein_coding	CCDS30814.1	ENSP00000358495	O75054		UPI0000140437	11/12					0.2555	0.4284	EUR	0/0				8.0			8.0	8.0	0.0	0/1	2			16.0	4,12,1,6		16.0	16.0	7.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
MYOC	4653	GRCh37	1	171607570	171607571			Intron	DEL	AG	AG	-	rs144871239	AG	AG	c.730+166_730+167del			ENST00000037502	MYOC,intron_variant,,ENST00000037502,NM_000261.1;	1:171607570-171607571	ENSG00000034971	ENST00000037502.6	Transcript	YES	-	-	-	-	-	rs144871239	intron_variant	MODIFIER		-1	HGNC	7610	protein_coding	CCDS1297.1	ENSP00000037502	Q99972	B4DV60	UPI00000012D6		2/2					0.0307	SAS	0/0		0,0	12,12	15.0		12.0	15.0	12.0	0.0	0/1	2	4,4	7,7	11.0	10,1,3,1	7.0	11.0	7.0	4.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
TNN	63923	GRCh37	1	175116046	175116047			Intron	INS	-	-	TT	rs11450833	-	-	c.3760-7_3760-6dup			ENST00000239462	TNN,intron_variant,,ENST00000239462,NM_022093.1;,regulatory_region_variant,,ENSR00000255419,;,regulatory_region_variant,,ENSR00001508420,;	1:175116046-175116047	ENSG00000120332	ENST00000239462.4	Transcript	YES	-	-	-	-	-	rs11450833	intron_variant	MODIFIER		1	HGNC	22942	protein_coding	CCDS30943.1	ENSP00000239462	Q9UQP3		UPI00001D7DA9		18/18				0.4111	0.5014	AMR	0/0				38.0		0.0	38.0	38.0	0.0	0/2	2			56.0	57,2,11,1	7.0	56.0	59.0	12.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ELF3	1999	GRCh37	1	201981005	201981006			Intron	INS	-	-	A	rs1169377361	-	-	c.164-63dup			ENST00000359651	ELF3,intron_variant,,ENST00000359651,;ELF3,intron_variant,,ENST00000367283,;ELF3,intron_variant,,ENST00000367284,NM_004433.4,NM_001114309.1;ELF3,intron_variant,,ENST00000446188,;RP11-510N19.5,intron_variant,,ENST00000504773,;RP11-465N4.4,upstream_gene_variant,,ENST00000419190,;ELF3,intron_variant,,ENST00000490203,;ELF3,intron_variant,,ENST00000495848,;ELF3,upstream_gene_variant,,ENST00000470384,;ELF3,upstream_gene_variant,,ENST00000475698,;ELF3,upstream_gene_variant,,ENST00000479874,;ELF3,downstream_gene_variant,,ENST00000498017,;,regulatory_region_variant,,ENSR00000956492,;	1:201981005-201981006	ENSG00000163435	ENST00000359651.3	Transcript	YES	-	-	-	-	-	rs1169377361	intron_variant	MODIFIER		1	HGNC	3318	protein_coding	CCDS1419.1	ENSP00000352673	P78545		UPI0000034E32		1/7							0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
TLR5	7100	GRCh37	1	223284687	223284688			Frame_Shift_Ins	INS	-	-	A	novel	-	-	c.1686dup	p.Pro563SerfsTer2	p.P563Sfs*2	ENST00000540964	TLR5,frameshift_variant,p.Pro563SerfsTer2,ENST00000540964,;TLR5,frameshift_variant,p.Pro563SerfsTer2,ENST00000366881,NM_003268.5;TLR5,frameshift_variant,p.Pro563SerfsTer2,ENST00000342210,;TLR5,downstream_gene_variant,,ENST00000407096,;,regulatory_region_variant,,ENSR00001513547,;	1:223284687-223284688	ENSG00000187554	ENST00000540964.1	Transcript	YES	2148-2149	1686-1687	562-563	-/X	-/T	-	frameshift_variant	HIGH		-1	HGNC	11851	protein_coding	CCDS31033.1	ENSP00000440643	O60602	B1AZ06	UPI0000205D14	4/4								0/0		0,0	91,91	93.0		91.0	93.0	91.0	0.0	0/1	2	37,37	35,36	78.0	32,46,18,19	35.0	78.0	35.0	37.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
PARP1	142	GRCh37	1	226553492	226553494			Intron	DEL	AAC	AAC	-	rs200302262	AAC	AAC	c.2505+161_2505+163del			ENST00000366794	PARP1,intron_variant,,ENST00000366794,NM_001618.3;PARP1,intron_variant,,ENST00000490921,;PARP1,intron_variant,,ENST00000498787,;PARP1,upstream_gene_variant,,ENST00000463968,;PARP1,upstream_gene_variant,,ENST00000468608,;PARP1,upstream_gene_variant,,ENST00000491816,;	1:226553492-226553494	ENSG00000143799	ENST00000366794.5	Transcript	YES	-	-	-	-	-	rs200302262	intron_variant	MODIFIER		-1	HGNC	270	protein_coding	CCDS1554.1	ENSP00000355759	P09874	Q96P95	UPI000013D92D		18/22							0/0				12.0	12,0,0,0		12.0	12.0	0.0	0/1	2			9.0	4,0,5,0		9.0	4.0	5.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
C2orf50	130813	GRCh37	2	11273409	11273410			5'UTR	INS	-	-	TC	rs57490327	-	-	c.-53_-52dup			ENST00000381585	C2orf50,5_prime_UTR_variant,,ENST00000381585,;C2orf50,5_prime_UTR_variant,,ENST00000405022,NM_182500.2;AC062028.1,upstream_gene_variant,,ENST00000396164,;AC062028.1,upstream_gene_variant,,ENST00000417697,;AC062028.1,upstream_gene_variant,,ENST00000447433,;AC062028.1,upstream_gene_variant,,ENST00000536743,;AC062028.1,upstream_gene_variant,,ENST00000544306,;AC062028.1,upstream_gene_variant,,ENST00000590207,;AC062028.1,upstream_gene_variant,,ENST00000590373,;,regulatory_region_variant,,ENSR00000112861,;,regulatory_region_variant,,ENSR00001168258,;	2:11273408-11273409	ENSG00000150873	ENST00000381585.3	Transcript	YES	230-231	-	-	-	-	rs57490327	5_prime_UTR_variant	MODIFIER		1	HGNC	26324	protein_coding	CCDS1678.1	ENSP00000370997	Q96LR7		UPI000006ECF0	1/3								0/0				9.0		0.0	9.0	9.0	0.0	0/2	2			23.0	24,2,7,1	4.0	23.0	26.0	8.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
HAAO	23498	GRCh37	2	42996760	42996763			Intron	DEL	AGAG	AGAG	-	rs10535571	AGAG	AGAG	c.630+90_630+93del			ENST00000294973	HAAO,intron_variant,,ENST00000294973,NM_012205.2;HAAO,downstream_gene_variant,,ENST00000431905,;HAAO,intron_variant,,ENST00000402698,;HAAO,intron_variant,,ENST00000404451,;HAAO,intron_variant,,ENST00000406007,;HAAO,downstream_gene_variant,,ENST00000406924,;,regulatory_region_variant,,ENSR00001618902,;	2:42996760-42996763	ENSG00000162882	ENST00000294973.6	Transcript	YES	-	-	-	-	-	rs10535571	intron_variant	MODIFIER		-1	HGNC	4796	protein_coding	CCDS33187.1	ENSP00000294973	P46952	C9IY88	UPI000007068E		7/9					0.8855	SAS	0/0				5.0			5.0	5.0	0.0	0/1	2			11.0	11,0,7,0		11.0	11.0	7.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
EML6	400954	GRCh37	2	55181023	55181023			Intron	DEL	A	A	-	rs34371058	A	A	c.4313-97del			ENST00000356458	EML6,intron_variant,,ENST00000356458,NM_001039753.2;EML6,intron_variant,,ENST00000481376,;EML6,upstream_gene_variant,,ENST00000490828,;,regulatory_region_variant,,ENSR00001177453,;	2:55181023	ENSG00000214595	ENST00000356458.6	Transcript	YES	-	-	-	-	-	rs34371058	intron_variant	MODIFIER		1	HGNC	35412	protein_coding	CCDS46286.1	ENSP00000348842	Q6ZMW3		UPI00006C0432		30/40							0/0				20.0		0.0	20.0	20.0	0.0	0/2	2			20.0	25,0,4,0	3.0	20.0	25.0	4.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
FMNL2	114793	GRCh37	2	153471255	153471256			Intron	INS	-	-	CAAAACAAAACAAAACAAAA	rs70974877	-	-	c.1063-104_1063-85dup			ENST00000288670	FMNL2,intron_variant,,ENST00000288670,NM_052905.3;FMNL2,upstream_gene_variant,,ENST00000475377,;,regulatory_region_variant,,ENSR00001628977,;	2:153471255-153471256	ENSG00000157827	ENST00000288670.9	Transcript	YES	-	-	-	-	-	rs70974877	intron_variant	MODIFIER		1	HGNC	18267	protein_coding	CCDS46429.1	ENSP00000288670	Q96PY5	B3KT32	UPI0000441EF9		11/25					0.3495	AFR	0/0				8.0		0.0	8.0	8.0	0.0	0/2	2			8.0	8,0,3,0	4.0	8.0	8.0	3.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
HOXD9	3235	GRCh37	2	176988290	176988291			In_Frame_Ins	INS	-	-	GCA	rs56007470	-	-	c.804_806dup	p.Gln269dup	p.Q269dup	ENST00000249499	HOXD9,inframe_insertion,p.Gln269dup,ENST00000249499,NM_014213.3;HOXD10,downstream_gene_variant,,ENST00000249501,NM_002148.3;HOXD-AS2,intron_variant,,ENST00000440016,;HOXD10,downstream_gene_variant,,ENST00000490088,;HOXD10,downstream_gene_variant,,ENST00000549469,;,regulatory_region_variant,,ENSR00001200315,;	2:176988290-176988291	ENSG00000128709	ENST00000249499.6	Transcript	YES	1203-1204	794-795	265	P/PQ	ccg/ccGCAg	rs56007470,COSV50893605	inframe_insertion	MODERATE		1	HGNC	5140	protein_coding	CCDS2267.2	ENSP00000249499	P28356		UPI000004A10E	1/2			0.1061	0.3821	0.3932	0.6124	gnomAD_AMR	0/0						0.0			0.0	0/1	2					12.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
SLC22A14	9389	GRCh37	3	38355176	38355177			Intron	INS	-	-	GCGCGCGCGCGC	rs1553644857	-	-	c.1164-35_1164-34insCGCGCGCGCGCG			ENST00000273173	SLC22A14,intron_variant,,ENST00000273173,NM_004803.3;SLC22A14,intron_variant,,ENST00000448498,;,regulatory_region_variant,,ENSR00001657319,;	3:38355176-38355177	ENSG00000144671	ENST00000273173.4	Transcript	YES	-	-	-	-	-	rs1553644857	intron_variant	MODIFIER		1	HGNC	8495	protein_coding	CCDS2677.1	ENSP00000273173	Q9Y267	F5H7H1	UPI00001AE9A8		6/9							0/0				20.0		1.0	20.0	20.0	0.0	0/1	2			18.0	18,2,5,0	8.0	18.0	20.0	5.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
GYG1	2992	GRCh37	3	148711906	148711907			Intron	INS	-	-	T	rs368468774	-	-	c.8-13dup			ENST00000345003	GYG1,intron_variant,,ENST00000296048,NM_001184720.1;GYG1,intron_variant,,ENST00000345003,NM_004130.3;GYG1,intron_variant,,ENST00000461191,;GYG1,intron_variant,,ENST00000473005,;GYG1,intron_variant,,ENST00000483267,;GYG1,intron_variant,,ENST00000484197,NM_001184721.1;GYG1,intron_variant,,ENST00000492285,;GYG1,intron_variant,,ENST00000478067,;GYG1,upstream_gene_variant,,ENST00000465547,;GYG1,upstream_gene_variant,,ENST00000497528,;	3:148711906-148711907	ENSG00000163754	ENST00000345003.4	Transcript	YES	-	-	-	-	-	rs368468774	intron_variant	MODIFIER		1	HGNC	4699	protein_coding	CCDS3139.1	ENSP00000340736	P46976	C9J8R8,C9J7C7	UPI000014176C		1/7		0.07009	0.03901	0.01383	0.07009	AA	0/0				26.0		0.0	26.0	26.0	0.0	0/1	2			22.0	21,2,1,1	4.0	22.0	23.0	2.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
SI	6476	GRCh37	3	164776647	164776648			Intron	INS	-	-	ACAC	rs138742044	-	-	c.1398+100_1398+103dup			ENST00000264382	SI,intron_variant,,ENST00000264382,NM_001041.3;	3:164776647-164776648	ENSG00000090402	ENST00000264382.3	Transcript	YES	-	-	-	-	-	rs138742044	intron_variant	MODIFIER		-1	HGNC	10856	protein_coding	CCDS3196.1	ENSP00000264382	P14410		UPI000022C287		12/47							0/0				44.0		0.0	44.0	44.0	0.0	0/2	2			19.0	25,0,9,0	3.0	19.0	25.0	9.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
