genome.wustl.edu.TCGA-A1-A0SD.indel.0e81f9c986154ce89e59240c3f09534f.txt 89.9 KB
Newer Older
Pradat Yoann's avatar
Pradat Yoann committed
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100
#version 2.4
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_Position	End_Position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_File	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	HGVSc	HGVSp	HGVSp_Short	Transcript_ID	Exon_Number	t_depth	t_ref_count	t_alt_count	n_depth	n_ref_count	n_alt_count	all_effects	Allele	Gene	Feature	Feature_type	Consequence	cDNA_position	CDS_position	Protein_position	Amino_acids	Codons	Existing_variation	ALLELE_NUM	DISTANCE	STRAND_VEP	SYMBOL	SYMBOL_SOURCE	HGNC_ID	BIOTYPE	CANONICAL	CCDS	ENSP	SWISSPROT	TREMBL	UNIPARC	RefSeq	SIFT	PolyPhen	EXON	INTRON	DOMAINS	AF	AFR_AF	AMR_AF	ASN_AF	EAS_AF	EUR_AF	SAS_AF	AA_AF	EA_AF	CLIN_SIG	SOMATIC	PUBMED	MOTIF_NAME	MOTIF_POS	HIGH_INF_POS	MOTIF_SCORE_CHANGE	IMPACT	PICK	VARIANT_CLASS	TSL	HGVS_OFFSET	PHENO	MINIMISED	ExAC_AF	ExAC_AF_AFR	ExAC_AF_AMR	ExAC_AF_EAS	ExAC_AF_FIN	ExAC_AF_NFE	ExAC_AF_OTH	ExAC_AF_SAS	GENE_PHENO	FILTER	flanking_bps	vcf_id	vcf_qual	ExAC_AF_Adj	ExAC_AC_AN_Adj	ExAC_AC_AN	ExAC_AC_AN_AFR	ExAC_AC_AN_AMR	ExAC_AC_AN_EAS	ExAC_AC_AN_FIN	ExAC_AC_AN_NFE	ExAC_AC_AN_OTH	ExAC_AC_AN_SAS	ExAC_FILTER	gnomAD_AF	gnomAD_AFR_AF	gnomAD_AMR_AF	gnomAD_ASJ_AF	gnomAD_EAS_AF	gnomAD_FIN_AF	gnomAD_NFE_AF	gnomAD_OTH_AF	gnomAD_SAS_AF	vcf_pos
IFNLR1	163702	.	GRCh37	1	24486218	24486219	+	Intron	INS	-	-	TTG	rs112101640		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.511-96_511-95insCAA			ENST00000327535		28	22	6	24	0	0	IFNLR1,intron_variant,,ENST00000327535,NM_170743.3,NM_173064.2;IFNLR1,intron_variant,,ENST00000327575,NM_173065.2;IFNLR1,intron_variant,,ENST00000374419,;IFNLR1,intron_variant,,ENST00000374421,;IFNLR1,downstream_gene_variant,,ENST00000374418,;	TTG	ENSG00000185436	ENST00000327535	Transcript	intron_variant						rs112101640	1		-1	IFNLR1	HGNC	18584	protein_coding	YES	CCDS248.1	ENSP00000327824	Q8IU57	A4QPA4	UPI000004D3FC	NM_170743.3,NM_173064.2				4/6																		MODIFIER	1	insertion														.	TTT	.	.																					24486218
ARID1A	8289	.	GRCh37	1	27107273	27107274	+	3'UTR	DEL	GT	GT	-	rs1553153821		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	GT	GT																c.*35_*36del			ENST00000324856	20/20	18	.	4	26	.	0	ARID1A,3_prime_UTR_variant,,ENST00000324856,NM_006015.4;ARID1A,3_prime_UTR_variant,,ENST00000457599,NM_139135.2;ARID1A,3_prime_UTR_variant,,ENST00000430799,;ARID1A,3_prime_UTR_variant,,ENST00000540690,;ARID1A,downstream_gene_variant,,ENST00000374152,;ARID1A,3_prime_UTR_variant,,ENST00000466382,;ARID1A,3_prime_UTR_variant,,ENST00000532781,;	-	ENSG00000117713	ENST00000324856	Transcript	3_prime_UTR_variant	7255-7256/8577					rs1553153821	1		1	ARID1A	HGNC	11110	protein_coding	YES	CCDS285.1	ENSP00000320485	O14497	Q96T01,Q96SY8,Q96SM7,E9PQW6,C1KEN7,A4FU79	UPI0000167B91	NM_006015.4			20/20																			MODIFIER	1	deletion													1	.	CCGTG	.	.												4.576e-05						9.595e-05			27107272
IGSF3	3321	.	GRCh37	1	117122285	117122286	+	In_Frame_Ins	INS	-	-	TCC	rs576658823		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.3122_3123insGGA	p.Asp1040_Asp1041insGlu	p.D1040_D1041insE	ENST00000369483	11/12	23	16	7	8	0	0	IGSF3,inframe_insertion,p.Asp1020_Asp1021insGlu,ENST00000369486,NM_001007237.2;IGSF3,inframe_insertion,p.Asp1040_Asp1041insGlu,ENST00000369483,NM_001542.3;IGSF3,inframe_insertion,p.Asp1040_Asp1041insGlu,ENST00000318837,;	TCC	ENSG00000143061	ENST00000369483	Transcript	inframe_insertion	3827-3828/7253	3122-3123/3645	1041/1214	D/ED	gac/gaGGAc	rs576658823,COSV59586221	1		-1	IGSF3	HGNC	5950	protein_coding	YES	CCDS30814.1	ENSP00000358495	O75054		UPI0000140437	NM_001542.3			11/12		Gene3D:2.60.40.10,Coiled-coils_(Ncoils):Coil,PROSITE_profiles:PS50835,PANTHER:PTHR12207,PANTHER:PTHR12207:SF21,SMART:SM00409,Low_complexity_(Seg):seg		0.1528	0.3069		0.1022	0.4284	0.2873				0,1						MODERATE	1	insertion			0,1										1	.	CGT	.	.												0.2555	0.122	0.2276	0.2791	0.1089	0.3553	0.2968	0.2783	0.2387	117122285
MYOC	4653	.	GRCh37	1	171607570	171607571	+	Intron	DEL	AG	AG	-	rs144871239		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	AG	AG																c.730+166_730+167del			ENST00000037502		11	.	7	15	.	12	MYOC,intron_variant,,ENST00000037502,NM_000261.1;	-	ENSG00000034971	ENST00000037502	Transcript	intron_variant						rs144871239	1		-1	MYOC	HGNC	7610	protein_coding	YES	CCDS1297.1	ENSP00000037502	Q99972	B4DV60	UPI00000012D6	NM_000261.1				2/2			0.0272	0.0043		0.0079	0.0099	0.0307										MODIFIER	1	deletion													1	.	ACAGA	.	.																					171607569
TNN	63923	.	GRCh37	1	175116046	175116047	+	Intron	INS	-	-	TT	rs11450833		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.3760-7_3760-6dup			ENST00000239462		56	.	7	38	.	0	TNN,intron_variant,,ENST00000239462,NM_022093.1;,regulatory_region_variant,,ENSR00000255419,;,regulatory_region_variant,,ENSR00001508420,;	TT	ENSG00000120332	ENST00000239462	Transcript	intron_variant						rs11450833	2		1	TNN	HGNC	22942	protein_coding	YES	CCDS30943.1	ENSP00000239462	Q9UQP3		UPI00001D7DA9	NM_022093.1				18/18																		MODIFIER	1	insertion														.	GCT	.	.												0.04389	0.04394	0.04295	0.03114	0.04116	0.04203	0.04591	0.03989	0.04163	175116046
ELF3	1999	.	GRCh37	1	201981005	201981006	+	Intron	INS	-	-	A	rs1169377361		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.164-63dup			ENST00000359651		3	.	3	0	.	0	ELF3,intron_variant,,ENST00000359651,;ELF3,intron_variant,,ENST00000367283,;ELF3,intron_variant,,ENST00000367284,NM_004433.4,NM_001114309.1;ELF3,intron_variant,,ENST00000446188,;RP11-510N19.5,intron_variant,,ENST00000504773,;RP11-465N4.4,upstream_gene_variant,,ENST00000419190,;ELF3,intron_variant,,ENST00000490203,;ELF3,intron_variant,,ENST00000495848,;ELF3,upstream_gene_variant,,ENST00000470384,;ELF3,upstream_gene_variant,,ENST00000475698,;ELF3,upstream_gene_variant,,ENST00000479874,;ELF3,downstream_gene_variant,,ENST00000498017,;,regulatory_region_variant,,ENSR00000956492,;	A	ENSG00000163435	ENST00000359651	Transcript	intron_variant						rs1169377361	1		1	ELF3	HGNC	3318	protein_coding	YES	CCDS1419.1	ENSP00000352673	P78545		UPI0000034E32					1/7																		MODIFIER	1	insertion													1	.	TCA	.	.																					201981005
TLR5	7100	.	GRCh37	1	223284687	223284688	+	Frame_Shift_Ins	INS	-	-	A	novel		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.1686dup	p.Pro563SerfsTer2	p.P563Sfs*2	ENST00000540964	4/4	78	.	35	93	.	91	TLR5,frameshift_variant,p.Pro563SerfsTer2,ENST00000540964,;TLR5,frameshift_variant,p.Pro563SerfsTer2,ENST00000366881,NM_003268.5;TLR5,frameshift_variant,p.Pro563SerfsTer2,ENST00000342210,;TLR5,downstream_gene_variant,,ENST00000407096,;,regulatory_region_variant,,ENSR00001513547,;	A	ENSG00000187554	ENST00000540964	Transcript	frameshift_variant	2148-2149/4088	1686-1687/2577	562-563/858	-/X	-/T		1		-1	TLR5	HGNC	11851	protein_coding	YES	CCDS31033.1	ENSP00000440643	O60602	B1AZ06	UPI0000205D14				4/4		Gene3D:3.80.10.10,PROSITE_profiles:PS51450,PANTHER:PTHR24365,PANTHER:PTHR24365:SF221,Superfamily:SSF52058																	HIGH	1	insertion													1	.	GGA	.	.																					223284687
