genome.wustl.edu.TCGA-A1-A0SD.indel.0e81f9c986154ce89e59240c3f09534f.txt 7.94 KB
Newer Older
Pradat Yoann's avatar
Pradat Yoann committed
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99
Chromosome	Position	dbSNP_RS	Tumor_Seq_Allele1	Tumor_Seq_Allele2	Variant_Quality	Filter_VCF	n_GT	n_SS	n_TIR	n_TAR	n_DP	n_DP4	n_AD	n_depth	n_ref_count	n_alt_count	t_GT	t_SS	t_TIR	t_TAR	t_DP	t_DP4	t_AD	t_depth	t_ref_count	t_alt_count
1	24486218		T	TTTG			0/0				24			24.0	24.0	0.0	0/1	2			22	0,22,0,6		22.0	22.0	6.0
1	27107272		CGT	C			0/0		0,0	21,21	26		0	26.0	21.0	0.0	0/1	2	3,3	14,14	18	4,14,2,1	4	18.0	14.0	3.0
1	117122285		G	GTCC			0/0				8			8.0	8.0	0.0	0/1	2			16	4,12,1,6		16.0	16.0	7.0
1	171607569		CAG	C			0/0		0,0	12,12	15		12	15.0	12.0	0.0	0/1	2	4,4	7,7	11	10,1,3,1	7	11.0	7.0	4.0
1	175116046		C	CT,CTT			0/0				38		0	38.0	38.0	0.0	0/2	2			56	57,2,11,1	7	56.0	59.0	12.0
1	201981005		C	CA			0/0						0			0.0	0/1	2					3			
1	223284687		G	GA			0/0		0,0	91,91	93		91	93.0	91.0	0.0	0/1	2	37,37	35,36	78	32,46,18,19	35	78.0	35.0	37.0
1	226553491		AAAC	A,AAACA			0/0				12	12,0,0,0		12.0	12.0	0.0	0/1	2			9	4,0,5,0		9.0	4.0	5.0
2	11273407		GTC	G,GTCTC			0/0				9		0	9.0	9.0	0.0	0/2	2			23	24,2,7,1	4	23.0	26.0	8.0
2	42996759		AAGAG	A			0/0				5			5.0	5.0	0.0	0/1	2			11	11,0,7,0		11.0	11.0	7.0
2	55181022		TA	TAA,T			0/0				20		0	20.0	20.0	0.0	0/2	2			20	25,0,4,0	3	20.0	25.0	4.0
2	153471255		T	TCAAAA,TCAAAACAAAACAAAACAAAA			0/0				8		0	8.0	8.0	0.0	0/2	2			8	8,0,3,0	4	8.0	8.0	3.0
2	176988290		C	CGCA			0/0						0			0.0	0/1	2					12			
3	38355176		T	TGCGCGCGCGCGC,TGCGCGCGTGTGTGTGTGTGTGTGCGCGC			0/0				20		1	20.0	20.0	0.0	0/1	2			18	18,2,5,0	8	18.0	20.0	5.0
3	148711906		G	GT			0/0				26		0	26.0	26.0	0.0	0/1	2			22	21,2,1,1	4	22.0	23.0	2.0
3	164776647		T	TACACAC,TACAC,TACACACAC			0/0				44		0	44.0	44.0	0.0	0/2	2			19	25,0,9,0	3	19.0	25.0	9.0
3	195792288		CGGGG	C			0/0				7		0	7.0	7.0	0.0	0/1	2			11	11,0,5,0	5	11.0	11.0	5.0
3	195956726		AAG	A			0/0				50		0	50.0	50.0	0.0	0/1	2			75	70,5,9,1	8	75.0	75.0	10.0
4	100472247		T	TA			0/0				10	0,10,0,0		10.0	10.0	0.0	0/1	2			16	0,11,0,5		16.0	11.0	5.0
4	108608100		CTCTAACACT	C			0/0				8		34	8.0	8.0	0.0	1/1	2			48	48,0,39,0	42	48.0	48.0	39.0
4	121739411		GCACA	G			0/0						0			0.0	0/1	2					4			
5	1093609		G	GGGGCGGGGACT			0/0						0			0.0	0/1	2					18			
5	174940299		TAAAAAAAAAAAAA	T			0/0						0			0.0	0/1	2					3			
6	32487441		A	AC			0/0				4			4.0	4.0	0.0	1/1	2			20	2,18,2,18		20.0	20.0	20.0
6	32548732		C	CT			0/0				31			31.0	31.0	0.0	0/1	2			106	1,87,0,18		106.0	88.0	18.0
6	32557600		T	TC			0/0				42			42.0	42.0	0.0	0/1	2			68	1,57,0,10		68.0	58.0	10.0
6	64289938		ATT	AT,ATTT,A			0/0				36		0	36.0	36.0	0.0	0/3	2			22	29,2,4,1	3	22.0	31.0	5.0
6	75950109		TA	TAA,T,TAAA			0/0				45		0	45.0	45.0	0.0	0/2	2			27	6,32,1,6	5	27.0	38.0	7.0