TFRC	7037	GRCh37	3	195792289	195792292			Intron	DEL	GGGG	GGGG	-	rs55639089	GGGG	GGGG	c.1198+22_1198+25del			ENST00000360110	TFRC,intron_variant,,ENST00000360110,NM_001128148.1;TFRC,intron_variant,,ENST00000392396,NM_003234.2;TFRC,intron_variant,,ENST00000420415,;TFRC,intron_variant,,ENST00000535031,;TFRC,intron_variant,,ENST00000540528,;TFRC,upstream_gene_variant,,ENST00000465288,;TFRC,intron_variant,,ENST00000464368,;TFRC,upstream_gene_variant,,ENST00000475593,;TFRC,upstream_gene_variant,,ENST00000477148,;TFRC,upstream_gene_variant,,ENST00000483983,;TFRC,downstream_gene_variant,,ENST00000491658,;	3:195792289-195792292	ENSG00000072274	ENST00000360110.4	Transcript	YES	-	-	-	-	-	rs55639089	intron_variant	MODIFIER		-1	HGNC	11763	protein_coding	CCDS3312.1	ENSP00000353224	P02786	G3V0E5,F5H6B1	UPI0000049ADE		10/18				0.3446	0.4495	gnomAD_EAS	0/0				7.0		0.0	7.0	7.0	0.0	0/1	2			11.0	11,0,5,0	5.0	11.0	11.0	5.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
PCYT1A	5130	GRCh37	3	195956727	195956728			3'Flank	DEL	AG	AG	-	rs144375332	AG	AG				ENST00000292823	PCYT1A,3_prime_UTR_variant,,ENST00000419333,;SLC51A,intron_variant,,ENST00000296327,NM_152672.5;PCYT1A,intron_variant,,ENST00000441879,;PCYT1A,downstream_gene_variant,,ENST00000292823,NM_005017.2;SLC51A,upstream_gene_variant,,ENST00000415111,;SLC51A,downstream_gene_variant,,ENST00000428985,;SLC51A,upstream_gene_variant,,ENST00000479732,;SLC51A,upstream_gene_variant,,ENST00000496737,;SLC51A,intron_variant,,ENST00000471430,;SLC51A,intron_variant,,ENST00000475271,;SLC51A,intron_variant,,ENST00000475672,;SLC51A,intron_variant,,ENST00000484407,;SLC51A,downstream_gene_variant,,ENST00000442203,;SLC51A,downstream_gene_variant,,ENST00000472653,;SLC51A,downstream_gene_variant,,ENST00000476129,;SLC51A,upstream_gene_variant,,ENST00000492794,;	3:195956727-195956728	ENSG00000163959	ENST00000296327.5	Transcript	YES	-	-	-	-	-	rs144375332	intron_variant	MODIFIER		1	HGNC	29955	protein_coding	CCDS3314.1	ENSP00000296327	Q86UW1		UPI000019219E		6/8							0/0				50.0		0.0	50.0	50.0	0.0	0/1	2			75.0	70,5,9,1	8.0	75.0	75.0	10.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
TRMT10A	93587	GRCh37	4	100472247	100472248			Intron	INS	-	-	A	rs370608163	-	-	c.646-101_646-100insT			ENST00000273962	TRMT10A,intron_variant,,ENST00000273962,NM_152292.4;TRMT10A,intron_variant,,ENST00000394876,;TRMT10A,intron_variant,,ENST00000394877,NM_001134665.1,NM_001134666.1;TRMT10A,downstream_gene_variant,,ENST00000455368,;TRMT10A,downstream_gene_variant,,ENST00000514547,;	4:100472247-100472248	ENSG00000145331	ENST00000273962.3	Transcript	YES	-	-	-	-	-	rs370608163	intron_variant	MODIFIER		-1	HGNC	28403	protein_coding	CCDS3650.1	ENSP00000273962	Q8TBZ6	D6R954	UPI000006D359		6/7							0/0				10.0	0,10,0,0		10.0	10.0	0.0	0/1	2			16.0	0,11,0,5		16.0	11.0	5.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
PAPSS1	9061	GRCh37	4	108608101	108608109			Intron	DEL	TCTAACACT	-	-	rs35832252	TCTAACACT	TCTAACACT	c.550+86_550+94del			ENST00000265174	PAPSS1,intron_variant,,ENST00000265174,NM_005443.4;PAPSS1,intron_variant,,ENST00000502431,;PAPSS1,intron_variant,,ENST00000511304,;PAPSS1,downstream_gene_variant,,ENST00000514489,;PAPSS1,downstream_gene_variant,,ENST00000506544,;	4:108608101-108608109	ENSG00000138801	ENST00000265174.4	Transcript	YES	-	-	-	-	-	rs35832252	intron_variant	MODIFIER		-1	HGNC	8603	protein_coding	CCDS3676.1	ENSP00000265174	O43252	Q6IAX6,Q4W5H3,Q4W5F0	UPI0000132102		4/11					0.9581	SAS	0/0				8.0		34.0	8.0	8.0	0.0	1/1	2			48.0	48,0,39,0	42.0	48.0	48.0	39.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
PRDM5	11107	GRCh37	4	121739412	121739415			Intron	DEL	CACA	CACA	-	novel	CACA	CACA	c.650+93_650+96del			ENST00000264808	PRDM5,intron_variant,,ENST00000264808,NM_018699.2;PRDM5,intron_variant,,ENST00000428209,;PRDM5,intron_variant,,ENST00000515109,;PRDM5,non_coding_transcript_exon_variant,,ENST00000507611,;PRDM5,intron_variant,,ENST00000502409,;PRDM5,intron_variant,,ENST00000505484,;PRDM5,intron_variant,,ENST00000512845,;	4:121739412-121739415	ENSG00000138738	ENST00000264808.3	Transcript	YES	-	-	-	-	-	-	intron_variant	MODIFIER		-1	HGNC	9349	protein_coding	CCDS3716.1	ENSP00000264808	Q9NQX1		UPI000013D572		5/15							0/0						0.0			0.0	0/1	2					4.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
SLC12A7	10723	GRCh37	5	1093609	1093610			Intron	INS	-	-	GGGCGGGGACT	rs56276350	-	-	c.342+28_342+38dup			ENST00000264930	SLC12A7,intron_variant,,ENST00000264930,NM_006598.2;	5:1093609-1093610	ENSG00000113504	ENST00000264930.5	Transcript	YES	-	-	-	-	-	rs56276350	intron_variant	MODIFIER		-1	HGNC	10915	protein_coding	CCDS34129.1	ENSP00000264930	Q9Y666		UPI0000141815		3/23		0.5905	0.9242		0.9871	EAS	0/0						0.0			0.0	0/1	2					18.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
SFXN1	94081	GRCh37	5	174940300	174940312			Intron	DEL	AAAAAAAAAAAAA	AAAAAAAAAAAAA	-	rs55761424	AAAAAAAAAAAAA	AAAAAAAAAAAAA	c.597-151_597-139del			ENST00000321442	SFXN1,intron_variant,,ENST00000321442,NM_022754.5;SFXN1,downstream_gene_variant,,ENST00000502393,;SFXN1,downstream_gene_variant,,ENST00000506963,;SFXN1,downstream_gene_variant,,ENST00000507017,;SFXN1,intron_variant,,ENST00000502865,;SFXN1,intron_variant,,ENST00000507823,;SFXN1,intron_variant,,ENST00000515736,;SFXN1,downstream_gene_variant,,ENST00000508290,;SFXN1,downstream_gene_variant,,ENST00000513725,;	5:174940300-174940312	ENSG00000164466	ENST00000321442.5	Transcript	YES	-	-	-	-	-	rs55761424	intron_variant	MODIFIER		1	HGNC	16085	protein_coding	CCDS4394.1	ENSP00000316905	Q9H9B4	D6RFI0,D6RDG7	UPI0000044799		6/10							0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
HLA-DRB5	3127	GRCh37	6	32487441	32487442			Intron	INS	-	C	C	rs747493738	-	-	c.371-14_371-13insG			ENST00000374975	HLA-DRB5,intron_variant,,ENST00000374975,NM_002125.3;	6:32487441-32487442	ENSG00000198502	ENST00000374975.3	Transcript	YES	-	-	-	-	-	rs747493738	intron_variant	MODIFIER		-1	HGNC	4953	protein_coding	CCDS4751.1	ENSP00000364114	Q30154	Q95385,Q5TJ21,Q30141,Q30138,Q30009,Q2YHL2,Q06663,Q06654,A1A424	UPI000008AF56		2/5		0.04726	0.09124	0.000582	0.09124	EA	0/0				4.0			4.0	4.0	0.0	1/1	2			20.0	2,18,2,18		20.0	20.0	20.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
HLA-DRB1	3123	GRCh37	6	32548732	32548733			Intron	INS	-	-	T	rs373779708	-	-	c.653-100_653-99insA			ENST00000360004	HLA-DRB1,intron_variant,,ENST00000360004,NM_002124.3;	6:32548732-32548733	ENSG00000196126	ENST00000360004.5	Transcript	YES	-	-	-	-	-	rs373779708	intron_variant	MODIFIER		-1	HGNC	4948	protein_coding	CCDS47409.1	ENSP00000353099	Q9GIY3,P04229,Q29974,P01911	M9PAL6,M9PAH4,M9PAH2,M9PA34,M9P9N9,M9P9N6,M9P978,M9P8M8,M9P8M7,Q9TQ40,Q9MYD9,Q95HN3,Q8WMA1,Q8MGY6,Q8HWN3,Q860S9,Q5Y7C5,Q3LTJ8,Q1G100,Q1G0Z8,Q06653,I6NVX3,I6M556,H8WV95,H6A2E5,H2BDR9,G9I2P4,G9HW13,G1EMX6,G1EMX4,G1CD91,G0ZMM9,G0ZMM8,G0ZDX1,F8R8N1,F8R8N0,F4YZX5,F4YZX4,F4YZX3,F4YZX2,F4YZX1,F4YZW3,F4YUA8,F2X654,F2VNW9,F2VNV6,F2VNV5,F2QL89,F1CCP7,F1CCN5,F1CCN2,F1CCL9,F0V6B9,E7BYD5,E3SWP0,E3SWN9,E3SWN8,E0X9M7,D9IFQ2,D7RIH8,D7NR21,D6MJL2,D6MJC0,D6BPR2,D5M8A0,D5M899,D5G2K8,D5FZP5,D5FZP4,D5FIF2,D5FIE9,D5FIE8,D5FIE7,D5FIE6,D5FIE4,D5FID9,D5FID8,D5FID7,D5FID6,D5FID2,D5FID0,D5FIC9,D5FIC8,D3U4F4,C8CJD1,B7VU65,A1Z0K9,A0N0W0	UPI000008A1F7		3/5							0/0				31.0			31.0	31.0	0.0	0/1	2			106.0	1,87,0,18		106.0	88.0	18.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
HLA-DRB1	3123	GRCh37	6	32557600	32557601			5'UTR	INS	-	-	C	rs1343244742	-	-	c.-82_-81insG			ENST00000360004	HLA-DRB1,5_prime_UTR_variant,,ENST00000360004,NM_002124.3;,regulatory_region_variant,,ENSR00000195691,;,TF_binding_site_variant,,ENSM00910732557,;,TF_binding_site_variant,,ENSM00523470620,;,TF_binding_site_variant,,ENSM00523157931,;	6:32557600-32557601	ENSG00000196126	ENST00000360004.5	Transcript	YES	25-26	-	-	-	-	rs1343244742	5_prime_UTR_variant	MODIFIER		-1	HGNC	4948	protein_coding	CCDS47409.1	ENSP00000353099	Q9GIY3,P04229,Q29974,P01911	M9PAL6,M9PAH4,M9PAH2,M9PA34,M9P9N9,M9P9N6,M9P978,M9P8M8,M9P8M7,Q9TQ40,Q9MYD9,Q95HN3,Q8WMA1,Q8MGY6,Q8HWN3,Q860S9,Q5Y7C5,Q3LTJ8,Q1G100,Q1G0Z8,Q06653,I6NVX3,I6M556,H8WV95,H6A2E5,H2BDR9,G9I2P4,G9HW13,G1EMX6,G1EMX4,G1CD91,G0ZMM9,G0ZMM8,G0ZDX1,F8R8N1,F8R8N0,F4YZX5,F4YZX4,F4YZX3,F4YZX2,F4YZX1,F4YZW3,F4YUA8,F2X654,F2VNW9,F2VNV6,F2VNV5,F2QL89,F1CCP7,F1CCN5,F1CCN2,F1CCL9,F0V6B9,E7BYD5,E3SWP0,E3SWN9,E3SWN8,E0X9M7,D9IFQ2,D7RIH8,D7NR21,D6MJL2,D6MJC0,D6BPR2,D5M8A0,D5M899,D5G2K8,D5FZP5,D5FZP4,D5FIF2,D5FIE9,D5FIE8,D5FIE7,D5FIE6,D5FIE4,D5FID9,D5FID8,D5FID7,D5FID6,D5FID2,D5FID0,D5FIC9,D5FIC8,D3U4F4,C8CJD1,B7VU65,A1Z0K9,A0N0W0	UPI000008A1F7	1/6								0/0				42.0			42.0	42.0	0.0	0/1	2			68.0	1,57,0,10		68.0	58.0	10.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
PTP4A1	7803	GRCh37	6	64289939	64289940			Intron	DEL	TT	TT	-	rs56188808	TT	TT	c.405-23_405-22del			ENST00000370651	PTP4A1,intron_variant,,ENST00000370650,;PTP4A1,intron_variant,,ENST00000370651,NM_003463.4;PTP4A1,downstream_gene_variant,,ENST00000578299,;PTP4A1,downstream_gene_variant,,ENST00000470661,;PTP4A1,downstream_gene_variant,,ENST00000473334,;	6:64289939-64289940	ENSG00000112245	ENST00000370651.3	Transcript	YES	-	-	-	-	-	rs56188808	intron_variant	MODIFIER		1	HGNC	9634	protein_coding	CCDS4965.1	ENSP00000359685	Q93096		UPI00000227B8		5/5				0.4399	0.4494	gnomAD_AFR	0/0				36.0		0.0	36.0	36.0	0.0	0/3	2			22.0	29,2,4,1	3.0	22.0	31.0	5.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
COX7A2	1347	GRCh37	6	75950110	75950110			Intron	DEL	A	A	-	rs56897555	A	A	c.205-9del			ENST00000370081	COX7A2,intron_variant,,ENST00000230459,NM_001865.3;COX7A2,intron_variant,,ENST00000370081,;COX7A2,intron_variant,,ENST00000370089,;COX7A2,intron_variant,,ENST00000377978,;COX7A2,intron_variant,,ENST00000460985,;COX7A2,intron_variant,,ENST00000472311,;COX7A2,intron_variant,,ENST00000509698,;COX7A2,intron_variant,,ENST00000459637,;COX7A2,downstream_gene_variant,,ENST00000481061,;	6:75950110	ENSG00000112695	ENST00000370081.2	Transcript	YES	-	-	-	-	-	rs56897555	intron_variant	MODIFIER		-1	HGNC	2288	protein_coding	CCDS34486.2	ENSP00000359098		H0UI06	UPI000015A446		3/4				0.4179	0.4475	gnomAD_FIN	0/0				45.0		0.0	45.0	45.0	0.0	0/2	2			27.0	6,32,1,6	5.0	27.0	38.0	7.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