PARP1	142	.	GRCh37	1	226553492	226553494	+	Intron	DEL	AAC	AAC	-	rs200302262		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	AAC	AAC																c.2505+161_2505+163del			ENST00000366794		9	4	5	12	12	0	PARP1,intron_variant,,ENST00000366794,NM_001618.3;PARP1,intron_variant,,ENST00000490921,;PARP1,intron_variant,,ENST00000498787,;PARP1,upstream_gene_variant,,ENST00000463968,;PARP1,upstream_gene_variant,,ENST00000468608,;PARP1,upstream_gene_variant,,ENST00000491816,;	-	ENSG00000143799	ENST00000366794	Transcript	intron_variant						rs200302262	1		-1	PARP1	HGNC	270	protein_coding	YES	CCDS1554.1	ENSP00000355759	P09874	Q96P95	UPI000013D92D	NM_001618.3				18/22																		MODIFIER	1	sequence_alteration													1	.	CAAACA	.	.																					226553491
C2orf50	130813	.	GRCh37	2	11273409	11273410	+	5'UTR	INS	-	-	TC	rs57490327		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.-53_-52dup			ENST00000381585	1/3	23	.	4	9	.	0	C2orf50,5_prime_UTR_variant,,ENST00000381585,;C2orf50,5_prime_UTR_variant,,ENST00000405022,NM_182500.2;AC062028.1,upstream_gene_variant,,ENST00000396164,;AC062028.1,upstream_gene_variant,,ENST00000417697,;AC062028.1,upstream_gene_variant,,ENST00000447433,;AC062028.1,upstream_gene_variant,,ENST00000536743,;AC062028.1,upstream_gene_variant,,ENST00000544306,;AC062028.1,upstream_gene_variant,,ENST00000590207,;AC062028.1,upstream_gene_variant,,ENST00000590373,;,regulatory_region_variant,,ENSR00000112861,;,regulatory_region_variant,,ENSR00001168258,;	TCTC	ENSG00000150873	ENST00000381585	Transcript	5_prime_UTR_variant	230-231/2684					rs57490327	2		1	C2orf50	HGNC	26324	protein_coding	YES	CCDS1678.1	ENSP00000370997	Q96LR7		UPI000006ECF0				1/3																			MODIFIER	1	sequence_alteration														.	GGTCT	.	.																					11273407
HAAO	23498	.	GRCh37	2	42996760	42996763	+	Intron	DEL	AGAG	AGAG	-	rs10535571		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	AGAG	AGAG																c.630+90_630+93del			ENST00000294973		18	11	7	5	0	0	HAAO,intron_variant,,ENST00000294973,NM_012205.2;HAAO,downstream_gene_variant,,ENST00000431905,;HAAO,intron_variant,,ENST00000402698,;HAAO,intron_variant,,ENST00000404451,;HAAO,intron_variant,,ENST00000406007,;HAAO,downstream_gene_variant,,ENST00000406924,;,regulatory_region_variant,,ENSR00001618902,;	-	ENSG00000162882	ENST00000294973	Transcript	intron_variant						rs10535571	1		-1	HAAO	HGNC	4796	protein_coding	YES	CCDS33187.1	ENSP00000294973	P46952	C9IY88	UPI000007068E	NM_012205.2				7/9			0.857	0.8617		0.6815	0.7137	0.8855										MODIFIER	1	deletion													1	.	AAAGAGA	.	.																					42996759
EML6	400954	.	GRCh37	2	55181023	55181023	+	Intron	DEL	A	A	-	rs34371058		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	A	A																c.4313-97del			ENST00000356458		20	.	3	20	.	0	EML6,intron_variant,,ENST00000356458,NM_001039753.2;EML6,intron_variant,,ENST00000481376,;EML6,upstream_gene_variant,,ENST00000490828,;,regulatory_region_variant,,ENSR00001177453,;	-	ENSG00000214595	ENST00000356458	Transcript	intron_variant						rs34371058	2		1	EML6	HGNC	35412	protein_coding	YES	CCDS46286.1	ENSP00000348842	Q6ZMW3		UPI00006C0432	NM_001039753.2				30/40																		MODIFIER	1	sequence_alteration														.	CTAA	.	.																					55181022
FMNL2	114793	.	GRCh37	2	153471255	153471256	+	Intron	INS	-	-	CAAAACAAAACAAAACAAAA	rs70974877		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.1063-104_1063-85dup			ENST00000288670		8	.	4	8	.	0	FMNL2,intron_variant,,ENST00000288670,NM_052905.3;FMNL2,upstream_gene_variant,,ENST00000475377,;,regulatory_region_variant,,ENSR00001628977,;	CAAAACAAAACAAAACAAAA	ENSG00000157827	ENST00000288670	Transcript	intron_variant						rs70974877	2		1	FMNL2	HGNC	18267	protein_coding	YES	CCDS46429.1	ENSP00000288670	Q96PY5	B3KT32	UPI0000441EF9	NM_052905.3				11/25			0.0915	0.2378		0.0288	0.16	0.2127										MODIFIER	1	insertion														.	CTC	.	.																					153471255
HOXD9	3235	.	GRCh37	2	176988290	176988291	+	In_Frame_Ins	INS	-	-	GCA	rs56007470		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.804_806dup	p.Gln269dup	p.Q269dup	ENST00000249499	1/2	12	.	12	0	.	0	HOXD9,inframe_insertion,p.Gln269dup,ENST00000249499,NM_014213.3;HOXD10,downstream_gene_variant,,ENST00000249501,NM_002148.3;HOXD-AS2,intron_variant,,ENST00000440016,;HOXD10,downstream_gene_variant,,ENST00000490088,;HOXD10,downstream_gene_variant,,ENST00000549469,;,regulatory_region_variant,,ENSR00001200315,;	GCA	ENSG00000128709	ENST00000249499	Transcript	inframe_insertion	1203-1204/2418	794-795/1059	265/352	P/PQ	ccg/ccGCAg	rs56007470,COSV50893605	1		1	HOXD9	HGNC	5140	protein_coding	YES	CCDS2267.2	ENSP00000249499	P28356		UPI000004A10E	NM_014213.3			1/2		PIRSF:PIRSF037109,PANTHER:PTHR24326,PANTHER:PTHR24326:SF113,Low_complexity_(Seg):seg		0.0514	0.5331		0.3919	0.4046	0.4642	0.1061	0.3821		0,1						MODERATE	1	insertion		12	0,1											.	CCG	.	.												0.3932	0.08464	0.6124	0.273	0.3863	0.4835	0.3688	0.3912	0.4562	176988290
SLC22A14	9389	.	GRCh37	3	38355176	38355177	+	Intron	INS	-	-	GCGCGCGCGCGC	rs1553644857		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.1164-35_1164-34insCGCGCGCGCGCG			ENST00000273173		18	.	8	20	.	1	SLC22A14,intron_variant,,ENST00000273173,NM_004803.3;SLC22A14,intron_variant,,ENST00000448498,;,regulatory_region_variant,,ENSR00001657319,;	GCGCGCGCGCGC	ENSG00000144671	ENST00000273173	Transcript	intron_variant						rs1553644857	1		1	SLC22A14	HGNC	8495	protein_coding	YES	CCDS2677.1	ENSP00000273173	Q9Y267	F5H7H1	UPI00001AE9A8	NM_004803.3				6/9																		MODIFIER	1	insertion														.	GTG	.	.																					38355176
GYG1	2992	.	GRCh37	3	148711906	148711907	+	Intron	INS	-	-	T	rs368468774		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.8-13dup			ENST00000345003		22	.	4	26	.	0	GYG1,intron_variant,,ENST00000296048,NM_001184720.1;GYG1,intron_variant,,ENST00000345003,NM_004130.3;GYG1,intron_variant,,ENST00000461191,;GYG1,intron_variant,,ENST00000473005,;GYG1,intron_variant,,ENST00000483267,;GYG1,intron_variant,,ENST00000484197,NM_001184721.1;GYG1,intron_variant,,ENST00000492285,;GYG1,intron_variant,,ENST00000478067,;GYG1,upstream_gene_variant,,ENST00000465547,;GYG1,upstream_gene_variant,,ENST00000497528,;	T	ENSG00000163754	ENST00000345003	Transcript	intron_variant						rs368468774	1		1	GYG1	HGNC	4699	protein_coding	YES	CCDS3139.1	ENSP00000340736	P46976	C9J8R8,C9J7C7	UPI000014176C	NM_004130.3				1/7									0.07009	0.03901								MODIFIER	1	insertion													1	.	TGT	.	.												0.01383	0.05858	0.01353	0.008938	0.01076	0.003844	0.01108	0.01578	0.01096	148711906