6	90577711		TCTTTGCCCAGACATGGA	T			0/0				36			36.0	36.0	0.0	0/1	2			71	18,37,3,13		71.0	55.0	16.0
6	105300084		G	GTT			0/0				6		9	6.0	6.0	0.0	1/1	2			30	26,3,20,3	8	30.0	29.0	23.0
6	117631463		T	TTAA			0/0				21		1	21.0	21.0	0.0	0/1	2			25	5,20,2,5	5	25.0	25.0	7.0
6	152765726		GA	GAA,G			0/0						0			0.0	0/1	2					5			
6	158484691		CAAAAAAAAAAA	C			0/0						0			0.0	0/1	2					3			
6	163899794		CT	CTT,C			0/0				36		0	36.0	36.0	0.0	0/2	2			22	24,2,3,0	3	22.0	26.0	3.0
7	122269207		CT	C			0/0						0			0.0	0/1	2					4			
7	135099044		TA	T,TAA			0/0						0			0.0	0/1	2					9			
7	144532829		A	AG			0/0						0			0.0	0/1	2					3			
7	150937074		CT	C			0/0						0			0.0	0/1	2					3			
8	55542730		CTTTGAAATGCTTGGTCAA	C			0/0		0,0	73,73	58		73	58.0	73.0	0.0	0/1	2	7,7	27,27	30	21,9,3,4	27	30.0	27.0	7.0
8	124382376		TA	T			0/0						0			0.0	0/1	2					3			
9	37305829		GAT	G			0/0				7		0	7.0	7.0	0.0	0/1	2			12	0,12,0,2	3	12.0	12.0	2.0
9	95039956		TA	T			0/0				6		0	6.0	6.0	0.0	0/1	2			6	6,0,2,0	3	6.0	6.0	2.0
9	130950344		ACCC	A			0/0				7	0,7,0,0		7.0	7.0	0.0	0/1	2			7	0,4,0,3		7.0	4.0	3.0
9	136249406		GATAATG	GATG,GATATATG,GATA			0/0				21			21.0	21.0	0.0	0/1	2			14	12,0,8,0		14.0	12.0	8.0
9	140161631		TGTGGGGCTGAG	T,TGTGGAG			0/0				15		0	15.0	15.0	0.0	0/2	2			20	7,11,1,4	4	20.0	18.0	5.0
10	8115955		A	ACC			0/0		0,0	58,58	69		58	69.0	58.0	0.0	0/1	2	30,30	65,66	107	24,72,8,20	65	107.0	65.0	30.0
10	36811687		G	GGT			0/0				77		0	77.0	77.0	0.0	0/1	2			95	97,3,24,0	11	95.0	100.0	24.0
10	75672607		C	CA,CAA			0/0				16		0	16.0	16.0	0.0	0/2	2			13	14,2,9,2	4	13.0	16.0	11.0
10	78839127		A	AGT,AGTGT			0/0						0			0.0	0/2	2					7			
11	120348771		G	GT			0/0						0			0.0	0/1	2					3			
12	58187016		CT	C			0/0				24		0	24.0	24.0	0.0	0/1	2			19	1,19,0,3	3	19.0	20.0	3.0
12	75893478		CA	C			0/0						0			0.0	0/1	2					3			
12	100930180		CT	C			0/0				21		0	21.0	21.0	0.0	0/1	2			16	16,0,3,0	3	16.0	16.0	3.0
12	110463769		C	CT			0/0						0			0.0	0/1	2					3			
13	95227137		AAAAG	A,AA			0/0				18		3	18.0	18.0	0.0	0/2	2			44	3,31,2,8	0	44.0	34.0	10.0
14	35515606		TGG	T			0/0				4		0	4.0	4.0	0.0	0/1	2			7	6,0,6,0	4	7.0	6.0	6.0
14	72941206		G	GA			0/0				9			9.0	9.0	0.0	0/1	2			105	67,1,39,1		105.0	68.0	40.0
14	92563254		AT	ATT,A			0/0				24		0	24.0	24.0	0.0	0/2	2			32	0,35,0,6	3	32.0	35.0	6.0
15	28473275		T	TA			0/0						0			0.0	0/1	2					3			
15	81187286		TA	T,TAA			0/0						0			0.0	0/2	2					4			
15	88690736		CCTTCTTCTTCTTCTTCTTCTT	C			0/0		0,0	12,12	18		0	18.0	12.0	0.0	0/1	2	5,5	5,6	27	0,28,0,4	4	27.0	5.0	5.0
16	460578		CT	C			0/0						0			0.0	0/1	2					3			
16	628994		TGGGC	T			0/0				17		0	17.0	17.0	0.0	0/1	2			41	0,41,0,19	7	41.0	41.0	19.0
16	4700318		CA	C			0/0				15		0	15.0	15.0	0.0	0/1	2			17	18,2,7,0	3	17.0	20.0	7.0