CASP8AP2	0	GRCh37	6	90577712	90577728			RNA	DEL	CTTTGCCCAGACATGGA	CTTTGCCCAGACATGGA	-	rs537929246	CTTTGCCCAGACATGGA	CTTTGCCCAGACATGGA	n.6140_6156del			ENST00000551025	CASP8AP2,non_coding_transcript_exon_variant,,ENST00000551025,;CASP8AP2,non_coding_transcript_exon_variant,,ENST00000237177,;CASP8AP2,intron_variant,,ENST00000548224,;	6:90577712-90577728	ENSG00000118412	ENST00000551025.1	Transcript	YES	6140-6156	-	-	-	-	rs537929246	non_coding_transcript_exon_variant	MODIFIER		1	HGNC	1510	processed_transcript						8/9		0.0809	0.01062	0.06093	0.06008	0.1471	EUR	0/0				36.0			36.0	36.0	0.0	0/1	2			71.0	18,37,3,13		71.0	55.0	16.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
HACE1	57531	GRCh37	6	105300084	105300085			Intron	INS	-	TT	TT	rs67205678	-	-	c.131+107_131+108insAA			ENST00000262903	HACE1,intron_variant,,ENST00000262903,NM_020771.3;HACE1,intron_variant,,ENST00000369125,;HACE1,intron_variant,,ENST00000519645,;HACE1,intron_variant,,ENST00000524020,;HACE1,intron_variant,,ENST00000416605,;HACE1,intron_variant,,ENST00000521962,;	6:105300084-105300085	ENSG00000085382	ENST00000262903.4	Transcript	YES	-	-	-	-	-	rs67205678	intron_variant	MODIFIER		-1	HGNC	21033	protein_coding	CCDS5050.1	ENSP00000262903	Q8IYU2	E5RFX0,E3W983	UPI00001602DC		2/23					0.0924	EUR	0/0				6.0		9.0	6.0	6.0	0.0	1/1	2			30.0	26,3,20,3	8.0	30.0	29.0	23.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ROS1	6098	GRCh37	6	117631463	117631464			Intron	INS	-	-	TAA	rs2243387	-	-	c.6234-22_6234-20dup			ENST00000368508	ROS1,intron_variant,,ENST00000368507,;ROS1,intron_variant,,ENST00000368508,NM_002944.2;	6:117631463-117631464	ENSG00000047936	ENST00000368508.3	Transcript	YES	-	-	-	-	-	rs2243387	intron_variant	MODIFIER		-1	HGNC	10261	protein_coding	CCDS5116.1	ENSP00000357494	P08922		UPI000013D467		39/42		0.152	0.1452	0.1896	0.2975	gnomAD_EAS	0/0				21.0		1.0	21.0	21.0	0.0	0/1	2			25.0	5,20,2,5	5.0	25.0	25.0	7.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
SYNE1	23345	GRCh37	6	152765727	152765728			Intron	INS	-	-	A	rs111322292	-	-	c.3670-14dup			ENST00000367255	SYNE1,intron_variant,,ENST00000265368,;SYNE1,intron_variant,,ENST00000341594,;SYNE1,intron_variant,,ENST00000367248,;SYNE1,intron_variant,,ENST00000367253,;SYNE1,intron_variant,,ENST00000367255,NM_182961.3;SYNE1,intron_variant,,ENST00000413186,;SYNE1,intron_variant,,ENST00000423061,NM_033071.3;SYNE1,intron_variant,,ENST00000448038,;SYNE1,intron_variant,,ENST00000461872,;	6:152765727	ENSG00000131018	ENST00000367255.5	Transcript	YES	-	-	-	-	-	rs111322292	intron_variant	MODIFIER	uncertain_significance	-1	HGNC	17089	protein_coding	CCDS5236.2	ENSP00000356224	Q8NF91		UPI000204AF58		29/145		0.09769	0.07297	0.08854	0.133	gnomAD_AFR	0/0						0.0			0.0	0/1	2					5.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
SYNJ2	8871	GRCh37	6	158484692	158484702			Intron	DEL	AAAAAAAAAAA	AAAAAAAAAAA	-	rs71298907	AAAAAAAAAAA	AAAAAAAAAAA	c.1128-114_1128-104del			ENST00000355585	SYNJ2,intron_variant,,ENST00000355585,NM_001178088.1,NM_003898.3;SYNJ2,intron_variant,,ENST00000367121,;SYNJ2,intron_variant,,ENST00000367122,;SYNJ2,intron_variant,,ENST00000449859,;SYNJ2,intron_variant,,ENST00000485863,;	6:158484692-158484702	ENSG00000078269	ENST00000355585.4	Transcript	YES	-	-	-	-	-	rs71298907	intron_variant	MODIFIER		1	HGNC	11504	protein_coding	CCDS5254.1	ENSP00000347792	O15056	B4DLC4	UPI000006E2F8		8/26							0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
QKI	9444	GRCh37	6	163899795	163899795			Intron	DEL	T	T	-	rs761851020	T	T	c.286-17del			ENST00000361752	QKI,intron_variant,,ENST00000275262,;QKI,intron_variant,,ENST00000361195,;QKI,intron_variant,,ENST00000361752,NM_006775.2,NM_206855.2,NM_206854.2,NM_206853.2;QKI,intron_variant,,ENST00000392127,;QKI,intron_variant,,ENST00000424802,;QKI,intron_variant,,ENST00000453779,;QKI,intron_variant,,ENST00000537041,;QKI,intron_variant,,ENST00000537124,;QKI,intron_variant,,ENST00000537883,;QKI,intron_variant,,ENST00000544436,;QKI,intron_variant,,ENST00000544823,;QKI,intron_variant,,ENST00000361758,;QKI,intron_variant,,ENST00000545346,;QKI,intron_variant,,ENST00000545607,;	6:163899795	ENSG00000112531	ENST00000361752.3	Transcript	YES	-	-	-	-	-	rs761851020	intron_variant	MODIFIER		1	HGNC	21100	protein_coding	CCDS5285.1	ENSP00000355094	Q96PU8	F5H8C8,F5H5U6,F5GYM3	UPI0000029EBD		2/7		0.1432	0.06338	0.1541	0.2523	gnomAD_AFR	0/0				36.0		0.0	36.0	36.0	0.0	0/2	2			22.0	24,2,3,0	3.0	22.0	26.0	3.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
CADPS2	93664	GRCh37	7	122269208	122269208			Intron	DEL	T	T	-	rs796823921	T	T	c.867+94del			ENST00000449022	CADPS2,intron_variant,,ENST00000313070,;CADPS2,intron_variant,,ENST00000334010,NM_001167940.1;CADPS2,intron_variant,,ENST00000412584,NM_001009571.3;CADPS2,intron_variant,,ENST00000449022,NM_017954.10;	7:122269208	ENSG00000081803	ENST00000449022.2	Transcript	YES	-	-	-	-	-	rs796823921	intron_variant	MODIFIER		-1	HGNC	16018	protein_coding	CCDS55158.1	ENSP00000398481	Q86UW7	B3KNS2	UPI0000668808		4/29							0/0						0.0			0.0	0/1	2					4.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
CNOT4	4850	GRCh37	7	135099045	135099045			Intron	DEL	A	A	-	rs567428044	A	A	c.561+35del			ENST00000541284	CNOT4,intron_variant,,ENST00000315544,NM_001190848.1;CNOT4,intron_variant,,ENST00000356162,;CNOT4,intron_variant,,ENST00000361528,;CNOT4,intron_variant,,ENST00000414802,;CNOT4,intron_variant,,ENST00000423368,NM_001190847.1,NM_013316.3;CNOT4,intron_variant,,ENST00000428680,NM_001008225.2;CNOT4,intron_variant,,ENST00000451834,;CNOT4,intron_variant,,ENST00000541284,NM_001190849.1,NM_001190850.1;,regulatory_region_variant,,ENSR00001733471,;	7:135099045	ENSG00000080802	ENST00000541284.1	Transcript	YES	-	-	-	-	-	rs567428044	intron_variant	MODIFIER		-1	HGNC	7880	protein_coding	CCDS55165.1	ENSP00000445508	O95628		UPI00004166A8		5/11				0.3464	0.3852	gnomAD_SAS	0/0						0.0			0.0	0/1	2					9.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
TPK1	27010	GRCh37	7	144532829	144532830			Intron	INS	-	-	G	rs111798915	-	-	c.-16-119dup			ENST00000360057	TPK1,intron_variant,,ENST00000360057,NM_022445.3;TPK1,intron_variant,,ENST00000378099,NM_001042482.1;TPK1,intron_variant,,ENST00000552881,;TPK1,intron_variant,,ENST00000548460,;TPK1,intron_variant,,ENST00000378098,;,regulatory_region_variant,,ENSR00000219489,;,TF_binding_site_variant,,ENSM00907117766,;	7:144532829-144532830	ENSG00000196511	ENST00000360057.3	Transcript	YES	-	-	-	-	-	rs111798915	intron_variant	MODIFIER		-1	HGNC	17358	protein_coding	CCDS5888.1	ENSP00000353165	Q9H3S4	Q75MX1,F8VRJ6	UPI000004FD50		1/8					0.4569	AFR	0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
SMARCD3	6604	GRCh37	7	150937075	150937075			Intron	DEL	T	T	-	rs552440384	T	T	c.1173+123del			ENST00000262188	SMARCD3,intron_variant,,ENST00000262188,NM_001003801.1;SMARCD3,intron_variant,,ENST00000356800,NM_001003802.1;SMARCD3,intron_variant,,ENST00000392811,NM_003078.3;CHPF2,downstream_gene_variant,,ENST00000035307,NM_019015.1;CHPF2,downstream_gene_variant,,ENST00000482173,;SMARCD3,downstream_gene_variant,,ENST00000491651,;CHPF2,downstream_gene_variant,,ENST00000495645,NM_001284295.1;MIR671,downstream_gene_variant,,ENST00000390183,;RP4-548D19.3,upstream_gene_variant,,ENST00000607902,;SMARCD3,downstream_gene_variant,,ENST00000460431,;SMARCD3,downstream_gene_variant,,ENST00000477169,;SMARCD3,downstream_gene_variant,,ENST00000489503,;SMARCD3,upstream_gene_variant,,ENST00000496530,;SMARCD3,intron_variant,,ENST00000469154,;SMARCD3,intron_variant,,ENST00000470588,;SMARCD3,intron_variant,,ENST00000472789,;CHPF2,downstream_gene_variant,,ENST00000465601,;SMARCD3,downstream_gene_variant,,ENST00000472103,;SMARCD3,downstream_gene_variant,,ENST00000472988,;SMARCD3,downstream_gene_variant,,ENST00000485592,;SMARCD3,downstream_gene_variant,,ENST00000485610,;	7:150937075	ENSG00000082014	ENST00000262188.8	Transcript	YES	-	-	-	-	-	rs552440384	intron_variant	MODIFIER		-1	HGNC	11108	protein_coding	CCDS34780.1	ENSP00000262188	Q6STE5		UPI000022D4B4		10/12					0.3869	EAS	0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
RP1	6101	GRCh37	8	55542731	55542748			In_Frame_Del	DEL	TTTGAAATGCTTGGTCAA	TTTGAAATGCTTGGTCAA	-	novel	TTTGAAATGCTTGGTCAA	TTTGAAATGCTTGGTCAA	c.6289_6306del	p.Phe2097_Gln2102del	p.F2097_Q2102del	ENST00000220676	RP1,inframe_deletion,p.Phe2097_Gln2102del,ENST00000220676,NM_006269.1;	8:55542731-55542748	ENSG00000104237	ENST00000220676.1	Transcript	YES	6437-6454	6289-6306	2097-2102	FEMLGQ/-	TTTGAAATGCTTGGTCAA/-	-	inframe_deletion	MODERATE		1	HGNC	10263	protein_coding	CCDS6160.1	ENSP00000220676	P56715	A0FDN2	UPI000013455B	4/4								0/0		0,0	73,73	58.0		73.0	58.0	73.0	0.0	0/1	2	7,7	27,27	30.0	21,9,3,4	27.0	30.0	27.0	7.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ATAD2	29028	GRCh37	8	124382377	124382377			Intron	DEL	A	A	-	rs563477611	A	A	c.728-113del			ENST00000287394	ATAD2,intron_variant,,ENST00000287394,NM_014109.3;ATAD2,intron_variant,,ENST00000521903,;ATAD2,upstream_gene_variant,,ENST00000534257,;ATAD2,intron_variant,,ENST00000517666,;ATAD2,intron_variant,,ENST00000519124,;ATAD2,intron_variant,,ENST00000521496,;ATAD2,downstream_gene_variant,,ENST00000530065,;	8:124382377	ENSG00000156802	ENST00000287394.5	Transcript	YES	-	-	-	-	-	rs563477611	intron_variant	MODIFIER		-1	HGNC	30123	protein_coding	CCDS6343.1	ENSP00000287394	Q6PL18		UPI0000052A8C		6/27							0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ZCCHC7	84186	GRCh37	9	37305830	37305831			Intron	DEL	AT	AT	-	rs3837244	AT	AT	c.951+136_951+137del			ENST00000336755	ZCCHC7,intron_variant,,ENST00000336755,NM_032226.2;ZCCHC7,intron_variant,,ENST00000534928,;ZCCHC7,intron_variant,,ENST00000461038,;ZCCHC7,intron_variant,,ENST00000463625,;ZCCHC7,intron_variant,,ENST00000488607,;	9:37305830-37305831	ENSG00000147905	ENST00000336755.5	Transcript	YES	-	-	-	-	-	rs3837244	intron_variant	MODIFIER		1	HGNC	26209	protein_coding	CCDS6608.2	ENSP00000337839	Q8N3Z6	B4E024	UPI0000036027		5/8							0/0				7.0		0.0	7.0	7.0	0.0	0/1	2			12.0	0,12,0,2	3.0	12.0	12.0	2.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