SI	6476	.	GRCh37	3	164776647	164776648	+	Intron	INS	-	-	ACAC	rs138742044		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.1398+100_1398+103dup			ENST00000264382		19	.	3	44	.	0	SI,intron_variant,,ENST00000264382,NM_001041.3;	ACAC	ENSG00000090402	ENST00000264382	Transcript	intron_variant						rs138742044	2		-1	SI	HGNC	10856	protein_coding	YES	CCDS3196.1	ENSP00000264382	P14410		UPI000022C287	NM_001041.3				12/47																		MODIFIER	1	insertion													1	.	ATA	.	.																					164776647
TFRC	7037	.	GRCh37	3	195792289	195792292	+	Intron	DEL	GGGG	GGGG	-	rs55639089		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	GGGG	GGGG																c.1198+22_1198+25del			ENST00000360110		11	.	5	7	.	0	TFRC,intron_variant,,ENST00000360110,NM_001128148.1;TFRC,intron_variant,,ENST00000392396,NM_003234.2;TFRC,intron_variant,,ENST00000420415,;TFRC,intron_variant,,ENST00000535031,;TFRC,intron_variant,,ENST00000540528,;TFRC,upstream_gene_variant,,ENST00000465288,;TFRC,intron_variant,,ENST00000464368,;TFRC,upstream_gene_variant,,ENST00000475593,;TFRC,upstream_gene_variant,,ENST00000477148,;TFRC,upstream_gene_variant,,ENST00000483983,;TFRC,downstream_gene_variant,,ENST00000491658,;	-	ENSG00000072274	ENST00000360110	Transcript	intron_variant						rs55639089	1		-1	TFRC	HGNC	11763	protein_coding	YES	CCDS3312.1	ENSP00000353224	P02786	G3V0E5,F5H6B1	UPI0000049ADE	NM_001128148.1				10/18																		MODIFIER	1	deletion													1	.	GCGGGGG	.	.												0.3446	0.2148	0.3712	0.3885	0.4495	0.3592	0.3386	0.3909	0.3095	195792288
PCYT1A	5130	.	GRCh37	3	195956727	195956728	+	3'Flank	DEL	AG	AG	-	rs144375332		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	AG	AG																			ENST00000292823		75	.	8	50	.	0	PCYT1A,3_prime_UTR_variant,,ENST00000419333,;SLC51A,intron_variant,,ENST00000296327,NM_152672.5;PCYT1A,intron_variant,,ENST00000441879,;PCYT1A,downstream_gene_variant,,ENST00000292823,NM_005017.2;SLC51A,upstream_gene_variant,,ENST00000415111,;SLC51A,downstream_gene_variant,,ENST00000428985,;SLC51A,upstream_gene_variant,,ENST00000479732,;SLC51A,upstream_gene_variant,,ENST00000496737,;SLC51A,intron_variant,,ENST00000471430,;SLC51A,intron_variant,,ENST00000475271,;SLC51A,intron_variant,,ENST00000475672,;SLC51A,intron_variant,,ENST00000484407,;SLC51A,downstream_gene_variant,,ENST00000442203,;SLC51A,downstream_gene_variant,,ENST00000472653,;SLC51A,downstream_gene_variant,,ENST00000476129,;SLC51A,upstream_gene_variant,,ENST00000492794,;	-	ENSG00000161217	ENST00000292823	Transcript	downstream_gene_variant						rs144375332	1	4511	-1	PCYT1A	HGNC	8754	protein_coding	YES	CCDS3315.1	ENSP00000292823	P49585	C9JVS0,C9JPY0,C9J050	UPI000000DB72	NM_005017.2																						MODIFIER		deletion													1	.	AAAGA	.	.																					195956726
TRMT10A	93587	.	GRCh37	4	100472247	100472248	+	Intron	INS	-	-	A	rs370608163		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.646-101_646-100insT			ENST00000273962		16	11	5	10	10	0	TRMT10A,intron_variant,,ENST00000273962,NM_152292.4;TRMT10A,intron_variant,,ENST00000394876,;TRMT10A,intron_variant,,ENST00000394877,NM_001134665.1,NM_001134666.1;TRMT10A,downstream_gene_variant,,ENST00000455368,;TRMT10A,downstream_gene_variant,,ENST00000514547,;	A	ENSG00000145331	ENST00000273962	Transcript	intron_variant						rs370608163	1		-1	TRMT10A	HGNC	28403	protein_coding	YES	CCDS3650.1	ENSP00000273962	Q8TBZ6	D6R954	UPI000006D359	NM_152292.4				6/7																		MODIFIER	1	insertion													1	.	ATT	.	.																					100472247
PAPSS1	9061	.	GRCh37	4	108608101	108608109	+	Intron	DEL	TCTAACACT	-	-	rs35832252		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	TCTAACACT	TCTAACACT																c.550+86_550+94del			ENST00000265174		48	.	42	34	.	34	PAPSS1,intron_variant,,ENST00000265174,NM_005443.4;PAPSS1,intron_variant,,ENST00000502431,;PAPSS1,intron_variant,,ENST00000511304,;PAPSS1,downstream_gene_variant,,ENST00000514489,;PAPSS1,downstream_gene_variant,,ENST00000506544,;	-	ENSG00000138801	ENST00000265174	Transcript	intron_variant						rs35832252	1		-1	PAPSS1	HGNC	8603	protein_coding	YES	CCDS3676.1	ENSP00000265174	O43252	Q6IAX6,Q4W5H3,Q4W5F0	UPI0000132102	NM_005443.4				4/11			0.3684	0.879		0.881	0.9245	0.9581										MODIFIER	1	deletion														.	ACTCTAACACTT	.	.																					108608100
PRDM5	11107	.	GRCh37	4	121739412	121739415	+	Intron	DEL	CACA	CACA	-	novel		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	CACA	CACA																c.650+93_650+96del			ENST00000264808		4	.	4	0	.	0	PRDM5,intron_variant,,ENST00000264808,NM_018699.2;PRDM5,intron_variant,,ENST00000428209,;PRDM5,intron_variant,,ENST00000515109,;PRDM5,non_coding_transcript_exon_variant,,ENST00000507611,;PRDM5,intron_variant,,ENST00000502409,;PRDM5,intron_variant,,ENST00000505484,;PRDM5,intron_variant,,ENST00000512845,;	-	ENSG00000138738	ENST00000264808	Transcript	intron_variant							1		-1	PRDM5	HGNC	9349	protein_coding	YES	CCDS3716.1	ENSP00000264808	Q9NQX1		UPI000013D572	NM_018699.2				5/15																		MODIFIER	1	deletion													1	.	TGCACAC	.	.																					121739411
SLC12A7	10723	.	GRCh37	5	1093609	1093610	+	Intron	INS	-	-	GGGCGGGGACT	rs56276350		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.342+28_342+38dup			ENST00000264930		18	.	18	0	.	0	SLC12A7,intron_variant,,ENST00000264930,NM_006598.2;	GGGCGGGGACT	ENSG00000113504	ENST00000264930	Transcript	intron_variant						rs56276350	1		-1	SLC12A7	HGNC	10915	protein_coding	YES	CCDS34129.1	ENSP00000264930	Q9Y666		UPI0000141815	NM_006598.2				3/23			0.5234	0.9078		0.9871	0.9334	0.9867	0.5905	0.9242								MODIFIER	1	insertion														.	CGG	.	.																					1093609
SFXN1	94081	.	GRCh37	5	174940300	174940312	+	Intron	DEL	AAAAAAAAAAAAA	AAAAAAAAAAAAA	-	rs55761424		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	AAAAAAAAAAAAA	AAAAAAAAAAAAA																c.597-151_597-139del			ENST00000321442		3	.	3	0	.	0	SFXN1,intron_variant,,ENST00000321442,NM_022754.5;SFXN1,downstream_gene_variant,,ENST00000502393,;SFXN1,downstream_gene_variant,,ENST00000506963,;SFXN1,downstream_gene_variant,,ENST00000507017,;SFXN1,intron_variant,,ENST00000502865,;SFXN1,intron_variant,,ENST00000507823,;SFXN1,intron_variant,,ENST00000515736,;SFXN1,downstream_gene_variant,,ENST00000508290,;SFXN1,downstream_gene_variant,,ENST00000513725,;	-	ENSG00000164466	ENST00000321442	Transcript	intron_variant						rs55761424	1		1	SFXN1	HGNC	16085	protein_coding	YES	CCDS4394.1	ENSP00000316905	Q9H9B4	D6RFI0,D6RDG7	UPI0000044799	NM_022754.5				6/10																		MODIFIER	1	deletion														.	GTAAAAAAAAAAAAAA	.	.																					174940299
HLA-DRB5	3127	.	GRCh37	6	32487441	32487442	+	Intron	INS	-	C	C	rs747493738		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.371-14_371-13insG			ENST00000374975		40	20	20	4	0	0	HLA-DRB5,intron_variant,,ENST00000374975,NM_002125.3;	C	ENSG00000198502	ENST00000374975	Transcript	intron_variant						rs747493738	1		-1	HLA-DRB5	HGNC	4953	protein_coding	YES	CCDS4751.1	ENSP00000364114	Q30154	Q95385,Q5TJ21,Q30141,Q30138,Q30009,Q2YHL2,Q06663,Q06654,A1A424	UPI000008AF56	NM_002125.3				2/5									0.04726	0.09124								MODIFIER	1	insertion														.	GAA	.	.												0.000582		0.0005299	0.001032	0.0007758	0.0005037	0.0007093		0.0004311	32487441