16	58200464		ACT	A			0/0				142		7	142.0	142.0	0.0	0/1	2			126	96,30,9,4	13	126.0	126.0	13.0
16	84230067		GCAACCCCTTCGCT	G			0/0						0			0.0	0/1	2					4			
16	84230082		AACCCCTTC	A			0/0				10			10.0	10.0	0.0	0/1	2			12	8,0,4,0		12.0	8.0	4.0
16	84230091		GCTCAA	G			0/0				12			12.0	12.0	0.0	0/1	2			11	7,0,4,0		11.0	7.0	4.0
16	89167075		C	CCCCAGGAGGCTCCCGGGAG			0/0						0			0.0	0/1	2					3			
17	1264611		TA	T			0/0				26		0	26.0	26.0	0.0	0/1	2			32	4,28,1,9	5	32.0	32.0	10.0
17	2297571		GCA	G			0/0						0			0.0	0/1	2					7			
17	3352494		C	CA			0/0				26		0	26.0	26.0	0.0	0/1	2			20	0,20,0,11	3	20.0	20.0	11.0
17	4802255		GGCCTCTGCCTCGCTCCACCC	G			0/0				5		0	5.0	5.0	0.0	0/1	2			13	4,9,1,3	6	13.0	13.0	4.0
17	55075670		CA	CAA,C			0/0				31		0	31.0	31.0	0.0	0/2	2			36	41,0,7,0	8	36.0	41.0	7.0
17	58525216		GA	G			0/0						0			0.0	0/1	2					3			
17	67101527		TC	T			0/0						0			0.0	0/1	2					3			
17	76456454		GAGTGTA	G,GAGTGTGCA			0/0				34			34.0	34.0	0.0	0/2	2			38	0,37,0,7		38.0	37.0	7.0
18	43666280		TAGTTAATATATTAATACCTTAAGA	T,TAGTTAATATATTAATACCTTAAGAT			0/0				25		36	25.0	25.0	0.0	0/2	2			15	4,6,3,2	35	15.0	10.0	5.0
19	2901114		CGCCGAAGTCT	C			0/0				4		0	4.0	4.0	0.0	0/1	2			18	2,16,1,5	5	18.0	18.0	6.0
19	4199809		C	CA			0/0		0,0	3,3	3		0	3.0	3.0	0.0	0/1	2	7,7	1,1	8	5,2,5,2	5	8.0	1.0	7.0
19	16513357		CT	C			0/0						0			0.0	0/1	2					4			
19	41062902		AC	A			0/0		0,0	13,13	20		0	20.0	13.0	0.0	0/1	2	13,13	14,14	46		9	46.0	14.0	13.0
20	17928175		CCTG	C			0/0		0,0	249,249	255		249	255.0	249.0	0.0	0/1	2	69,70	239,239	330	240,90,49,17	239	330.0	239.0	69.0
20	30060720		GCA	G			0/0		0,0	37,37	40		37	40.0	37.0	0.0	0/1	2	9,9	40,41	54	49,5,7,1	40	54.0	40.0	9.0
20	30354257		GGT	GGTGT,G			0/0				48		1	48.0	48.0	0.0	0/1	2			41	48,0,9,0	3	41.0	48.0	9.0
20	46279833		GCAA	G			0/0				70			70.0	70.0	0.0	0/1	2			108	82,25,8,3		108.0	107.0	11.0
21	30338153		C	CA			0/0						0			0.0	0/1	2					3			
21	34726106		A	AT			0/0		0,0	191,191	229		191	229.0	191.0	0.0	0/1	2	57,57	148,148	253	47,204,14,36	148	253.0	148.0	57.0
21	41384834		C	CTT			0/0				4		0	4.0	4.0	0.0	0/1	2			6	6,0,2,0	3	6.0	6.0	2.0
21	45712357		AC	A			0/0				3		0	3.0	3.0	0.0	0/1	2			8	0,7,0,4	4	8.0	7.0	4.0
22	31301792		A	AGCCACC			0/0						0			0.0	0/1	2					4			
22	41918653		GT	G			0/0		0,0	2,2	2		0	2.0	2.0	0.0	0/1	2	4,4	0,0	4		4	4.0	0.0	4.0
X	23724675		CAAA	C,CA			0/0				28		0	28.0	28.0	0.0	0/1	2			20	26,0,3,0	3	20.0	26.0	3.0
X	54972154		C	CGT			0/0				13			13.0	13.0	0.0	0/1	2			5	0,6,0,2		5.0	6.0	2.0
X	55027964		AT	A			0/0						0			0.0	0/1	2					5			
X	70361651		CA	CAA,C			0/0				39		0	39.0	39.0	0.0	0/2	2			35	38,7,20,2	5	35.0	45.0	22.0
X	106461963		CA	C			0/0				23		0	23.0	23.0	0.0	0/1	2			13	14,0,3,0	3	13.0	14.0	3.0
X	129203198		C	CA			0/0				11		0	11.0	11.0	0.0	0/1	2			9	12,0,5,0	3	9.0	12.0	5.0