IARS	3376	GRCh37	9	95039957	95039957			Intron	DEL	A	A	-	rs34636470	A	A	c.894+188del			ENST00000375643	IARS,intron_variant,,ENST00000375629,;IARS,intron_variant,,ENST00000375643,NM_013417.3;IARS,intron_variant,,ENST00000395554,;IARS,intron_variant,,ENST00000443024,NM_002161.5;IARS,intron_variant,,ENST00000447699,;IARS,downstream_gene_variant,,ENST00000498025,;	9:95039957	ENSG00000196305	ENST00000375643.3	Transcript	YES	-	-	-	-	-	rs34636470	intron_variant	MODIFIER		-1	HGNC	5330	protein_coding	CCDS6694.1	ENSP00000364794	P41252	Q9P1N9,Q7L4K8,Q5TCD1,Q5TCC4,Q59G75,J3KR24	UPI0000141335		9/33					0.4667	AFR	0/0				6.0		0.0	6.0	6.0	0.0	0/1	2			6.0	6,0,2,0	3.0	6.0	6.0	2.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
CIZ1	25792	GRCh37	9	130950345	130950347			Intron	DEL	CCC	CCC	-	rs370607901	CCC	CCC	c.287-134_287-132del			ENST00000393608	CIZ1,intron_variant,,ENST00000277465,;CIZ1,intron_variant,,ENST00000324544,;CIZ1,intron_variant,,ENST00000325721,;CIZ1,intron_variant,,ENST00000357558,NM_001131017.1;CIZ1,intron_variant,,ENST00000372938,NM_001131016.1;CIZ1,intron_variant,,ENST00000372948,NM_001131015.1;CIZ1,intron_variant,,ENST00000372954,NM_001131018.1;CIZ1,intron_variant,,ENST00000393608,NM_012127.2;CIZ1,intron_variant,,ENST00000415526,;CIZ1,intron_variant,,ENST00000420484,;CIZ1,intron_variant,,ENST00000538431,NM_001257975.1;CIZ1,intron_variant,,ENST00000541172,NM_001257976.1;CIZ1,intron_variant,,ENST00000467178,;CIZ1,intron_variant,,ENST00000474442,;CIZ1,intron_variant,,ENST00000476727,;CIZ1,intron_variant,,ENST00000488559,;CIZ1,intron_variant,,ENST00000491954,;CIZ1,intron_variant,,ENST00000498156,;	9:130950345-130950347	ENSG00000148337	ENST00000393608.1	Transcript	YES	-	-	-	-	-	rs370607901	intron_variant	MODIFIER		-1	HGNC	16744	protein_coding	CCDS6894.1	ENSP00000377232	Q9ULV3	Q9Y3F8,F6WSM2,F6VD24,B0EXJ7	UPI0000141722		3/16							0/0				7.0	0,7,0,0		7.0	7.0	0.0	0/1	2			7.0	0,4,0,3		7.0	4.0	3.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
C9orf96	169436	GRCh37	9	136249409	136249412			Intron	DEL	AATG	AATG	G	rs375935698	AATG	AATG	c.175-231_175-229del			ENST00000371957	C9orf96,intron_variant,,ENST00000371955,;C9orf96,intron_variant,,ENST00000371957,NM_153710.4;C9orf96,intron_variant,,ENST00000426926,;C9orf96,intron_variant,,ENST00000468046,;C9orf96,intron_variant,,ENST00000475232,;	9:136249407-136249412	ENSG00000198870	ENST00000371957.3	Transcript	YES	-	-	-	-	-	rs375935698	intron_variant	MODIFIER		1	HGNC	28669	protein_coding	CCDS35169.1	ENSP00000361025	Q8NE28		UPI00001D763E		2/17							0/0				21.0			21.0	21.0	0.0	0/1	2			14.0	12,0,8,0		14.0	12.0	8.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
NELFB	25920	GRCh37	9	140161636	140161642			Intron	DEL	GGCTGAG	GGCTGAG	AG	rs544060553	GGCTGAG	GGCTGAG	c.1239-56_1239-52del			ENST00000343053	NELFB,intron_variant,,ENST00000343053,NM_015456.3;	9:140161632-140161642	ENSG00000188986	ENST00000343053.4	Transcript	YES	-	-	-	-	-	rs33923321	intron_variant	MODIFIER		1	HGNC	24324	protein_coding	CCDS7040.1	ENSP00000339495	Q8WX92		UPI0000070699		9/12					0.0514	AFR	0/0				15.0		0.0	15.0	15.0	0.0	0/2	2			20.0	7,11,1,4	4.0	20.0	18.0	5.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
GATA3	2625	GRCh37	10	8115955	8115956			Frame_Shift_Ins	INS	-	-	CC	novel	-	-	c.1307_1308dup	p.Ser437ProfsTer40	p.S437Pfs*40	ENST00000379328	GATA3,frameshift_variant,p.Ser437ProfsTer40,ENST00000379328,NM_001002295.1,NM_002051.2;GATA3,frameshift_variant,p.Ser436ProfsTer40,ENST00000346208,;GATA3,non_coding_transcript_exon_variant,,ENST00000461472,;	10:8115955-8115956	ENSG00000107485	ENST00000379328.3	Transcript	YES	1872-1873	1304-1305	435	H/HX	cac/caCCc	-	frameshift_variant	HIGH		1	HGNC	4172	protein_coding	CCDS31143.1	ENSP00000368632	P23771		UPI000002AA34	6/6								0/0		0,0	58,58	69.0		58.0	69.0	58.0	0.0	0/1	2	30,30	65,66	107.0	24,72,8,20	65.0	107.0	65.0	30.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
NAMPTL	0	GRCh37	10	36811687	36811688			3'UTR	INS	-	-	GT	rs143754208	-	-	c.*55_*56dup			ENST00000440465	NAMPTL,splice_region_variant,,ENST00000543053,;NAMPTL,3_prime_UTR_variant,,ENST00000440465,;	10:36811687-36811688	ENSG00000229644	ENST00000440465.1	Transcript	YES	1475-1476	-	-	-	-	rs143754208	3_prime_UTR_variant	MODIFIER		-1	HGNC	17633	protein_coding		ENSP00000407952		Q658Z1,Q5SYT8,F5H246	UPI00004701B5	1/1						0.1876	AFR	0/0				77.0		0.0	77.0	77.0	0.0	0/1	2			95.0	97,3,24,0	11.0	95.0	100.0	24.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
PLAU	5328	GRCh37	10	75672607	75672608			Intron	INS	-	-	AA	rs61567551	-	-	c.194-64_194-63dup			ENST00000372764	PLAU,intron_variant,,ENST00000372762,;PLAU,intron_variant,,ENST00000372764,NM_002658.3;C10orf55,intron_variant,,ENST00000409178,NM_001001791.2;C10orf55,intron_variant,,ENST00000412307,;PLAU,intron_variant,,ENST00000446342,NM_001145031.1;PLAU,intron_variant,,ENST00000481390,;PLAU,intron_variant,,ENST00000494287,;PLAU,downstream_gene_variant,,ENST00000496926,;,regulatory_region_variant,,ENSR00000029888,;	10:75672607-75672608	ENSG00000122861	ENST00000372764.3	Transcript	YES	-	-	-	-	-	rs61567551	intron_variant	MODIFIER		1	HGNC	9052	protein_coding	CCDS7339.1	ENSP00000361850	P00749	S4R3G7,Q9UEJ5,Q96SE8	UPI000013CB02		4/10					0.5586	EUR	0/0				16.0		0.0	16.0	16.0	0.0	0/2	2			13.0	14,2,9,2	4.0	13.0	16.0	11.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
KCNMA1	3778	GRCh37	10	78839127	78839128			Intron	INS	-	-	GTGT	rs68133946	-	-	c.1593+108_1593+111dup			ENST00000404857	KCNMA1,intron_variant,,ENST00000286627,NM_002247.3,NM_001271519.1;KCNMA1,intron_variant,,ENST00000286628,NM_001161352.1;KCNMA1,intron_variant,,ENST00000354353,;KCNMA1,intron_variant,,ENST00000372403,;KCNMA1,intron_variant,,ENST00000372408,;KCNMA1,intron_variant,,ENST00000372421,;KCNMA1,intron_variant,,ENST00000372437,;KCNMA1,intron_variant,,ENST00000372440,;KCNMA1,intron_variant,,ENST00000372443,;KCNMA1,intron_variant,,ENST00000404771,;KCNMA1,intron_variant,,ENST00000404857,NM_001161353.1;KCNMA1,intron_variant,,ENST00000406533,;KCNMA1,intron_variant,,ENST00000428546,;KCNMA1,intron_variant,,ENST00000434208,;KCNMA1,intron_variant,,ENST00000450795,;KCNMA1,intron_variant,,ENST00000457953,;KCNMA1,intron_variant,,ENST00000604624,NM_001271518.1,NM_001014797.2;KCNMA1,intron_variant,,ENST00000484343,;KCNMA1,intron_variant,,ENST00000484507,;,regulatory_region_variant,,ENSR00001524269,;	10:78839127-78839128	ENSG00000156113	ENST00000404857.1	Transcript	YES	-	-	-	-	-	rs68133946	intron_variant	MODIFIER		-1	HGNC	6284	protein_coding	CCDS53545.1	ENSP00000385806	Q12791		UPI00003519E8		13/27					0.3313	EAS	0/0						0.0			0.0	0/2	2					7.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ARHGEF12	23365	GRCh37	11	120348771	120348772			Intron	INS	-	-	T	rs368383611	-	-	c.3533-82dup			ENST00000397843	ARHGEF12,intron_variant,,ENST00000356641,NM_001198665.1;ARHGEF12,intron_variant,,ENST00000397843,NM_015313.2;ARHGEF12,intron_variant,,ENST00000532993,;ARHGEF12,intron_variant,,ENST00000526067,;ARHGEF12,downstream_gene_variant,,ENST00000528681,;ARHGEF12,downstream_gene_variant,,ENST00000529970,;ARHGEF12,downstream_gene_variant,,ENST00000531616,;	11:120348771-120348772	ENSG00000196914	ENST00000397843.2	Transcript	YES	-	-	-	-	-	rs368383611	intron_variant	MODIFIER		1	HGNC	14193	protein_coding	CCDS41727.1	ENSP00000380942	Q9NZN5	E9PMR6	UPI00000708ED		36/40							0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
TSFM	10102	GRCh37	12	58187017	58187017			Intron	DEL	T	T	-	rs947862578	T	T	c.634+170del			ENST00000323833	TSFM,intron_variant,,ENST00000323833,NM_001172696.1;TSFM,intron_variant,,ENST00000350762,;TSFM,intron_variant,,ENST00000454289,NM_005726.5;TSFM,intron_variant,,ENST00000457189,;TSFM,intron_variant,,ENST00000540550,NM_001172695.1;TSFM,intron_variant,,ENST00000543727,NM_001172697.1;TSFM,intron_variant,,ENST00000548851,;TSFM,intron_variant,,ENST00000550559,;AVIL,downstream_gene_variant,,ENST00000257861,NM_006576.3;TSFM,downstream_gene_variant,,ENST00000434359,;AVIL,downstream_gene_variant,,ENST00000537081,;TSFM,intron_variant,,ENST00000497617,;AVIL,downstream_gene_variant,,ENST00000546952,;AVIL,downstream_gene_variant,,ENST00000549851,;AVIL,downstream_gene_variant,,ENST00000551248,;	12:58187017	ENSG00000123297	ENST00000323833.8	Transcript	YES	-	-	-	-	-	rs947862578	intron_variant	MODIFIER		1	HGNC	12367	protein_coding	CCDS53809.1	ENSP00000313877	P43897		UPI000002A8C3		6/6							0/0				24.0		0.0	24.0	24.0	0.0	0/1	2			19.0	1,19,0,3	3.0	19.0	20.0	3.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
GLIPR1	11010	GRCh37	12	75893479	75893479			3'UTR	DEL	A	A	-	rs35207358	A	A	c.*733del			ENST00000266659	GLIPR1,3_prime_UTR_variant,,ENST00000266659,NM_006851.2;KRR1,3_prime_UTR_variant,,ENST00000229214,NM_007043.6;KRR1,downstream_gene_variant,,ENST00000438169,;GLIPR1,downstream_gene_variant,,ENST00000456650,;GLIPR1,downstream_gene_variant,,ENST00000550491,;GLIPR1,downstream_gene_variant,,ENST00000536703,;KRR1,downstream_gene_variant,,ENST00000551070,;	12:75893479	ENSG00000111615	ENST00000229214.4	Transcript	YES	1280	-	-	-	-	rs35207358	3_prime_UTR_variant	MODIFIER		-1	HGNC	5176	protein_coding	CCDS9012.1	ENSP00000229214	Q13601		UPI00001403EE	10/10						0.5216	AMR	0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