HLA-DRB1	3123	.	GRCh37	6	32548732	32548733	+	Intron	INS	-	-	T	rs373779708		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.653-100_653-99insA			ENST00000360004		106	88	18	31	0	0	HLA-DRB1,intron_variant,,ENST00000360004,NM_002124.3;	T	ENSG00000196126	ENST00000360004	Transcript	intron_variant						rs373779708	1		-1	HLA-DRB1	HGNC	4948	protein_coding	YES	CCDS47409.1	ENSP00000353099	Q9GIY3,P04229,Q29974,P01911	M9PAL6,M9PAH4,M9PAH2,M9PA34,M9P9N9,M9P9N6,M9P978,M9P8M8,M9P8M7,Q9TQ40,Q9MYD9,Q95HN3,Q8WMA1,Q8MGY6,Q8HWN3,Q860S9,Q5Y7C5,Q3LTJ8,Q1G100,Q1G0Z8,Q06653,I6NVX3,I6M556,H8WV95,H6A2E5,H2BDR9,G9I2P4,G9HW13,G1EMX6,G1EMX4,G1CD91,G0ZMM9,G0ZMM8,G0ZDX1,F8R8N1,F8R8N0,F4YZX5,F4YZX4,F4YZX3,F4YZX2,F4YZX1,F4YZW3,F4YUA8,F2X654,F2VNW9,F2VNV6,F2VNV5,F2QL89,F1CCP7,F1CCN5,F1CCN2,F1CCL9,F0V6B9,E7BYD5,E3SWP0,E3SWN9,E3SWN8,E0X9M7,D9IFQ2,D7RIH8,D7NR21,D6MJL2,D6MJC0,D6BPR2,D5M8A0,D5M899,D5G2K8,D5FZP5,D5FZP4,D5FIF2,D5FIE9,D5FIE8,D5FIE7,D5FIE6,D5FIE4,D5FID9,D5FID8,D5FID7,D5FID6,D5FID2,D5FID0,D5FIC9,D5FIC8,D3U4F4,C8CJD1,B7VU65,A1Z0K9,A0N0W0	UPI000008A1F7	NM_002124.3				3/5																		MODIFIER	1	insertion													1	.	GCC	.	.																					32548732
HLA-DRB1	3123	.	GRCh37	6	32557600	32557601	+	5'UTR	INS	-	-	C	rs1343244742		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.-82_-81insG			ENST00000360004	1/6	68	58	10	42	0	0	HLA-DRB1,5_prime_UTR_variant,,ENST00000360004,NM_002124.3;,regulatory_region_variant,,ENSR00000195691,;,TF_binding_site_variant,,ENSM00910732557,;,TF_binding_site_variant,,ENSM00523470620,;,TF_binding_site_variant,,ENSM00523157931,;	C	ENSG00000196126	ENST00000360004	Transcript	5_prime_UTR_variant	25-26/1229					rs1343244742	1		-1	HLA-DRB1	HGNC	4948	protein_coding	YES	CCDS47409.1	ENSP00000353099	Q9GIY3,P04229,Q29974,P01911	M9PAL6,M9PAH4,M9PAH2,M9PA34,M9P9N9,M9P9N6,M9P978,M9P8M8,M9P8M7,Q9TQ40,Q9MYD9,Q95HN3,Q8WMA1,Q8MGY6,Q8HWN3,Q860S9,Q5Y7C5,Q3LTJ8,Q1G100,Q1G0Z8,Q06653,I6NVX3,I6M556,H8WV95,H6A2E5,H2BDR9,G9I2P4,G9HW13,G1EMX6,G1EMX4,G1CD91,G0ZMM9,G0ZMM8,G0ZDX1,F8R8N1,F8R8N0,F4YZX5,F4YZX4,F4YZX3,F4YZX2,F4YZX1,F4YZW3,F4YUA8,F2X654,F2VNW9,F2VNV6,F2VNV5,F2QL89,F1CCP7,F1CCN5,F1CCN2,F1CCL9,F0V6B9,E7BYD5,E3SWP0,E3SWN9,E3SWN8,E0X9M7,D9IFQ2,D7RIH8,D7NR21,D6MJL2,D6MJC0,D6BPR2,D5M8A0,D5M899,D5G2K8,D5FZP5,D5FZP4,D5FIF2,D5FIE9,D5FIE8,D5FIE7,D5FIE6,D5FIE4,D5FID9,D5FID8,D5FID7,D5FID6,D5FID2,D5FID0,D5FIC9,D5FIC8,D3U4F4,C8CJD1,B7VU65,A1Z0K9,A0N0W0	UPI000008A1F7	NM_002124.3			1/6																			MODIFIER	1	insertion													1	.	ATT	.	.																					32557600
PTP4A1	7803	.	GRCh37	6	64289939	64289940	+	Intron	DEL	TT	TT	-	rs56188808		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	TT	TT																c.405-23_405-22del			ENST00000370651		22	.	3	36	.	0	PTP4A1,intron_variant,,ENST00000370650,;PTP4A1,intron_variant,,ENST00000370651,NM_003463.4;PTP4A1,downstream_gene_variant,,ENST00000578299,;PTP4A1,downstream_gene_variant,,ENST00000470661,;PTP4A1,downstream_gene_variant,,ENST00000473334,;	-	ENSG00000112245	ENST00000370651	Transcript	intron_variant						rs56188808	3		1	PTP4A1	HGNC	9634	protein_coding	YES	CCDS4965.1	ENSP00000359685	Q93096		UPI00000227B8	NM_003463.4				5/5																		MODIFIER	1	sequence_alteration														.	CATTT	.	.												0.0228	0.01967	0.02582	0.02965	0.0204	0.03172	0.02001	0.02141	0.02653	64289938
COX7A2	1347	.	GRCh37	6	75950110	75950110	+	Intron	DEL	A	A	-	rs56897555		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	A	A																c.205-9del			ENST00000370081		27	.	5	45	.	0	COX7A2,intron_variant,,ENST00000230459,NM_001865.3;COX7A2,intron_variant,,ENST00000370081,;COX7A2,intron_variant,,ENST00000370089,;COX7A2,intron_variant,,ENST00000377978,;COX7A2,intron_variant,,ENST00000460985,;COX7A2,intron_variant,,ENST00000472311,;COX7A2,intron_variant,,ENST00000509698,;COX7A2,intron_variant,,ENST00000459637,;COX7A2,downstream_gene_variant,,ENST00000481061,;	-	ENSG00000112695	ENST00000370081	Transcript	intron_variant						rs56897555	2		-1	COX7A2	HGNC	2288	protein_coding	YES	CCDS34486.2	ENSP00000359098		H0UI06	UPI000015A446					3/4																		MODIFIER	1	sequence_alteration														.	TTAA	.	.												0.1015	0.1462	0.1154	0.1063	0.1032	0.06696	0.08834	0.1038	0.136	75950109
CASP8AP2	0	.	GRCh37	6	90577712	90577728	+	RNA	DEL	CTTTGCCCAGACATGGA	CTTTGCCCAGACATGGA	-	rs537929246		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	CTTTGCCCAGACATGGA	CTTTGCCCAGACATGGA																n.6140_6156del			ENST00000551025	8/9	71	55	16	36	0	0	CASP8AP2,non_coding_transcript_exon_variant,,ENST00000551025,;CASP8AP2,non_coding_transcript_exon_variant,,ENST00000237177,;CASP8AP2,intron_variant,,ENST00000548224,;	-	ENSG00000118412	ENST00000551025	Transcript	non_coding_transcript_exon_variant	6140-6156/7344					rs537929246	1		1	CASP8AP2	HGNC	1510	processed_transcript	YES									8/9			0.0809	0.0061	0.0908		0.0437	0.1471	0.1452	0.01062	0.06093								MODIFIER	1	deletion														.	ATCTTTGCCCAGACATGGAA	.	.												0.06008	0.006838	0.04643	0.09033	0.0226	0.06336	0.06516	0.07212	0.09395	90577711
HACE1	57531	.	GRCh37	6	105300084	105300085	+	Intron	INS	-	TT	TT	rs67205678		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.131+107_131+108insAA			ENST00000262903		30	.	8	9	.	9	HACE1,intron_variant,,ENST00000262903,NM_020771.3;HACE1,intron_variant,,ENST00000369125,;HACE1,intron_variant,,ENST00000519645,;HACE1,intron_variant,,ENST00000524020,;HACE1,intron_variant,,ENST00000416605,;HACE1,intron_variant,,ENST00000521962,;	TT	ENSG00000085382	ENST00000262903	Transcript	intron_variant						rs67205678	1		-1	HACE1	HGNC	21033	protein_coding	YES	CCDS5050.1	ENSP00000262903	Q8IYU2	E5RFX0,E3W983	UPI00001602DC	NM_020771.3				2/23			0.0227	0.0548			0.0924	0.0368										MODIFIER	1	insertion													1	.	TGT	.	.																					105300084
ROS1	6098	.	GRCh37	6	117631463	117631464	+	Intron	INS	-	-	TAA	rs2243387		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.6234-22_6234-20dup			ENST00000368508		25	.	5	21	.	1	ROS1,intron_variant,,ENST00000368507,;ROS1,intron_variant,,ENST00000368508,NM_002944.2;	TAA	ENSG00000047936	ENST00000368508	Transcript	intron_variant						rs2243387	1		-1	ROS1	HGNC	10261	protein_coding	YES	CCDS5116.1	ENSP00000357494	P08922		UPI000013D467	NM_002944.2				39/42			0.0091	0.0288		0.0774	0.0109	0.0215	0.152	0.1452								MODIFIER	1	insertion													1	.	TTT	.	.												0.1896	0.1454	0.2941	0.1945	0.2975	0.2391	0.1434	0.1848	0.191	117631463
SYNE1	23345	.	GRCh37	6	152765727	152765728	+	Intron	INS	-	-	A	rs111322292		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.3670-14dup			ENST00000367255		5	.	5	0	.	0	SYNE1,intron_variant,,ENST00000265368,;SYNE1,intron_variant,,ENST00000341594,;SYNE1,intron_variant,,ENST00000367248,;SYNE1,intron_variant,,ENST00000367253,;SYNE1,intron_variant,,ENST00000367255,NM_182961.3;SYNE1,intron_variant,,ENST00000413186,;SYNE1,intron_variant,,ENST00000423061,NM_033071.3;SYNE1,intron_variant,,ENST00000448038,;SYNE1,intron_variant,,ENST00000461872,;	AA	ENSG00000131018	ENST00000367255	Transcript	intron_variant						rs111322292	1		-1	SYNE1	HGNC	17089	protein_coding	YES	CCDS5236.2	ENSP00000356224	Q8NF91		UPI000204AF58	NM_182961.3				29/145									0.09769	0.07297	uncertain_significance							MODIFIER	1	sequence_alteration			1										1	.	TGAA	.	.												0.08854	0.133	0.1117	0.08963	0.1053	0.09	0.0739	0.08981	0.08905	152765726
SYNJ2	8871	.	GRCh37	6	158484692	158484702	+	Intron	DEL	AAAAAAAAAAA	AAAAAAAAAAA	-	rs71298907		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	AAAAAAAAAAA	AAAAAAAAAAA																c.1128-114_1128-104del			ENST00000355585		3	.	3	0	.	0	SYNJ2,intron_variant,,ENST00000355585,NM_001178088.1,NM_003898.3;SYNJ2,intron_variant,,ENST00000367121,;SYNJ2,intron_variant,,ENST00000367122,;SYNJ2,intron_variant,,ENST00000449859,;SYNJ2,intron_variant,,ENST00000485863,;	-	ENSG00000078269	ENST00000355585	Transcript	intron_variant						rs71298907	1		1	SYNJ2	HGNC	11504	protein_coding	YES	CCDS5254.1	ENSP00000347792	O15056	B4DLC4	UPI000006E2F8	NM_001178088.1,NM_003898.3				8/26																		MODIFIER	1	deletion														.	TCAAAAAAAAAAAA	.	.																					158484691
QKI	9444	.	GRCh37	6	163899795	163899795	+	Intron	DEL	T	T	-	rs761851020		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	T	T																c.286-17del			ENST00000361752		22	.	3	36	.	0	QKI,intron_variant,,ENST00000275262,;QKI,intron_variant,,ENST00000361195,;QKI,intron_variant,,ENST00000361752,NM_006775.2,NM_206855.2,NM_206854.2,NM_206853.2;QKI,intron_variant,,ENST00000392127,;QKI,intron_variant,,ENST00000424802,;QKI,intron_variant,,ENST00000453779,;QKI,intron_variant,,ENST00000537041,;QKI,intron_variant,,ENST00000537124,;QKI,intron_variant,,ENST00000537883,;QKI,intron_variant,,ENST00000544436,;QKI,intron_variant,,ENST00000544823,;QKI,intron_variant,,ENST00000361758,;QKI,intron_variant,,ENST00000545346,;QKI,intron_variant,,ENST00000545607,;	-	ENSG00000112531	ENST00000361752	Transcript	intron_variant						rs761851020	2		1	QKI	HGNC	21100	protein_coding	YES	CCDS5285.1	ENSP00000355094	Q96PU8	F5H8C8,F5H5U6,F5GYM3	UPI0000029EBD	NM_006775.2,NM_206855.2,NM_206854.2,NM_206853.2				2/7									0.1279	0.1478								MODIFIER	1	sequence_alteration													1	.	CCTT	.	.												0.1365	0.09755	0.1539	0.1666	0.1478	0.07404	0.1415	0.1448	0.1583	163899794
CADPS2	93664	.	GRCh37	7	122269208	122269208	+	Intron	DEL	T	T	-	rs796823921		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	T	T																c.867+94del			ENST00000449022		4	.	4	0	.	0	CADPS2,intron_variant,,ENST00000313070,;CADPS2,intron_variant,,ENST00000334010,NM_001167940.1;CADPS2,intron_variant,,ENST00000412584,NM_001009571.3;CADPS2,intron_variant,,ENST00000449022,NM_017954.10;	-	ENSG00000081803	ENST00000449022	Transcript	intron_variant						rs796823921	1		-1	CADPS2	HGNC	16018	protein_coding	YES	CCDS55158.1	ENSP00000398481	Q86UW7	B3KNS2	UPI0000668808	NM_017954.10				4/29																		MODIFIER	1	deletion														.	TCTT	.	.																					122269207
CNOT4	4850	.	GRCh37	7	135099045	135099045	+	Intron	DEL	A	A	-	rs567428044		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	A	A																c.561+35del			ENST00000541284		9	.	9	0	.	0	CNOT4,intron_variant,,ENST00000315544,NM_001190848.1;CNOT4,intron_variant,,ENST00000356162,;CNOT4,intron_variant,,ENST00000361528,;CNOT4,intron_variant,,ENST00000414802,;CNOT4,intron_variant,,ENST00000423368,NM_001190847.1,NM_013316.3;CNOT4,intron_variant,,ENST00000428680,NM_001008225.2;CNOT4,intron_variant,,ENST00000451834,;CNOT4,intron_variant,,ENST00000541284,NM_001190849.1,NM_001190850.1;,regulatory_region_variant,,ENSR00001733471,;	-	ENSG00000080802	ENST00000541284	Transcript	intron_variant						rs567428044	1		-1	CNOT4	HGNC	7880	protein_coding	YES	CCDS55165.1	ENSP00000445508	O95628		UPI00004166A8	NM_001190849.1,NM_001190850.1				5/11																		MODIFIER	1	sequence_alteration														.	TTAA	.	.												0.3464	0.3028	0.3735	0.3747	0.352	0.2811	0.3444	0.3483	0.3852	135099044
TPK1	27010	.	GRCh37	7	144532829	144532830	+	Intron	INS	-	-	G	rs111798915		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.-16-119dup			ENST00000360057		3	.	3	0	.	0	TPK1,intron_variant,,ENST00000360057,NM_022445.3;TPK1,intron_variant,,ENST00000378099,NM_001042482.1;TPK1,intron_variant,,ENST00000552881,;TPK1,intron_variant,,ENST00000548460,;TPK1,intron_variant,,ENST00000378098,;,regulatory_region_variant,,ENSR00000219489,;,TF_binding_site_variant,,ENSM00907117766,;	G	ENSG00000196511	ENST00000360057	Transcript	intron_variant						rs111798915	1		-1	TPK1	HGNC	17358	protein_coding	YES	CCDS5888.1	ENSP00000353165	Q9H3S4	Q75MX1,F8VRJ6	UPI000004FD50	NM_022445.3				1/8			0.4569	0.3184		0.0486	0.3757	0.1442										MODIFIER	1	insertion													1	.	CAG	.	.																					144532829
SMARCD3	6604	.	GRCh37	7	150937075	150937075	+	Intron	DEL	T	T	-	rs552440384		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	T	T																c.1173+123del			ENST00000262188		3	.	3	0	.	0	SMARCD3,intron_variant,,ENST00000262188,NM_001003801.1;SMARCD3,intron_variant,,ENST00000356800,NM_001003802.1;SMARCD3,intron_variant,,ENST00000392811,NM_003078.3;CHPF2,downstream_gene_variant,,ENST00000035307,NM_019015.1;CHPF2,downstream_gene_variant,,ENST00000482173,;SMARCD3,downstream_gene_variant,,ENST00000491651,;CHPF2,downstream_gene_variant,,ENST00000495645,NM_001284295.1;MIR671,downstream_gene_variant,,ENST00000390183,;RP4-548D19.3,upstream_gene_variant,,ENST00000607902,;SMARCD3,downstream_gene_variant,,ENST00000460431,;SMARCD3,downstream_gene_variant,,ENST00000477169,;SMARCD3,downstream_gene_variant,,ENST00000489503,;SMARCD3,upstream_gene_variant,,ENST00000496530,;SMARCD3,intron_variant,,ENST00000469154,;SMARCD3,intron_variant,,ENST00000470588,;SMARCD3,intron_variant,,ENST00000472789,;CHPF2,downstream_gene_variant,,ENST00000465601,;SMARCD3,downstream_gene_variant,,ENST00000472103,;SMARCD3,downstream_gene_variant,,ENST00000472988,;SMARCD3,downstream_gene_variant,,ENST00000485592,;SMARCD3,downstream_gene_variant,,ENST00000485610,;	-	ENSG00000082014	ENST00000262188	Transcript	intron_variant						rs552440384	1		-1	SMARCD3	HGNC	11108	protein_coding	YES	CCDS34780.1	ENSP00000262188	Q6STE5		UPI000022D4B4	NM_001003801.1				10/12			0.3548	0.33		0.3869	0.3608	0.3538										MODIFIER	1	deletion														.	TCTT	.	.																					150937074
RP1	6101	.	GRCh37	8	55542731	55542748	+	In_Frame_Del	DEL	TTTGAAATGCTTGGTCAA	TTTGAAATGCTTGGTCAA	-	novel		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	TTTGAAATGCTTGGTCAA	TTTGAAATGCTTGGTCAA																c.6289_6306del	p.Phe2097_Gln2102del	p.F2097_Q2102del	ENST00000220676	4/4	30	.	27	73	.	73	RP1,inframe_deletion,p.Phe2097_Gln2102del,ENST00000220676,NM_006269.1;	-	ENSG00000104237	ENST00000220676	Transcript	inframe_deletion	6437-6454/7100	6289-6306/6471	2097-2102/2156	FEMLGQ/-	TTTGAAATGCTTGGTCAA/-		1		1	RP1	HGNC	10263	protein_coding	YES	CCDS6160.1	ENSP00000220676	P56715	A0FDN2	UPI000013455B	NM_006269.1			4/4		PANTHER:PTHR23005,PANTHER:PTHR23005:SF4																	MODERATE	1	deletion													1	.	TCTTTGAAATGCTTGGTCAAG	.	.																					55542730