NR1H4	9971	GRCh37	12	100930181	100930181			Intron	DEL	T	T	-	rs113077673	T	T	c.763-99del			ENST00000551379	NR1H4,intron_variant,,ENST00000188403,NM_001206993.1,NM_001206992.1;NR1H4,intron_variant,,ENST00000392986,;NR1H4,intron_variant,,ENST00000548884,NM_005123.3,NM_001206977.1,NM_001206979.1;NR1H4,intron_variant,,ENST00000549996,NM_001206978.1;NR1H4,intron_variant,,ENST00000551379,;NR1H4,intron_variant,,ENST00000321046,;	12:100930181	ENSG00000012504	ENST00000551379.1	Transcript	YES	-	-	-	-	-	rs113077673	intron_variant	MODIFIER		1	HGNC	7967	protein_coding	CCDS55876.1	ENSP00000447149	Q96RI1	B7Z423	UPI000006E701		4/8							0/0				21.0		0.0	21.0	21.0	0.0	0/1	2			16.0	16,0,3,0	3.0	16.0	16.0	3.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ANKRD13A	88455	GRCh37	12	110463769	110463770			Intron	INS	-	-	T	rs748271339	-	-	c.883+156dup			ENST00000261739	ANKRD13A,intron_variant,,ENST00000261739,NM_033121.1;ANKRD13A,intron_variant,,ENST00000547639,;C12orf76,downstream_gene_variant,,ENST00000546651,;ANKRD13A,upstream_gene_variant,,ENST00000547419,;ANKRD13A,upstream_gene_variant,,ENST00000551491,;ANKRD13A,downstream_gene_variant,,ENST00000550404,;ANKRD13A,intron_variant,,ENST00000546476,;ANKRD13A,intron_variant,,ENST00000553025,;ANKRD13A,upstream_gene_variant,,ENST00000549826,;ANKRD13A,upstream_gene_variant,,ENST00000553251,;	12:110463769-110463770	ENSG00000076513	ENST00000261739.4	Transcript	YES	-	-	-	-	-	rs748271339	intron_variant	MODIFIER		1	HGNC	21268	protein_coding	CCDS9140.1	ENSP00000261739	Q8IZ07	Q3ZTS7,B4DDL0,B3KMT9	UPI000004472C		8/14							0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
TGDS	23483	GRCh37	13	95227139	95227141			Intron	DEL	AAG	AAG	-	rs201674028	AAG	AAG	c.983-35_983-33del			ENST00000261296	TGDS,intron_variant,,ENST00000261296,NM_014305.2;TGDS,downstream_gene_variant,,ENST00000498294,;TGDS,downstream_gene_variant,,ENST00000470480,;	13:95227138-95227141	ENSG00000088451	ENST00000261296.5	Transcript	YES	-	-	-	-	-	rs373864754	intron_variant	MODIFIER		-1	HGNC	20324	protein_coding	CCDS9471.1	ENSP00000261296	O95455	Q2TU31	UPI000006E8F4		11/11		0.07436	0.02589	0.03093	0.1043	gnomAD_AFR	0/0				18.0		3.0	18.0	18.0	0.0	0/2	2			44.0	3,31,2,8	0.0	44.0	34.0	10.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
FAM177A1	283635	GRCh37	14	35515607	35515608			5'Flank	DEL	GG	GG	-	rs4007475	GG	GG				ENST00000280987	FAM177A1,5_prime_UTR_variant,,ENST00000382406,;FAM177A1,intron_variant,,ENST00000396472,NM_001079519.1;FAM177A1,intron_variant,,ENST00000555211,;FAM177A1,upstream_gene_variant,,ENST00000280987,NM_173607.3;FAM177A1,upstream_gene_variant,,ENST00000554052,;FAM177A1,upstream_gene_variant,,ENST00000553852,;FAM177A1,upstream_gene_variant,,ENST00000553955,;FAM177A1,upstream_gene_variant,,ENST00000556858,;,regulatory_region_variant,,ENSR00000067618,;,TF_binding_site_variant,,ENSM00529338732,;,TF_binding_site_variant,,ENSM00522874412,;,TF_binding_site_variant,,ENSM00642279804,;	14:35515607-35515608	ENSG00000151327	ENST00000280987.4	Transcript	YES	-	-	-	-	-	rs4007475	upstream_gene_variant	MODIFIER		1	HGNC	19829	protein_coding	CCDS9653.2	ENSP00000280987	Q8N128	G3V583,G3V3Z5	UPI00005A8F3C									0/0				4.0		0.0	4.0	4.0	0.0	0/1	2			7.0	6,0,6,0	4.0	7.0	6.0	6.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
RGS6	9628	GRCh37	14	72941206	72941207			Intron	INS	-	-	A	rs141283571	-	-	c.619-127_619-126insA			ENST00000553525	RGS6,intron_variant,,ENST00000343854,NM_001204419.1;RGS6,intron_variant,,ENST00000355512,;RGS6,intron_variant,,ENST00000402788,NM_001204423.1;RGS6,intron_variant,,ENST00000404301,;RGS6,intron_variant,,ENST00000406236,;RGS6,intron_variant,,ENST00000407322,;RGS6,intron_variant,,ENST00000434263,;RGS6,intron_variant,,ENST00000553525,NM_001204424.1;RGS6,intron_variant,,ENST00000553530,NM_004296.5,NM_001204422.1,NM_001204421.1,NM_001204418.1,NM_001204417.1,NM_001204420.1;RGS6,intron_variant,,ENST00000554782,;RGS6,intron_variant,,ENST00000555571,;RGS6,intron_variant,,ENST00000556437,NM_001204416.1;RGS6,intron_variant,,ENST00000555368,;RGS6,downstream_gene_variant,,ENST00000553690,;RGS6,intron_variant,,ENST00000554474,;RGS6,intron_variant,,ENST00000554734,;	14:72941206-72941207	ENSG00000182732	ENST00000553525.1	Transcript	YES	-	-	-	-	-	rs141283571	intron_variant	MODIFIER		1	HGNC	10002	protein_coding	CCDS55924.1	ENSP00000451030	P49758	Q59FJ8	UPI00001698D0		9/17							0/0				9.0			9.0	9.0	0.0	0/1	2			105.0	67,1,39,1		105.0	68.0	40.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ATXN3	4287	GRCh37	14	92563255	92563255			Intron	DEL	T	T	-	rs398026196	T	T	c.25-73del			ENST00000393287	ATXN3,intron_variant,,ENST00000340660,NM_030660.4;ATXN3,intron_variant,,ENST00000393287,;ATXN3,intron_variant,,ENST00000429774,NM_001127696.1,NM_001164779.1,NM_001164782.1;ATXN3,intron_variant,,ENST00000502250,NM_001164780.1;ATXN3,intron_variant,,ENST00000503767,;ATXN3,intron_variant,,ENST00000506466,;ATXN3,intron_variant,,ENST00000532032,;ATXN3,intron_variant,,ENST00000545170,NM_004993.5,NM_001164776.1,NM_001164778.1,NM_001164774.1,NM_001164777.1;ATXN3,intron_variant,,ENST00000553491,NM_001127697.2;ATXN3,intron_variant,,ENST00000554592,;ATXN3,intron_variant,,ENST00000554672,;ATXN3,intron_variant,,ENST00000555381,NM_001164781.1;ATXN3,intron_variant,,ENST00000556220,;ATXN3,intron_variant,,ENST00000557311,;ATXN3,upstream_gene_variant,,ENST00000526872,;ATXN3,intron_variant,,ENST00000504047,;ATXN3,intron_variant,,ENST00000511362,;ATXN3,intron_variant,,ENST00000553287,;ATXN3,intron_variant,,ENST00000553309,;ATXN3,intron_variant,,ENST00000553498,;ATXN3,intron_variant,,ENST00000553686,;ATXN3,intron_variant,,ENST00000554040,;ATXN3,intron_variant,,ENST00000554214,;ATXN3,intron_variant,,ENST00000554491,;ATXN3,intron_variant,,ENST00000555958,;ATXN3,intron_variant,,ENST00000556339,;ATXN3,intron_variant,,ENST00000556644,;ATXN3,upstream_gene_variant,,ENST00000526245,;ATXN3,intron_variant,,ENST00000359366,;ATXN3,intron_variant,,ENST00000454964,;ATXN3,intron_variant,,ENST00000507965,;ATXN3,intron_variant,,ENST00000515746,;ATXN3,intron_variant,,ENST00000553488,;ATXN3,intron_variant,,ENST00000553570,;ATXN3,intron_variant,,ENST00000554350,;ATXN3,intron_variant,,ENST00000554673,;ATXN3,intron_variant,,ENST00000554994,;ATXN3,intron_variant,,ENST00000555816,;ATXN3,intron_variant,,ENST00000556082,;ATXN3,intron_variant,,ENST00000556274,;ATXN3,intron_variant,,ENST00000556288,;ATXN3,intron_variant,,ENST00000556315,;ATXN3,intron_variant,,ENST00000556374,;ATXN3,intron_variant,,ENST00000556671,;ATXN3,intron_variant,,ENST00000556898,;ATXN3,intron_variant,,ENST00000556958,;ATXN3,intron_variant,,ENST00000557030,;	14:92563255	ENSG00000066427	ENST00000393287.5	Transcript	YES	-	-	-	-	-	rs398026196	intron_variant	MODIFIER		-1	HGNC	7106	protein_coding	CCDS9900.1	ENSP00000376965	P54252	G3V4F4,G3V2G2,D3VVM7,D3VVL3,D3VVJ0,D3VVF1,D3VVD5,D3VVC1	UPI000013D23A		1/10				0.3785	0.4519	SAS	0/0				24.0		0.0	24.0	24.0	0.0	0/2	2			32.0	0,35,0,6	3.0	32.0	35.0	6.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
HERC2	8924	GRCh37	15	28473275	28473276			Intron	INS	-	-	A	rs367658561	-	-	c.5464+88dup			ENST00000261609	HERC2,intron_variant,,ENST00000261609,NM_004667.5;HERC2,intron_variant,,ENST00000569335,;	15:28473275-28473276	ENSG00000128731	ENST00000261609.7	Transcript	YES	-	-	-	-	-	rs367658561	intron_variant	MODIFIER		-1	HGNC	4868	protein_coding	CCDS10021.1	ENSP00000261609	O95714		UPI00004578F7		35/92							0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
KIAA1199	57214	GRCh37	15	81187287	81187288			Intron	INS	-	-	A	rs370268279	-	-	c.1087-44dup			ENST00000394685	KIAA1199,intron_variant,,ENST00000220244,NM_018689.1;KIAA1199,intron_variant,,ENST00000356249,;KIAA1199,intron_variant,,ENST00000394685,;RP11-351M8.1,downstream_gene_variant,,ENST00000560560,;RP11-351M8.1,downstream_gene_variant,,ENST00000561295,;RP11-351M8.2,downstream_gene_variant,,ENST00000560873,;RP11-351M8.1,downstream_gene_variant,,ENST00000558261,;	15:81187287	ENSG00000103888	ENST00000394685.3	Transcript	YES	-	-	-	-	-	rs370268279	intron_variant	MODIFIER		1	HGNC	29213	protein_coding	CCDS10315.1	ENSP00000378177	Q8WUJ3		UPI00001D7799		10/29		0.08071	0.06227	0.003945	0.08071	AA	0/0						0.0			0.0	0/2	2					4.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
NTRK3	4916	GRCh37	15	88690737	88690757			Intron	DEL	CTTCTTCTTCTTCTTCTTCTT	CTTCTTCTTCTTCTTCTTCTT	-	rs34299110	CTTCTTCTTCTTCTTCTTCTT	CTTCTTCTTCTTCTTCTTCTT	c.396-123_396-103del			ENST00000360948	NTRK3,intron_variant,,ENST00000317501,NM_001007156.2;NTRK3,intron_variant,,ENST00000355254,;NTRK3,intron_variant,,ENST00000357724,;NTRK3,intron_variant,,ENST00000360948,NM_001012338.2;NTRK3,intron_variant,,ENST00000394480,NM_002530.3,NM_001243101.1;NTRK3,intron_variant,,ENST00000540489,;NTRK3,intron_variant,,ENST00000542733,;NTRK3,intron_variant,,ENST00000557856,;NTRK3,intron_variant,,ENST00000558676,;NTRK3,intron_variant,,ENST00000559188,;MED28P6,upstream_gene_variant,,ENST00000558776,;	15:88690737-88690757	ENSG00000140538	ENST00000360948.2	Transcript	YES	-	-	-	-	-	rs34299110	intron_variant	MODIFIER		-1	HGNC	8033	protein_coding	CCDS32322.1	ENSP00000354207	Q16288	R4GNH5	UPI000006DC82		4/18					0.7466	AFR	0/0		0,0	12,12	18.0		0.0	18.0	12.0	0.0	0/1	2	5,5	5,6	27.0	0,28,0,4	4.0	27.0	5.0	5.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
DECR2	26063	GRCh37	16	460579	460579			Intron	DEL	T	T	-	rs11315123	T	T	c.463-112del			ENST00000219481	DECR2,intron_variant,,ENST00000219481,NM_020664.3;DECR2,intron_variant,,ENST00000424398,;DECR2,downstream_gene_variant,,ENST00000397710,;DECR2,intron_variant,,ENST00000461947,;DECR2,downstream_gene_variant,,ENST00000461802,;DECR2,intron_variant,,ENST00000429116,;DECR2,intron_variant,,ENST00000437024,;DECR2,intron_variant,,ENST00000439661,;DECR2,intron_variant,,ENST00000445291,;DECR2,intron_variant,,ENST00000461749,;DECR2,intron_variant,,ENST00000469922,;NME4,downstream_gene_variant,,ENST00000444498,;DECR2,downstream_gene_variant,,ENST00000465166,;	16:460579	ENSG00000242612	ENST00000219481.5	Transcript	YES	-	-	-	-	-	rs11315123	intron_variant	MODIFIER		1	HGNC	2754	protein_coding	CCDS10409.1	ENSP00000219481	Q9NUI1	Q9H3W9	UPI000003BBDC		5/8	0.5094				0.5908	AMR	0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