ATAD2	29028	.	GRCh37	8	124382377	124382377	+	Intron	DEL	A	A	-	rs563477611		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	A	A																c.728-113del			ENST00000287394		3	.	3	0	.	0	ATAD2,intron_variant,,ENST00000287394,NM_014109.3;ATAD2,intron_variant,,ENST00000521903,;ATAD2,upstream_gene_variant,,ENST00000534257,;ATAD2,intron_variant,,ENST00000517666,;ATAD2,intron_variant,,ENST00000519124,;ATAD2,intron_variant,,ENST00000521496,;ATAD2,downstream_gene_variant,,ENST00000530065,;	-	ENSG00000156802	ENST00000287394	Transcript	intron_variant						rs563477611	1		-1	ATAD2	HGNC	30123	protein_coding	YES	CCDS6343.1	ENSP00000287394	Q6PL18		UPI0000052A8C	NM_014109.3				6/27																		MODIFIER	1	deletion														.	CTAA	.	.																					124382376
ZCCHC7	84186	.	GRCh37	9	37305830	37305831	+	Intron	DEL	AT	AT	-	rs3837244		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	AT	AT																c.951+136_951+137del			ENST00000336755		12	.	3	7	.	0	ZCCHC7,intron_variant,,ENST00000336755,NM_032226.2;ZCCHC7,intron_variant,,ENST00000534928,;ZCCHC7,intron_variant,,ENST00000461038,;ZCCHC7,intron_variant,,ENST00000463625,;ZCCHC7,intron_variant,,ENST00000488607,;	-	ENSG00000147905	ENST00000336755	Transcript	intron_variant						rs3837244	1		1	ZCCHC7	HGNC	26209	protein_coding	YES	CCDS6608.2	ENSP00000337839	Q8N3Z6	B4E024	UPI0000036027	NM_032226.2				5/8																		MODIFIER	1	deletion														.	AGATA	.	.																					37305829
IARS	3376	.	GRCh37	9	95039957	95039957	+	Intron	DEL	A	A	-	rs34636470		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	A	A																c.894+188del			ENST00000375643		6	.	3	6	.	0	IARS,intron_variant,,ENST00000375629,;IARS,intron_variant,,ENST00000375643,NM_013417.3;IARS,intron_variant,,ENST00000395554,;IARS,intron_variant,,ENST00000443024,NM_002161.5;IARS,intron_variant,,ENST00000447699,;IARS,downstream_gene_variant,,ENST00000498025,;	-	ENSG00000196305	ENST00000375643	Transcript	intron_variant						rs34636470	1		-1	IARS	HGNC	5330	protein_coding	YES	CCDS6694.1	ENSP00000364794	P41252	Q9P1N9,Q7L4K8,Q5TCD1,Q5TCC4,Q59G75,J3KR24	UPI0000141335	NM_013417.3				9/33			0.4667	0.3646		0.3214	0.3837	0.3252										MODIFIER	1	deletion													1	.	TTAA	.	.																					95039956
CIZ1	25792	.	GRCh37	9	130950345	130950347	+	Intron	DEL	CCC	CCC	-	rs370607901		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	CCC	CCC																c.287-134_287-132del			ENST00000393608		7	4	3	7	7	0	CIZ1,intron_variant,,ENST00000277465,;CIZ1,intron_variant,,ENST00000324544,;CIZ1,intron_variant,,ENST00000325721,;CIZ1,intron_variant,,ENST00000357558,NM_001131017.1;CIZ1,intron_variant,,ENST00000372938,NM_001131016.1;CIZ1,intron_variant,,ENST00000372948,NM_001131015.1;CIZ1,intron_variant,,ENST00000372954,NM_001131018.1;CIZ1,intron_variant,,ENST00000393608,NM_012127.2;CIZ1,intron_variant,,ENST00000415526,;CIZ1,intron_variant,,ENST00000420484,;CIZ1,intron_variant,,ENST00000538431,NM_001257975.1;CIZ1,intron_variant,,ENST00000541172,NM_001257976.1;CIZ1,intron_variant,,ENST00000467178,;CIZ1,intron_variant,,ENST00000474442,;CIZ1,intron_variant,,ENST00000476727,;CIZ1,intron_variant,,ENST00000488559,;CIZ1,intron_variant,,ENST00000491954,;CIZ1,intron_variant,,ENST00000498156,;	-	ENSG00000148337	ENST00000393608	Transcript	intron_variant						rs370607901	1		-1	CIZ1	HGNC	16744	protein_coding	YES	CCDS6894.1	ENSP00000377232	Q9ULV3	Q9Y3F8,F6WSM2,F6VD24,B0EXJ7	UPI0000141722	NM_012127.2				3/16																		MODIFIER	1	deletion													1	.	AACCCA	.	.																					130950344
C9orf96	169436	.	GRCh37	9	136249409	136249412	+	Intron	DEL	AATG	AATG	G	rs375935698		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	AATG	AATG																c.175-231_175-229del			ENST00000371957		20	12	8	21	0	0	C9orf96,intron_variant,,ENST00000371955,;C9orf96,intron_variant,,ENST00000371957,NM_153710.4;C9orf96,intron_variant,,ENST00000426926,;C9orf96,intron_variant,,ENST00000468046,;C9orf96,intron_variant,,ENST00000475232,;	ATG	ENSG00000198870	ENST00000371957	Transcript	intron_variant						rs375935698	1		1	C9orf96	HGNC	28669	protein_coding	YES	CCDS35169.1	ENSP00000361025	Q8NE28		UPI00001D763E	NM_153710.4				2/17																		MODIFIER	1	indel														.	TGATAATGG	.	.																					136249406
NELFB	25920	.	GRCh37	9	140161636	140161642	+	Intron	DEL	GGCTGAG	GGCTGAG	AG	rs544060553		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	GGCTGAG	GGCTGAG																c.1239-56_1239-52del			ENST00000343053		20	.	4	15	.	0	NELFB,intron_variant,,ENST00000343053,NM_015456.3;	GTGGAG	ENSG00000188986	ENST00000343053	Transcript	intron_variant						rs544060553	2		1	NELFB	HGNC	24324	protein_coding	YES	CCDS7040.1	ENSP00000339495	Q8WX92		UPI0000070699	NM_015456.3				9/12			0.5113	0.7421		0.4772	0.7097	0.6708										MODIFIER	1	sequence_alteration														.	GTGTGGGGCTGAGG	.	.																					140161631
GATA3	2625	.	GRCh37	10	8115955	8115956	+	Frame_Shift_Ins	INS	-	-	CC	novel		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.1307_1308dup	p.Ser437ProfsTer40	p.S437Pfs*40	ENST00000379328	6/6	107	.	65	69	.	58	GATA3,frameshift_variant,p.Ser437ProfsTer40,ENST00000379328,NM_001002295.1,NM_002051.2;GATA3,frameshift_variant,p.Ser436ProfsTer40,ENST00000346208,;GATA3,non_coding_transcript_exon_variant,,ENST00000461472,;	CC	ENSG00000107485	ENST00000379328	Transcript	frameshift_variant	1872-1873/3078	1304-1305/1335	435/444	H/HX	cac/caCCc		1		1	GATA3	HGNC	4172	protein_coding	YES	CCDS31143.1	ENSP00000368632	P23771		UPI000002AA34	NM_001002295.1,NM_002051.2			6/6		PANTHER:PTHR10071:SF106,PANTHER:PTHR10071,PIRSF:PIRSF003027																	HIGH	1	insertion		4											1	.	CAC	.	.																					8115955
NAMPTL	0	.	GRCh37	10	36811687	36811688	+	3'UTR	INS	-	-	GT	rs143754208		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.*55_*56dup			ENST00000440465	1/1	95	.	11	77	.	0	NAMPTL,splice_region_variant,,ENST00000543053,;NAMPTL,3_prime_UTR_variant,,ENST00000440465,;	GT	ENSG00000229644	ENST00000440465	Transcript	3_prime_UTR_variant	1475-1476/2514					rs143754208	1		-1	NAMPTL	HGNC	17633	protein_coding	YES		ENSP00000407952		Q658Z1,Q5SYT8,F5H246	UPI00004701B5				1/1				0.1876	0.1571		0.1458	0.1869	0.1728										MODIFIER	1	insertion														.	AGG	.	.																					36811687
PLAU	5328	.	GRCh37	10	75672607	75672608	+	Intron	INS	-	-	AA	rs61567551		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.194-64_194-63dup			ENST00000372764		13	.	4	16	.	0	PLAU,intron_variant,,ENST00000372762,;PLAU,intron_variant,,ENST00000372764,NM_002658.3;C10orf55,intron_variant,,ENST00000409178,NM_001001791.2;C10orf55,intron_variant,,ENST00000412307,;PLAU,intron_variant,,ENST00000446342,NM_001145031.1;PLAU,intron_variant,,ENST00000481390,;PLAU,intron_variant,,ENST00000494287,;PLAU,downstream_gene_variant,,ENST00000496926,;,regulatory_region_variant,,ENSR00000029888,;	AA	ENSG00000122861	ENST00000372764	Transcript	intron_variant						rs61567551	2		1	PLAU	HGNC	9052	protein_coding	YES	CCDS7339.1	ENSP00000361850	P00749	S4R3G7,Q9UEJ5,Q96SE8	UPI000013CB02	NM_002658.3				4/10																		MODIFIER	1	insertion													1	.	TCA	.	.																					75672607