PIGQ	9091	GRCh37	16	628995	628998			Intron	DEL	GGGC	GGGC	-	rs3842719	GGGC	GGGC	c.1223+62_1223+65del			ENST00000026218	PIGQ,intron_variant,,ENST00000026218,NM_148920.2;PIGQ,intron_variant,,ENST00000321878,NM_004204.3;PIGQ,intron_variant,,ENST00000409527,;PIGQ,downstream_gene_variant,,ENST00000293874,;PIGQ,downstream_gene_variant,,ENST00000409439,;PIGQ,downstream_gene_variant,,ENST00000422307,;PIGQ,downstream_gene_variant,,ENST00000439574,;PIGQ,downstream_gene_variant,,ENST00000470411,;PIGQ,upstream_gene_variant,,ENST00000540241,;PIGQ,upstream_gene_variant,,ENST00000540548,;PIGQ,downstream_gene_variant,,ENST00000544860,;PIGQ,intron_variant,,ENST00000420990,;PIGQ,intron_variant,,ENST00000443147,;PIGQ,intron_variant,,ENST00000480424,;PIGQ,upstream_gene_variant,,ENST00000476438,;PIGQ,downstream_gene_variant,,ENST00000537901,;,regulatory_region_variant,,ENSR00000371231,;	16:628995-628998	ENSG00000007541	ENST00000026218.5	Transcript	YES	-	-	-	-	-	rs3842719	intron_variant	MODIFIER		1	HGNC	14135	protein_coding	CCDS10411.1	ENSP00000026218	Q9BRB3	J3QTH6,B8ZZC7,B8ZZ31,B8ZZ29	UPI000006CC88		6/9					0.6359	EAS	0/0				17.0		0.0	17.0	17.0	0.0	0/1	2			41.0	0,41,0,19	7.0	41.0	41.0	19.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
MGRN1	23295	GRCh37	16	4700319	4700319			Intron	DEL	A	A	-	rs373572089	A	A	c.89-30del			ENST00000262370	MGRN1,intron_variant,,ENST00000262370,NM_015246.3;MGRN1,intron_variant,,ENST00000399577,NM_001142290.2;MGRN1,intron_variant,,ENST00000415496,NM_001142291.2,NM_001142289.2;MGRN1,intron_variant,,ENST00000586183,;MGRN1,intron_variant,,ENST00000587747,;MGRN1,intron_variant,,ENST00000588994,;MGRN1,intron_variant,,ENST00000591895,;MGRN1,upstream_gene_variant,,ENST00000590790,;MGRN1,upstream_gene_variant,,ENST00000593224,;MGRN1,intron_variant,,ENST00000536343,;,regulatory_region_variant,,ENSR00000371576,;,regulatory_region_variant,,ENSR00001583164,;	16:4700319	ENSG00000102858	ENST00000262370.7	Transcript	YES	-	-	-	-	-	rs373572089	intron_variant	MODIFIER		1	HGNC	20254	protein_coding	CCDS42115.1	ENSP00000262370	O60291	K7ERA1	UPI000018CE7F		1/16				0.3604	0.3812	gnomAD_FIN	0/0				15.0		0.0	15.0	15.0	0.0	0/1	2			17.0	18,2,7,0	3.0	17.0	20.0	7.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
CSNK2A2	1459	GRCh37	16	58200465	58200466			Intron	DEL	CT	CT	-	rs112507755	CT	CT	c.827+22_827+23del			ENST00000262506	CSNK2A2,intron_variant,,ENST00000262506,NM_001896.2;CSNK2A2,intron_variant,,ENST00000563307,;CSNK2A2,intron_variant,,ENST00000567730,;CSNK2A2,intron_variant,,ENST00000566813,;	16:58200465-58200466	ENSG00000070770	ENST00000262506.3	Transcript	YES	-	-	-	-	-	rs112507755	intron_variant	MODIFIER		-1	HGNC	2459	protein_coding	CCDS10794.1	ENSP00000262506	P19784	H3BNI9	UPI0000000C95		9/11				0.2061	0.3128	gnomAD_SAS	0/0				142.0		7.0	142.0	142.0	0.0	0/1	2			126.0	96,30,9,4	13.0	126.0	126.0	13.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ADAD2	161931	GRCh37	16	84230068	84230080			Intron	DEL	CAACCCCTTCGCT	CAACCCCTTCGCT	-	rs3217260	CAACCCCTTCGCT	CAACCCCTTCGCT	c.1772+115_1772+127del			ENST00000268624	ADAD2,intron_variant,,ENST00000268624,NM_139174.3;ADAD2,intron_variant,,ENST00000315906,NM_001145400.1;ADAD2,downstream_gene_variant,,ENST00000567685,;RP11-486L19.2,intron_variant,,ENST00000536986,;RP11-486L19.2,intron_variant,,ENST00000565643,;RP11-486L19.2,intron_variant,,ENST00000569834,;RP11-486L19.2,upstream_gene_variant,,ENST00000561900,;ADAD2,downstream_gene_variant,,ENST00000567413,;ADAD2,intron_variant,,ENST00000564430,;ADAD2,intron_variant,,ENST00000566526,;ADAD2,upstream_gene_variant,,ENST00000563849,;ADAD2,downstream_gene_variant,,ENST00000564169,;ADAD2,downstream_gene_variant,,ENST00000569221,;,regulatory_region_variant,,ENSR00001589788,;	16:84230068-84230080	ENSG00000140955	ENST00000268624.3	Transcript	YES	-	-	-	-	-	rs3217260	intron_variant	MODIFIER		1	HGNC	30714	protein_coding	CCDS10944.1	ENSP00000268624	Q8NCV1	D3DUL6	UPI000013D7CA		9/10							0/0						0.0			0.0	0/1	2					4.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ADAD2	161931	GRCh37	16	84230083	84230090			Intron	DEL	ACCCCTTC	ACCCCTTC	-	rs770359859	ACCCCTTC	ACCCCTTC	c.1772+107_1772+114del			ENST00000268624	ADAD2,intron_variant,,ENST00000268624,NM_139174.3;ADAD2,intron_variant,,ENST00000315906,NM_001145400.1;ADAD2,downstream_gene_variant,,ENST00000567685,;RP11-486L19.2,intron_variant,,ENST00000536986,;RP11-486L19.2,intron_variant,,ENST00000565643,;RP11-486L19.2,intron_variant,,ENST00000569834,;RP11-486L19.2,upstream_gene_variant,,ENST00000561900,;ADAD2,downstream_gene_variant,,ENST00000567413,;ADAD2,intron_variant,,ENST00000564430,;ADAD2,intron_variant,,ENST00000566526,;ADAD2,upstream_gene_variant,,ENST00000563849,;ADAD2,downstream_gene_variant,,ENST00000564169,;ADAD2,downstream_gene_variant,,ENST00000569221,;,regulatory_region_variant,,ENSR00001589788,;	16:84230083-84230090	ENSG00000140955	ENST00000268624.3	Transcript	YES	-	-	-	-	-	rs770359859	intron_variant	MODIFIER		1	HGNC	30714	protein_coding	CCDS10944.1	ENSP00000268624	Q8NCV1	D3DUL6	UPI000013D7CA		9/10							0/0				10.0			10.0	10.0	0.0	0/1	2			12.0	8,0,4,0		12.0	8.0	4.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ADAD2	161931	GRCh37	16	84230092	84230096			Intron	DEL	CTCAA	CTCAA	-	rs879172869	CTCAA	CTCAA	c.1772+117_1772+121del			ENST00000268624	ADAD2,intron_variant,,ENST00000268624,NM_139174.3;ADAD2,intron_variant,,ENST00000315906,NM_001145400.1;ADAD2,downstream_gene_variant,,ENST00000567685,;RP11-486L19.2,intron_variant,,ENST00000536986,;RP11-486L19.2,intron_variant,,ENST00000565643,;RP11-486L19.2,intron_variant,,ENST00000569834,;RP11-486L19.2,upstream_gene_variant,,ENST00000561900,;ADAD2,downstream_gene_variant,,ENST00000567413,;ADAD2,intron_variant,,ENST00000564430,;ADAD2,intron_variant,,ENST00000566526,;ADAD2,upstream_gene_variant,,ENST00000563849,;ADAD2,downstream_gene_variant,,ENST00000564169,;ADAD2,downstream_gene_variant,,ENST00000569221,;,regulatory_region_variant,,ENSR00001589788,;	16:84230092-84230096	ENSG00000140955	ENST00000268624.3	Transcript	YES	-	-	-	-	-	rs879172869	intron_variant	MODIFIER		1	HGNC	30714	protein_coding	CCDS10944.1	ENSP00000268624	Q8NCV1	D3DUL6	UPI000013D7CA		9/10							0/0				12.0			12.0	12.0	0.0	0/1	2			11.0	7,0,4,0		11.0	7.0	4.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ACSF3	197322	GRCh37	16	89167075	89167076			5'UTR	INS	-	-	CCCAGGAGGCTCCCGGGAG	rs11273288	-	-	c.-14_-13insCCAGGAGGCTCCCGGGAGC			ENST00000317447	ACSF3,5_prime_UTR_variant,,ENST00000317447,NM_174917.3,NM_001127214.2,NM_001243279.1,NM_001284316.1;ACSF3,5_prime_UTR_variant,,ENST00000406948,;ACSF3,5_prime_UTR_variant,,ENST00000537290,;ACSF3,5_prime_UTR_variant,,ENST00000541755,;ACSF3,intron_variant,,ENST00000378345,;ACSF3,intron_variant,,ENST00000537895,;ACSF3,intron_variant,,ENST00000540697,;ACSF3,upstream_gene_variant,,ENST00000538340,;ACSF3,upstream_gene_variant,,ENST00000543676,;ACSF3,upstream_gene_variant,,ENST00000544543,;ACSF3,5_prime_UTR_variant,,ENST00000542688,;	16:89167075-89167076	ENSG00000176715	ENST00000317447.4	Transcript	YES	363-364	-	-	-	-	rs11273288	5_prime_UTR_variant	MODIFIER	benign	1	HGNC	27288	protein_coding	CCDS10974.1	ENSP00000320646	Q4G176	H3BTS0,F5H755,F5H5A1,F5H3B2,F5H362,F5GX20	UPI00001AF19E	3/11			0.5032	0.6828		0.7233	AMR	0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
YWHAE	7531	GRCh37	17	1264612	1264612			Intron	DEL	A	A	-	rs55734488	A	A	c.372-20del			ENST00000264335	YWHAE,intron_variant,,ENST00000264335,NM_006761.4;YWHAE,intron_variant,,ENST00000571732,;YWHAE,intron_variant,,ENST00000573026,;YWHAE,intron_variant,,ENST00000575977,;YWHAE,upstream_gene_variant,,ENST00000496706,;YWHAE,intron_variant,,ENST00000466227,;YWHAE,intron_variant,,ENST00000573196,;YWHAE,downstream_gene_variant,,ENST00000469398,;YWHAE,downstream_gene_variant,,ENST00000486241,;YWHAE,downstream_gene_variant,,ENST00000489287,;,regulatory_region_variant,,ENSR00001590983,;	17:1264612	ENSG00000108953	ENST00000264335.8	Transcript	YES	-	-	-	-	-	rs55734488	intron_variant	MODIFIER		-1	HGNC	12851	protein_coding	CCDS11001.1	ENSP00000264335	P62258	B7ZA86	UPI0000021A46		3/5				0.4478	0.5202	AMR	0/0				26.0		0.0	26.0	26.0	0.0	0/1	2			32.0	4,28,1,9	5.0	32.0	32.0	10.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
MNT	4335	GRCh37	17	2297572	2297573			Intron	DEL	CA	CA	-	rs35367394	CA	CA	c.695+26_695+27del			ENST00000174618	MNT,intron_variant,,ENST00000174618,NM_020310.2;MNT,intron_variant,,ENST00000575394,;MNT,upstream_gene_variant,,ENST00000571232,;MNT,downstream_gene_variant,,ENST00000571836,;MNT,upstream_gene_variant,,ENST00000572892,;MNT,downstream_gene_variant,,ENST00000574559,;MNT,upstream_gene_variant,,ENST00000575374,;MNT,upstream_gene_variant,,ENST00000575402,;,regulatory_region_variant,,ENSR00000282087,;	17:2297572-2297573	ENSG00000070444	ENST00000174618.4	Transcript	YES	-	-	-	-	-	rs35367394	intron_variant	MODIFIER		-1	HGNC	7188	protein_coding	CCDS11018.1	ENSP00000174618	Q99583	K7ES66	UPI000012F2C6		3/5							0/0						0.0			0.0	0/1	2					7.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
SPATA22	84690	GRCh37	17	3352494	3352495			Intron	INS	-	-	A	rs35147573	-	-	c.330-52dup			ENST00000573128	SPATA22,intron_variant,,ENST00000268981,NM_001170699.1;SPATA22,intron_variant,,ENST00000355380,NM_001170696.1;SPATA22,intron_variant,,ENST00000397168,NM_032598.4;SPATA22,intron_variant,,ENST00000541913,;SPATA22,intron_variant,,ENST00000571553,;SPATA22,intron_variant,,ENST00000571607,;SPATA22,intron_variant,,ENST00000572582,;SPATA22,intron_variant,,ENST00000572969,NM_001170698.1;SPATA22,intron_variant,,ENST00000573128,;SPATA22,intron_variant,,ENST00000574051,;SPATA22,intron_variant,,ENST00000574797,;SPATA22,intron_variant,,ENST00000575375,NM_001170697.1,NM_001170695.1;	17:3352494-3352495	ENSG00000141255	ENST00000573128.1	Transcript	YES	-	-	-	-	-	rs35147573	intron_variant	MODIFIER		-1	HGNC	30705	protein_coding	CCDS11027.1	ENSP00000459580	Q8NHS9	I3L517,I3L4D7,I3L2B9,I3L1L5	UPI0000140D16		5/8		0.1994	0.1555	0.1589	0.4187	EAS	0/0				26.0		0.0	26.0	26.0	0.0	0/1	2			20.0	0,20,0,11	3.0	20.0	20.0	11.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
CHRNE	1145	GRCh37	17	4802256	4802275			Intron	DEL	GCCTCTGCCTCGCTCCACCC	GCCTCTGCCTCGCTCCACCC	-	rs147753790	GCCTCTGCCTCGCTCCACCC	GCCTCTGCCTCGCTCCACCC	c.1326+21_1326+40del			ENST00000293780	CHRNE,intron_variant,,ENST00000293780,NM_000080.3;MINK1,downstream_gene_variant,,ENST00000347992,NM_170663.4;MINK1,downstream_gene_variant,,ENST00000355280,NM_001024937.3,NM_015716.4,NM_153827.4;C17orf107,upstream_gene_variant,,ENST00000381365,NM_001145536.1;MINK1,downstream_gene_variant,,ENST00000453408,;C17orf107,upstream_gene_variant,,ENST00000521575,;MINK1,downstream_gene_variant,,ENST00000576037,;CHRNE,downstream_gene_variant,,ENST00000575637,;CHRNE,intron_variant,,ENST00000572438,;MINK1,downstream_gene_variant,,ENST00000571207,;MINK1,downstream_gene_variant,,ENST00000572304,;MINK1,downstream_gene_variant,,ENST00000572330,;MINK1,downstream_gene_variant,,ENST00000574453,;MINK1,downstream_gene_variant,,ENST00000574871,;MINK1,downstream_gene_variant,,ENST00000575511,;,regulatory_region_variant,,ENSR00000090557,;	17:4802256-4802275	ENSG00000108556	ENST00000293780.4	Transcript	YES	-	-	-	-	-	rs147753790	intron_variant	MODIFIER		-1	HGNC	1966	protein_coding	CCDS11058.1	ENSP00000293780	Q04844	Q8N731	UPI0000125262		11/11		0.02746	0.07156	0.1776	0.5296	gnomAD_EAS	0/0				5.0		0.0	5.0	5.0	0.0	0/1	2			13.0	4,9,1,3	6.0	13.0	13.0	4.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
SCPEP1	59342	GRCh37	17	55075671	55075671			Intron	DEL	A	A	-	rs367630962	A	A	c.881-75del			ENST00000262288	SCPEP1,intron_variant,,ENST00000262288,NM_021626.2;SCPEP1,intron_variant,,ENST00000573239,;SCPEP1,downstream_gene_variant,,ENST00000575395,;AC007114.1,upstream_gene_variant,,ENST00000580911,;SCPEP1,downstream_gene_variant,,ENST00000571345,;SCPEP1,downstream_gene_variant,,ENST00000571898,;SCPEP1,non_coding_transcript_exon_variant,,ENST00000570479,;SCPEP1,non_coding_transcript_exon_variant,,ENST00000570505,;SCPEP1,intron_variant,,ENST00000575423,;SCPEP1,intron_variant,,ENST00000576154,;SCPEP1,downstream_gene_variant,,ENST00000570480,;SCPEP1,downstream_gene_variant,,ENST00000570589,;SCPEP1,downstream_gene_variant,,ENST00000572591,;SCPEP1,downstream_gene_variant,,ENST00000573789,;	17:55075671	ENSG00000121064	ENST00000262288.3	Transcript	YES	-	-	-	-	-	rs367630962	intron_variant	MODIFIER		1	HGNC	29507	protein_coding	CCDS11593.1	ENSP00000262288	Q9HB40	I3L506	UPI0000038BD2		9/12							0/0				31.0		0.0	31.0	31.0	0.0	0/2	2			36.0	41,0,7,0	8.0	36.0	41.0	7.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
APPBP2	10513	GRCh37	17	58525217	58525217			Intron	DEL	A	A	-	rs572924329	A	A	c.1505-22del			ENST00000083182	APPBP2,intron_variant,,ENST00000083182,NM_006380.2,NM_001282476.1;APPBP2,intron_variant,,ENST00000589341,;	17:58525217	ENSG00000062725	ENST00000083182.3	Transcript	YES	-	-	-	-	-	rs572924329	intron_variant	MODIFIER		-1	HGNC	622	protein_coding	CCDS32699.1	ENSP00000083182	Q92624	K7EIZ9	UPI000006D959		12/12		0.2135	0.22	0.2813	0.3088	gnomAD_SAS	0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ABCA6	23460	GRCh37	17	67101528	67101528			Intron	DEL	C	C	-	rs920437473	C	C	c.2740+75del			ENST00000284425	ABCA6,intron_variant,,ENST00000284425,NM_080284.2;ABCA6,non_coding_transcript_exon_variant,,ENST00000590311,;ABCA6,downstream_gene_variant,,ENST00000589803,;	17:67101528	ENSG00000154262	ENST00000284425.2	Transcript	YES	-	-	-	-	-	rs920437473	intron_variant	MODIFIER		-1	HGNC	36	protein_coding	CCDS11683.1	ENSP00000284425	Q8N139		UPI000013DD9D		20/38							0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
DNAH17	8632	GRCh37	17	76456460	76456460			Intron	INS	A	A	GCA	novel	A	A	c.9298-121_9298-120insGC			ENST00000389840	DNAH17,intron_variant,,ENST00000389840,;DNAH17,intron_variant,,ENST00000585328,NM_173628.3;DNAH17,intron_variant,,ENST00000586052,;DNAH17,upstream_gene_variant,,ENST00000592152,;DNAH17,intron_variant,,ENST00000591369,;	17:76456455-76456460	ENSG00000187775	ENST00000389840.5	Transcript	YES	-	-	-	-	-	-	intron_variant	MODIFIER		-1	HGNC	2946	protein_coding		ENSP00000374490	Q9UFH2		UPI0001A5EE11		58/80							0/0				34.0			34.0	34.0	0.0	0/2	2			38.0	0,37,0,7		38.0	37.0	7.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ATP5A1	498	GRCh37	18	43666304	43666305			Intron	INS	-	-	T	rs1555694804	-	-	c.1284+48_1284+49insA			ENST00000282050	ATP5A1,intron_variant,,ENST00000282050,NM_001001937.1;ATP5A1,intron_variant,,ENST00000398752,NM_004046.5,NM_001001935.2;ATP5A1,intron_variant,,ENST00000590665,NM_001257334.1;ATP5A1,intron_variant,,ENST00000593152,NM_001257335.1;ATP5A1,downstream_gene_variant,,ENST00000589252,;ATP5A1,downstream_gene_variant,,ENST00000589869,;ATP5A1,downstream_gene_variant,,ENST00000590324,;ATP5A1,downstream_gene_variant,,ENST00000590406,;ATP5A1,downstream_gene_variant,,ENST00000592989,;ATP5A1,non_coding_transcript_exon_variant,,ENST00000586523,;ATP5A1,intron_variant,,ENST00000586592,;ATP5A1,intron_variant,,ENST00000587902,;ATP5A1,intron_variant,,ENST00000590156,;ATP5A1,intron_variant,,ENST00000592364,;ATP5A1,downstream_gene_variant,,ENST00000585650,;ATP5A1,downstream_gene_variant,,ENST00000589611,;ATP5A1,downstream_gene_variant,,ENST00000590448,;ATP5A1,downstream_gene_variant,,ENST00000591981,;	18:43666281-43666304	ENSG00000152234	ENST00000282050.2	Transcript	YES	-	-	-	-	-	rs146099416,COSV56359510	intron_variant	MODIFIER		-1	HGNC	823	protein_coding	CCDS11927.1	ENSP00000282050	P25705	K7EQH4,K7ERX7,K7EK77,K7EJP1,B4DGW3	UPI000006221A		10/12	0.1669				0.3405	SAS	0/0				25.0		36.0	25.0	25.0	0.0	0/2	2			15.0	4,6,3,2	35.0	15.0	10.0	5.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ZNF57	126295	GRCh37	19	2901115	2901124			Intron	DEL	GCCGAAGTCT	GCCGAAGTCT	-	rs11279103	GCCGAAGTCT	GCCGAAGTCT	c.3+71_3+80del			ENST00000306908	ZNF57,intron_variant,,ENST00000306908,NM_173480.2;AC119403.1,upstream_gene_variant,,ENST00000590960,;,regulatory_region_variant,,ENSR00000105958,;	19:2901115-2901124	ENSG00000171970	ENST00000306908.5	Transcript	YES	-	-	-	-	-	rs11279103	intron_variant	MODIFIER		1	HGNC	13125	protein_coding	CCDS12098.1	ENSP00000303696	Q68EA5	K7ERB8,G3V131,E5RHE3,A5HJR3	UPI000006FE5C		1/3		0.6039	0.8337		0.8777	EUR	0/0				4.0		0.0	4.0	4.0	0.0	0/1	2			18.0	2,16,1,5	5.0	18.0	18.0	6.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ANKRD24	170961	GRCh37	19	4199809	4199810			Intron	INS	-	-	A	rs112892199	-	-	c.123+43_123+44insA			ENST00000600132	ANKRD24,intron_variant,,ENST00000262970,;ANKRD24,intron_variant,,ENST00000318934,;ANKRD24,intron_variant,,ENST00000597689,;ANKRD24,intron_variant,,ENST00000600132,NM_133475.1;ANKRD24,intron_variant,,ENST00000595928,;,regulatory_region_variant,,ENSR00001154223,;,regulatory_region_variant,,ENSR00001608547,;	19:4199809-4199810	ENSG00000089847	ENST00000600132.1	Transcript	YES	-	-	-	-	-	rs112892199	intron_variant	MODIFIER		1	HGNC	29424	protein_coding	CCDS45925.1	ENSP00000471252	Q8TF21		UPI000041F5A9		3/21	0.3622	0.3898	0.4136	0.3727	0.4804	gnomAD_FIN	0/0		0,0	3,3	3.0		0.0	3.0	3.0	0.0	0/1	2	7,7	1,1	8.0	5,2,5,2	5.0	8.0	1.0	7.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
EPS15L1	58513	GRCh37	19	16513358	16513358			Intron	DEL	T	T	-	rs34782743	T	T	c.1627-62del			ENST00000455140	EPS15L1,intron_variant,,ENST00000248070,NM_021235.2;EPS15L1,intron_variant,,ENST00000455140,NM_001258374.1;EPS15L1,intron_variant,,ENST00000535753,NM_001258375.1;EPS15L1,intron_variant,,ENST00000594975,;EPS15L1,intron_variant,,ENST00000597937,NM_001258376.1;EPS15L1,intron_variant,,ENST00000599790,;EPS15L1,intron_variant,,ENST00000602009,;RN7SL844P,upstream_gene_variant,,ENST00000473320,;EPS15L1,intron_variant,,ENST00000592031,;EPS15L1,intron_variant,,ENST00000602022,;	19:16513358	ENSG00000127527	ENST00000455140.2	Transcript	YES	-	-	-	-	-	rs34782743	intron_variant	MODIFIER		-1	HGNC	24634	protein_coding	CCDS58654.1	ENSP00000393313	Q9UBC2		UPI0000D4C04A		15/23					0.184	SAS	0/0						0.0			0.0	0/1	2					4.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
SPTBN4	57731	GRCh37	19	41062903	41062903			Intron	DEL	C	C	-	rs34510741	C	C	c.5290-16del			ENST00000352632	SPTBN4,intron_variant,,ENST00000338932,;SPTBN4,intron_variant,,ENST00000352632,;SPTBN4,intron_variant,,ENST00000392023,NM_025213.2;SPTBN4,intron_variant,,ENST00000392025,;SPTBN4,intron_variant,,ENST00000595535,;SPTBN4,intron_variant,,ENST00000598249,NM_020971.2;SPTBN4,intron_variant,,ENST00000597389,;SPTBN4,downstream_gene_variant,,ENST00000596900,;	19:41062903	ENSG00000160460	ENST00000352632.3	Transcript	YES	-	-	-	-	-	rs34510741	intron_variant	MODIFIER		1	HGNC	14896	protein_coding	CCDS12559.1	ENSP00000263373	Q9H254		UPI0000135DBB		25/35				0.459	0.4639	gnomAD_AFR	0/0		0,0	13,13	20.0		0.0	20.0	13.0	0.0	0/1	2	13,13	14,14	46.0		9.0	46.0	14.0	13.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
SNX5	27131	GRCh37	20	17928176	17928178			In_Frame_Del	DEL	CTG	CTG	-	novel	CTG	CTG	c.1030_1032del	p.Gln344del	p.Q344del	ENST00000377768	SNX5,inframe_deletion,p.Gln344del,ENST00000377768,NM_152227.1;SNX5,inframe_deletion,p.Gln344del,ENST00000377759,NM_014426.2;SNX5,downstream_gene_variant,,ENST00000419004,;SNX5,downstream_gene_variant,,ENST00000431277,;SNX5,non_coding_transcript_exon_variant,,ENST00000483485,;SNX5,non_coding_transcript_exon_variant,,ENST00000490175,;SNX5,non_coding_transcript_exon_variant,,ENST00000476648,;SNX5,non_coding_transcript_exon_variant,,ENST00000491090,;SNX5,downstream_gene_variant,,ENST00000474883,;SNX5,downstream_gene_variant,,ENST00000494401,;SNX5,non_coding_transcript_exon_variant,,ENST00000463050,;SNX5,upstream_gene_variant,,ENST00000484809,;SNX5,upstream_gene_variant,,ENST00000606570,;	20:17928176-17928178	ENSG00000089006	ENST00000377768.3	Transcript	YES	1343-1345	1030-1032	344	Q/-	CAG/-	-	inframe_deletion	MODERATE		-1	HGNC	14969	protein_coding	CCDS13130.1	ENSP00000366998	Q9Y5X3		UPI0000135B43	12/14								0/0		0,0	249,249	255.0		249.0	255.0	249.0	0.0	0/1	2	69,70	239,239	330.0	240,90,49,17	239.0	330.0	239.0	69.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
DEFB124	245937	GRCh37	20	30060721	30060722			Intron	DEL	CA	CA	-	rs34150499	CA	CA	c.58+37_58+38del			ENST00000317676	DEFB124,intron_variant,,ENST00000317676,NM_001037500.1;REM1,upstream_gene_variant,,ENST00000201979,NM_014012.5;DEFB124,non_coding_transcript_exon_variant,,ENST00000481595,;	20:30060721-30060722	ENSG00000180383	ENST00000317676.2	Transcript	YES	-	-	-	-	-	rs34150499	intron_variant	MODIFIER		-1	HGNC	18104	protein_coding	CCDS33457.1	ENSP00000326309	Q8NES8		UPI00005E4A77		1/1				0.03977	0.0579	gnomAD_SAS	0/0		0,0	37,37	40.0		37.0	40.0	37.0	0.0	0/1	2	9,9	40,41	54.0	49,5,7,1	40.0	54.0	40.0	9.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