KCNMA1	3778	.	GRCh37	10	78839127	78839128	+	Intron	INS	-	-	GTGT	rs68133946		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.1593+108_1593+111dup			ENST00000404857		7	.	7	0	.	0	KCNMA1,intron_variant,,ENST00000286627,NM_002247.3,NM_001271519.1;KCNMA1,intron_variant,,ENST00000286628,NM_001161352.1;KCNMA1,intron_variant,,ENST00000354353,;KCNMA1,intron_variant,,ENST00000372403,;KCNMA1,intron_variant,,ENST00000372408,;KCNMA1,intron_variant,,ENST00000372421,;KCNMA1,intron_variant,,ENST00000372437,;KCNMA1,intron_variant,,ENST00000372440,;KCNMA1,intron_variant,,ENST00000372443,;KCNMA1,intron_variant,,ENST00000404771,;KCNMA1,intron_variant,,ENST00000404857,NM_001161353.1;KCNMA1,intron_variant,,ENST00000406533,;KCNMA1,intron_variant,,ENST00000428546,;KCNMA1,intron_variant,,ENST00000434208,;KCNMA1,intron_variant,,ENST00000450795,;KCNMA1,intron_variant,,ENST00000457953,;KCNMA1,intron_variant,,ENST00000604624,NM_001271518.1,NM_001014797.2;KCNMA1,intron_variant,,ENST00000484343,;KCNMA1,intron_variant,,ENST00000484507,;,regulatory_region_variant,,ENSR00001524269,;	GTGT	ENSG00000156113	ENST00000404857	Transcript	intron_variant						rs68133946	2		-1	KCNMA1	HGNC	6284	protein_coding	YES	CCDS53545.1	ENSP00000385806	Q12791		UPI00003519E8	NM_001161353.1				13/27			0.2307	0.4222		0.2192	0.3877	0.274										MODIFIER	1	insertion													1	.	GAG	.	.																					78839127
ARHGEF12	23365	.	GRCh37	11	120348771	120348772	+	Intron	INS	-	-	T	rs368383611		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.3533-82dup			ENST00000397843		3	.	3	0	.	0	ARHGEF12,intron_variant,,ENST00000356641,NM_001198665.1;ARHGEF12,intron_variant,,ENST00000397843,NM_015313.2;ARHGEF12,intron_variant,,ENST00000532993,;ARHGEF12,intron_variant,,ENST00000526067,;ARHGEF12,downstream_gene_variant,,ENST00000528681,;ARHGEF12,downstream_gene_variant,,ENST00000529970,;ARHGEF12,downstream_gene_variant,,ENST00000531616,;	T	ENSG00000196914	ENST00000397843	Transcript	intron_variant						rs368383611	1		1	ARHGEF12	HGNC	14193	protein_coding	YES	CCDS41727.1	ENSP00000380942	Q9NZN5	E9PMR6	UPI00000708ED	NM_015313.2				36/40																		MODIFIER	1	insertion													1	.	TGT	.	.																					120348771
TSFM	10102	.	GRCh37	12	58187017	58187017	+	Intron	DEL	T	T	-	rs947862578		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	T	T																c.634+170del			ENST00000323833		19	.	3	24	.	0	TSFM,intron_variant,,ENST00000323833,NM_001172696.1;TSFM,intron_variant,,ENST00000350762,;TSFM,intron_variant,,ENST00000454289,NM_005726.5;TSFM,intron_variant,,ENST00000457189,;TSFM,intron_variant,,ENST00000540550,NM_001172695.1;TSFM,intron_variant,,ENST00000543727,NM_001172697.1;TSFM,intron_variant,,ENST00000548851,;TSFM,intron_variant,,ENST00000550559,;AVIL,downstream_gene_variant,,ENST00000257861,NM_006576.3;TSFM,downstream_gene_variant,,ENST00000434359,;AVIL,downstream_gene_variant,,ENST00000537081,;TSFM,intron_variant,,ENST00000497617,;AVIL,downstream_gene_variant,,ENST00000546952,;AVIL,downstream_gene_variant,,ENST00000549851,;AVIL,downstream_gene_variant,,ENST00000551248,;	-	ENSG00000123297	ENST00000323833	Transcript	intron_variant						rs947862578	1		1	TSFM	HGNC	12367	protein_coding	YES	CCDS53809.1	ENSP00000313877	P43897		UPI000002A8C3	NM_001172696.1				6/6																		MODIFIER	1	deletion													1	.	TCTT	.	.																					58187016
GLIPR1	11010	.	GRCh37	12	75893479	75893479	+	3'UTR	DEL	A	A	-	rs35207358		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	A	A																c.*733del			ENST00000266659	6/6	3	.	3	0	.	0	GLIPR1,3_prime_UTR_variant,,ENST00000266659,NM_006851.2;KRR1,3_prime_UTR_variant,,ENST00000229214,NM_007043.6;KRR1,downstream_gene_variant,,ENST00000438169,;GLIPR1,downstream_gene_variant,,ENST00000456650,;GLIPR1,downstream_gene_variant,,ENST00000550491,;GLIPR1,downstream_gene_variant,,ENST00000536703,;KRR1,downstream_gene_variant,,ENST00000551070,;	-	ENSG00000139278	ENST00000266659	Transcript	3_prime_UTR_variant	1723/5877					rs35207358	1		1	GLIPR1	HGNC	17001	protein_coding	YES	CCDS9011.1	ENSP00000266659	P48060		UPI000012B60F	NM_006851.2			6/6				0.4387	0.5216		0.4157	0.4483	0.502										MODIFIER		deletion														.	CCAA	.	.																					75893478
NR1H4	9971	.	GRCh37	12	100930181	100930181	+	Intron	DEL	T	T	-	rs113077673		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	T	T																c.763-99del			ENST00000551379		16	.	3	21	.	0	NR1H4,intron_variant,,ENST00000188403,NM_001206993.1,NM_001206992.1;NR1H4,intron_variant,,ENST00000392986,;NR1H4,intron_variant,,ENST00000548884,NM_005123.3,NM_001206977.1,NM_001206979.1;NR1H4,intron_variant,,ENST00000549996,NM_001206978.1;NR1H4,intron_variant,,ENST00000551379,;NR1H4,intron_variant,,ENST00000321046,;	-	ENSG00000012504	ENST00000551379	Transcript	intron_variant						rs113077673	1		1	NR1H4	HGNC	7967	protein_coding	YES	CCDS55876.1	ENSP00000447149	Q96RI1	B7Z423	UPI000006E701					4/8																		MODIFIER	1	deletion													1	.	CCTT	.	.																					100930180
ANKRD13A	88455	.	GRCh37	12	110463769	110463770	+	Intron	INS	-	-	T	rs748271339		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.883+156dup			ENST00000261739		3	.	3	0	.	0	ANKRD13A,intron_variant,,ENST00000261739,NM_033121.1;ANKRD13A,intron_variant,,ENST00000547639,;C12orf76,downstream_gene_variant,,ENST00000546651,;ANKRD13A,upstream_gene_variant,,ENST00000547419,;ANKRD13A,upstream_gene_variant,,ENST00000551491,;ANKRD13A,downstream_gene_variant,,ENST00000550404,;ANKRD13A,intron_variant,,ENST00000546476,;ANKRD13A,intron_variant,,ENST00000553025,;ANKRD13A,upstream_gene_variant,,ENST00000549826,;ANKRD13A,upstream_gene_variant,,ENST00000553251,;	T	ENSG00000076513	ENST00000261739	Transcript	intron_variant						rs748271339	1		1	ANKRD13A	HGNC	21268	protein_coding	YES	CCDS9140.1	ENSP00000261739	Q8IZ07	Q3ZTS7,B4DDL0,B3KMT9	UPI000004472C	NM_033121.1				8/14																		MODIFIER	1	insertion														.	TCT	.	.																					110463769
TGDS	23483	.	GRCh37	13	95227139	95227141	+	Intron	DEL	AAG	AAG	-	rs201674028		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	AAG	AAG																c.983-35_983-33del			ENST00000261296		44	.	0	18	.	3	TGDS,intron_variant,,ENST00000261296,NM_014305.2;TGDS,downstream_gene_variant,,ENST00000498294,;TGDS,downstream_gene_variant,,ENST00000470480,;	A	ENSG00000088451	ENST00000261296	Transcript	intron_variant						rs201674028	2		-1	TGDS	HGNC	20324	protein_coding	YES	CCDS9471.1	ENSP00000261296	O95455	Q2TU31	UPI000006E8F4	NM_014305.2				11/11			0.6112	0.1988		0.0069	0.2873	0.1401	0.352	0.2172								MODIFIER	1	sequence_alteration													1	.	AAAAAGA	.	.												0.1115	0.3381	0.06527	0.12	0.001773	0.08812	0.1365	0.1266	0.06702	95227137