TPX2	22974	GRCh37	20	30354259	30354260			Intron	INS	-	-	GT	rs35700111	-	-	c.230-101_230-100dup			ENST00000300403	TPX2,intron_variant,,ENST00000300403,NM_012112.4;TPX2,intron_variant,,ENST00000340513,;	20:30354258-30354259	ENSG00000088325	ENST00000300403.6	Transcript	YES	-	-	-	-	-	rs35700111	intron_variant	MODIFIER		1	HGNC	1249	protein_coding	CCDS13190.1	ENSP00000300403	Q9ULW0	Q96FC3,Q643R0,B3KM90	UPI00000015BB		4/17							0/0				48.0		1.0	48.0	48.0	0.0	0/1	2			41.0	48,0,9,0	3.0	41.0	48.0	9.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
NCOA3	8202	GRCh37	20	46279834	46279836			In_Frame_Del	DEL	CAA	CAA	-	rs767107142	CAA	CAA	c.3762_3764del	p.Gln1276del	p.Q1276del	ENST00000371998	NCOA3,inframe_deletion,p.Gln1272del,ENST00000372004,NM_006534.3,NM_181659.2,NM_001174088.1,NM_001174087.1;NCOA3,inframe_deletion,p.Gln1202del,ENST00000341724,;NCOA3,inframe_deletion,p.Gln1267del,ENST00000371997,;NCOA3,inframe_deletion,p.Gln1276del,ENST00000371998,;	20:46279834-46279836	ENSG00000124151	ENST00000371998.3	Transcript	YES	3951-3953	3760-3762	1254	Q/-	CAA/-	rs767107142	inframe_deletion	MODERATE		1	HGNC	7670	protein_coding	CCDS13407.1	ENSP00000361066	Q9Y6Q9	Q569F6,B4DYT5	UPI000012FE45	20/23					0.0002913	0.002922	gnomAD_EAS	0/0				70.0			70.0	70.0	0.0	0/1	2			108.0	82,25,8,3		108.0	107.0	11.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
LTN1	26046	GRCh37	21	30338153	30338154			Intron	INS	-	-	A	rs71335064	-	-	c.2301+33dup			ENST00000389194	LTN1,intron_variant,,ENST00000361371,;LTN1,intron_variant,,ENST00000389194,NM_015565.2;LTN1,intron_variant,,ENST00000389195,;LTN1,downstream_gene_variant,,ENST00000483326,;	21:30338153-30338154	ENSG00000198862	ENST00000389194.2	Transcript	YES	-	-	-	-	-	rs71335064	intron_variant	MODIFIER		-1	HGNC	13082	protein_coding	CCDS33527.2	ENSP00000373846	O94822	G1UI34	UPI000049DF6C		11/29		0.07002	0.07561	0.1059	0.1603	gnomAD_SAS	0/0						0.0			0.0	0/1	2					3.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
IFNAR1	3454	GRCh37	21	34726106	34726107			Intron	INS	-	-	T	rs772509641	-	-	c.1440+24dup			ENST00000270139	IFNAR1,intron_variant,,ENST00000270139,NM_000629.2;IFNAR1,intron_variant,,ENST00000416947,;IFNAR1,intron_variant,,ENST00000442357,;	21:34726106-34726107	ENSG00000142166	ENST00000270139.3	Transcript	YES	-	-	-	-	-	rs772509641	intron_variant	MODIFIER		1	HGNC	5432	protein_coding	CCDS13624.1	ENSP00000270139	P17181	B4DNT3	UPI000006FE3C		10/10				5.992e-05	0.0001161	gnomAD_ASJ	0/0		0,0	191,191	229.0		191.0	229.0	191.0	0.0	0/1	2	57,57	148,148	253.0	47,204,14,36	148.0	253.0	148.0	57.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
DSCAM	1826	GRCh37	21	41384834	41384835			3'UTR	INS	-	-	TT	rs11451228	-	-	c.*125_*126dup			ENST00000400454	DSCAM,3_prime_UTR_variant,,ENST00000400454,NM_001271534.1,NM_001389.3;DSCAM,3_prime_UTR_variant,,ENST00000404019,;	21:41384834-41384835	ENSG00000171587	ENST00000400454.1	Transcript	YES	6643-6644	-	-	-	-	rs11451228	3_prime_UTR_variant	MODIFIER		-1	HGNC	3039	protein_coding	CCDS42929.1	ENSP00000383303	O60469		UPI00000422DF	33/33						0.3738	EUR	0/0				4.0		0.0	4.0	4.0	0.0	0/1	2			6.0	6,0,2,0	3.0	6.0	6.0	2.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
AIRE	326	GRCh37	21	45712358	45712358			Intron	DEL	C	C	-	rs5844181	C	C	c.1095+78del			ENST00000291582	AIRE,intron_variant,,ENST00000291582,NM_000383.3;AIRE,intron_variant,,ENST00000329347,;AIRE,intron_variant,,ENST00000355347,;AIRE,intron_variant,,ENST00000337909,;AIRE,intron_variant,,ENST00000397994,;AIRE,intron_variant,,ENST00000527919,;AIRE,intron_variant,,ENST00000530812,;	21:45712358	ENSG00000160224	ENST00000291582.5	Transcript	YES	-	-	-	-	-	rs5844181	intron_variant	MODIFIER		1	HGNC	360	protein_coding	CCDS13706.1	ENSP00000291582	O43918		UPI0000030FA6		9/13							0/0				3.0		0.0	3.0	3.0	0.0	0/1	2			8.0	0,7,0,4	4.0	8.0	7.0	4.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
OSBP2	23762	GRCh37	22	31301792	31301793			Intron	INS	-	-	GCCACC	rs201836388	-	-	c.2376-19_2376-14dup			ENST00000332585	OSBP2,intron_variant,,ENST00000332585,NM_030758.3;OSBP2,intron_variant,,ENST00000382310,;OSBP2,intron_variant,,ENST00000401475,NM_001282740.1;OSBP2,intron_variant,,ENST00000403222,NM_001282738.1;OSBP2,intron_variant,,ENST00000407373,;OSBP2,intron_variant,,ENST00000431368,;OSBP2,intron_variant,,ENST00000437268,NM_001282741.1;OSBP2,intron_variant,,ENST00000446658,NM_001282739.1;OSBP2,intron_variant,,ENST00000452656,;OSBP2,intron_variant,,ENST00000535268,NM_001282742.1;EIF4HP2,downstream_gene_variant,,ENST00000424380,;	22:31301792-31301793	ENSG00000184792	ENST00000332585.6	Transcript	YES	-	-	-	-	-	rs201836388	intron_variant	MODIFIER		1	HGNC	8504	protein_coding	CCDS43002.1	ENSP00000332576	Q969R2	C9JS84,C9J7J0	UPI0000161E15		12/13		0.007321	0.04166	0.03039	0.08495	gnomAD_ASJ	0/0						0.0			0.0	0/1	2					4.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ACO2	50	GRCh37	22	41918654	41918654			Intron	DEL	T	T	-	rs11331024	T	T	c.1139-179del			ENST00000216254	ACO2,intron_variant,,ENST00000216254,NM_001098.2;ACO2,intron_variant,,ENST00000396512,;POLR3H,downstream_gene_variant,,ENST00000355209,NM_001018050.2;POLR3H,downstream_gene_variant,,ENST00000396504,NM_138338.3,NM_001282885.1,NM_001282884.1;ACO2,downstream_gene_variant,,ENST00000466237,;	22:41918654	ENSG00000100412	ENST00000216254.4	Transcript	YES	-	-	-	-	-	rs11331024	intron_variant	MODIFIER		1	HGNC	118	protein_coding	CCDS14017.1	ENSP00000216254	Q99798	B4DZ08,B4DEC3	UPI000003CA3B		9/17					0.4308	AMR	0/0		0,0	2,2	2.0		0.0	2.0	2.0	0.0	0/1	2	4,4	0,0	4.0		4.0	4.0	0.0	4.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ACOT9	23597	GRCh37	X	23724676	23724678			Intron	DEL	AAA	AAA	-	rs35002168	AAA	AAA	c.842+67_842+69del			ENST00000379303	ACOT9,intron_variant,,ENST00000336430,NM_001033583.2;ACOT9,intron_variant,,ENST00000379295,;ACOT9,intron_variant,,ENST00000379303,NM_001037171.1;ACOT9,intron_variant,,ENST00000473710,;ACOT9,downstream_gene_variant,,ENST00000492081,;ACOT9,intron_variant,,ENST00000379297,;ACOT9,intron_variant,,ENST00000494361,;ACOT9,downstream_gene_variant,,ENST00000449612,;	X:23724676-23724678	ENSG00000123130	ENST00000379303.5	Transcript	YES	-	-	-	-	-	rs35002168	intron_variant	MODIFIER		-1	HGNC	17152	protein_coding	CCDS43924.1	ENSP00000368605	Q9Y305	Q9H2R8	UPI00003D7D31		11/15							0/0				28.0		0.0	28.0	28.0	0.0	0/1	2			20.0	26,0,3,0	3.0	20.0	26.0	3.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
PFKFB1	5207	GRCh37	X	54972154	54972155			Intron	INS	-	-	GT	rs779266579	-	-	c.994-180_994-179dup			ENST00000375006	PFKFB1,intron_variant,,ENST00000374992,;PFKFB1,intron_variant,,ENST00000375006,NM_001271804.1,NM_002625.3;PFKFB1,intron_variant,,ENST00000545676,NM_001271805.1;	X:54972154-54972155	ENSG00000158571	ENST00000375006.3	Transcript	YES	-	-	-	-	-	rs779266579	intron_variant	MODIFIER		-1	HGNC	8872	protein_coding	CCDS14364.1	ENSP00000364145	P16118	I1Z9G4,I1Z9G3	UPI000012A3ED		9/13							0/0				13.0			13.0	13.0	0.0	0/1	2			5.0	0,6,0,2		5.0	6.0	2.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
APEX2	27301	GRCh37	X	55027965	55027965			Intron	DEL	T	T	-	rs375803683	T	T	c.158-5del			ENST00000374987	APEX2,intron_variant,,ENST00000374987,NM_014481.3;PFKFB1,upstream_gene_variant,,ENST00000545676,NM_001271805.1;APEX2,intron_variant,,ENST00000471758,;,regulatory_region_variant,,ENSR00000246753,;	X:55027965	ENSG00000169188	ENST00000374987.3	Transcript	YES	-	-	-	-	-	rs375803683	intron_variant	MODIFIER		1	HGNC	17889	protein_coding	CCDS14365.1	ENSP00000364126	Q9UBZ4	E5KN95,B7ZA71	UPI0000071F5B		1/5		0.2698	0.0537	0.04282	0.3202	gnomAD_AFR	0/0						0.0			0.0	0/1	2					5.0				TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
MED12	9968	GRCh37	X	70361652	70361652			Intron	DEL	A	A	-	rs371432455	A	A	c.6409-81del			ENST00000374080	MED12,intron_variant,,ENST00000333646,NM_005120.2;MED12,intron_variant,,ENST00000374080,;MED12,intron_variant,,ENST00000374102,;NLGN3,upstream_gene_variant,,ENST00000358741,NM_181303.1;NLGN3,upstream_gene_variant,,ENST00000374051,NM_018977.3;NLGN3,upstream_gene_variant,,ENST00000395855,;MED12,downstream_gene_variant,,ENST00000444034,;NLGN3,upstream_gene_variant,,ENST00000536169,NM_001166660.1;AL590764.1,downstream_gene_variant,,ENST00000579622,;	X:70361652	ENSG00000184634	ENST00000374080.3	Transcript	YES	-	-	-	-	-	rs371432455	intron_variant	MODIFIER		1	HGNC	11957	protein_coding	CCDS43970.1	ENSP00000363193	Q93074	Q7Z2F4,Q7Z2F1,Q7Z2E0	UPI00004257E2		43/44					0.3407	EUR	0/0				39.0		0.0	39.0	39.0	0.0	0/2	2			35.0	38,7,20,2	5.0	35.0	45.0	22.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
PIH1D3	139212	GRCh37	X	106461964	106461964			Intron	DEL	A	A	-	rs1234164779	A	A	c.227-121del			ENST00000535523	PIH1D3,intron_variant,,ENST00000336387,;PIH1D3,intron_variant,,ENST00000372453,NM_173494.1;PIH1D3,intron_variant,,ENST00000535523,NM_001169154.1;	X:106461964	ENSG00000080572	ENST00000535523.1	Transcript	YES	-	-	-	-	-	rs1234164779	intron_variant	MODIFIER		1	HGNC	28570	protein_coding	CCDS14528.1	ENSP00000441930	Q9NQM4		UPI0000073CF5		4/7							0/0				23.0		0.0	23.0	23.0	0.0	0/1	2			13.0	14,0,3,0	3.0	13.0	14.0	3.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01
ELF4	2000	GRCh37	X	129203198	129203199			Intron	INS	-	-	A	rs367640579	-	-	c.1187+76dup			ENST00000308167	ELF4,intron_variant,,ENST00000308167,NM_001421.3;ELF4,intron_variant,,ENST00000335997,NM_001127197.1;ELF4,downstream_gene_variant,,ENST00000434609,;	X:129203198-129203199	ENSG00000102034	ENST00000308167.5	Transcript	YES	-	-	-	-	-	rs367640579	intron_variant	MODIFIER		-1	HGNC	3319	protein_coding	CCDS14617.1	ENSP00000311280	Q99607	B1AL80	UPI0000072B32		8/8							0/0				11.0		0.0	11.0	11.0	0.0	0/1	2			9.0	12,0,5,0	3.0	9.0	12.0	5.0	TCGA-A1-A0SD	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	01