FAM177A1	283635	.	GRCh37	14	35515607	35515608	+	5'Flank	DEL	GG	GG	-	rs4007475		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	GG	GG																			ENST00000280987		7	.	4	4	.	0	FAM177A1,5_prime_UTR_variant,,ENST00000382406,;FAM177A1,intron_variant,,ENST00000396472,NM_001079519.1;FAM177A1,intron_variant,,ENST00000555211,;FAM177A1,upstream_gene_variant,,ENST00000280987,NM_173607.3;FAM177A1,upstream_gene_variant,,ENST00000554052,;FAM177A1,upstream_gene_variant,,ENST00000553852,;FAM177A1,upstream_gene_variant,,ENST00000553955,;FAM177A1,upstream_gene_variant,,ENST00000556858,;,regulatory_region_variant,,ENSR00000067618,;,TF_binding_site_variant,,ENSM00529338732,;,TF_binding_site_variant,,ENSM00522874412,;,TF_binding_site_variant,,ENSM00642279804,;	-	ENSG00000151327	ENST00000280987	Transcript	upstream_gene_variant						rs4007475	1	1	1	FAM177A1	HGNC	19829	protein_coding	YES	CCDS9653.2	ENSP00000280987	Q8N128	G3V583,G3V3Z5	UPI00005A8F3C	NM_173607.3																						MODIFIER	1	deletion			1											.	CTGGG	.	.																					35515606
RGS6	9628	.	GRCh37	14	72941206	72941207	+	Intron	INS	-	-	A	rs141283571		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.619-127_619-126insA			ENST00000553525		108	68	40	9	0	0	RGS6,intron_variant,,ENST00000343854,NM_001204419.1;RGS6,intron_variant,,ENST00000355512,;RGS6,intron_variant,,ENST00000402788,NM_001204423.1;RGS6,intron_variant,,ENST00000404301,;RGS6,intron_variant,,ENST00000406236,;RGS6,intron_variant,,ENST00000407322,;RGS6,intron_variant,,ENST00000434263,;RGS6,intron_variant,,ENST00000553525,NM_001204424.1;RGS6,intron_variant,,ENST00000553530,NM_004296.5,NM_001204422.1,NM_001204421.1,NM_001204418.1,NM_001204417.1,NM_001204420.1;RGS6,intron_variant,,ENST00000554782,;RGS6,intron_variant,,ENST00000555571,;RGS6,intron_variant,,ENST00000556437,NM_001204416.1;RGS6,intron_variant,,ENST00000555368,;RGS6,downstream_gene_variant,,ENST00000553690,;RGS6,intron_variant,,ENST00000554474,;RGS6,intron_variant,,ENST00000554734,;	A	ENSG00000182732	ENST00000553525	Transcript	intron_variant						rs141283571	1		1	RGS6	HGNC	10002	protein_coding	YES	CCDS55924.1	ENSP00000451030	P49758	Q59FJ8	UPI00001698D0	NM_001204424.1				9/17																		MODIFIER	1	insertion														.	TGG	.	.																					72941206
ATXN3	4287	.	GRCh37	14	92563255	92563255	+	Intron	DEL	T	T	-	rs398026196		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	T	T																c.25-73del			ENST00000393287		32	.	3	24	.	0	ATXN3,intron_variant,,ENST00000340660,NM_030660.4;ATXN3,intron_variant,,ENST00000393287,;ATXN3,intron_variant,,ENST00000429774,NM_001127696.1,NM_001164779.1,NM_001164782.1;ATXN3,intron_variant,,ENST00000502250,NM_001164780.1;ATXN3,intron_variant,,ENST00000503767,;ATXN3,intron_variant,,ENST00000506466,;ATXN3,intron_variant,,ENST00000532032,;ATXN3,intron_variant,,ENST00000545170,NM_004993.5,NM_001164776.1,NM_001164778.1,NM_001164774.1,NM_001164777.1;ATXN3,intron_variant,,ENST00000553491,NM_001127697.2;ATXN3,intron_variant,,ENST00000554592,;ATXN3,intron_variant,,ENST00000554672,;ATXN3,intron_variant,,ENST00000555381,NM_001164781.1;ATXN3,intron_variant,,ENST00000556220,;ATXN3,intron_variant,,ENST00000557311,;ATXN3,upstream_gene_variant,,ENST00000526872,;ATXN3,intron_variant,,ENST00000504047,;ATXN3,intron_variant,,ENST00000511362,;ATXN3,intron_variant,,ENST00000553287,;ATXN3,intron_variant,,ENST00000553309,;ATXN3,intron_variant,,ENST00000553498,;ATXN3,intron_variant,,ENST00000553686,;ATXN3,intron_variant,,ENST00000554040,;ATXN3,intron_variant,,ENST00000554214,;ATXN3,intron_variant,,ENST00000554491,;ATXN3,intron_variant,,ENST00000555958,;ATXN3,intron_variant,,ENST00000556339,;ATXN3,intron_variant,,ENST00000556644,;ATXN3,upstream_gene_variant,,ENST00000526245,;ATXN3,intron_variant,,ENST00000359366,;ATXN3,intron_variant,,ENST00000454964,;ATXN3,intron_variant,,ENST00000507965,;ATXN3,intron_variant,,ENST00000515746,;ATXN3,intron_variant,,ENST00000553488,;ATXN3,intron_variant,,ENST00000553570,;ATXN3,intron_variant,,ENST00000554350,;ATXN3,intron_variant,,ENST00000554673,;ATXN3,intron_variant,,ENST00000554994,;ATXN3,intron_variant,,ENST00000555816,;ATXN3,intron_variant,,ENST00000556082,;ATXN3,intron_variant,,ENST00000556274,;ATXN3,intron_variant,,ENST00000556288,;ATXN3,intron_variant,,ENST00000556315,;ATXN3,intron_variant,,ENST00000556374,;ATXN3,intron_variant,,ENST00000556671,;ATXN3,intron_variant,,ENST00000556898,;ATXN3,intron_variant,,ENST00000556958,;ATXN3,intron_variant,,ENST00000557030,;	-	ENSG00000066427	ENST00000393287	Transcript	intron_variant						rs398026196	2		-1	ATXN3	HGNC	7106	protein_coding	YES	CCDS9900.1	ENSP00000376965	P54252	G3V4F4,G3V2G2,D3VVM7,D3VVL3,D3VVJ0,D3VVF1,D3VVD5,D3VVC1	UPI000013D23A					1/10																		MODIFIER	1	sequence_alteration													1	.	AATT	.	.												0.1584	0.1307	0.2062	0.1491	0.1078	0.1475	0.1626	0.1551	0.1404	92563254
HERC2	8924	.	GRCh37	15	28473275	28473276	+	Intron	INS	-	-	A	rs367658561		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.5464+88dup			ENST00000261609		3	.	3	0	.	0	HERC2,intron_variant,,ENST00000261609,NM_004667.5;HERC2,intron_variant,,ENST00000569335,;	A	ENSG00000128731	ENST00000261609	Transcript	intron_variant						rs367658561	1		-1	HERC2	HGNC	4868	protein_coding	YES	CCDS10021.1	ENSP00000261609	O95714		UPI00004578F7	NM_004667.5				35/92																		MODIFIER	1	insertion													1	.	TTA	.	.																					28473275
KIAA1199	57214	.	GRCh37	15	81187287	81187288	+	Intron	INS	-	-	A	rs370268279		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.1087-44dup			ENST00000394685		4	.	4	0	.	0	KIAA1199,intron_variant,,ENST00000220244,NM_018689.1;KIAA1199,intron_variant,,ENST00000356249,;KIAA1199,intron_variant,,ENST00000394685,;RP11-351M8.1,downstream_gene_variant,,ENST00000560560,;RP11-351M8.1,downstream_gene_variant,,ENST00000561295,;RP11-351M8.2,downstream_gene_variant,,ENST00000560873,;RP11-351M8.1,downstream_gene_variant,,ENST00000558261,;	AA	ENSG00000103888	ENST00000394685	Transcript	intron_variant						rs370268279	2		1	KIAA1199	HGNC	29213	protein_coding	YES	CCDS10315.1	ENSP00000378177	Q8WUJ3		UPI00001D7799					10/29									0.03355	0.0292								MODIFIER	1	sequence_alteration														.	ATAA	.	.												0.0523	0.06667	0.07103	0.0798	0.06021	0.03167	0.04353	0.06482	0.06801	81187286
NTRK3	4916	.	GRCh37	15	88690737	88690757	+	Intron	DEL	CTTCTTCTTCTTCTTCTTCTT	CTTCTTCTTCTTCTTCTTCTT	-	rs34299110		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	CTTCTTCTTCTTCTTCTTCTT	CTTCTTCTTCTTCTTCTTCTT																c.396-123_396-103del			ENST00000360948		27	.	4	18	.	0	NTRK3,intron_variant,,ENST00000317501,NM_001007156.2;NTRK3,intron_variant,,ENST00000355254,;NTRK3,intron_variant,,ENST00000357724,;NTRK3,intron_variant,,ENST00000360948,NM_001012338.2;NTRK3,intron_variant,,ENST00000394480,NM_002530.3,NM_001243101.1;NTRK3,intron_variant,,ENST00000540489,;NTRK3,intron_variant,,ENST00000542733,;NTRK3,intron_variant,,ENST00000557856,;NTRK3,intron_variant,,ENST00000558676,;NTRK3,intron_variant,,ENST00000559188,;MED28P6,upstream_gene_variant,,ENST00000558776,;	-	ENSG00000140538	ENST00000360948	Transcript	intron_variant						rs34299110	1		-1	NTRK3	HGNC	8033	protein_coding	YES	CCDS32322.1	ENSP00000354207	Q16288	R4GNH5	UPI000006DC82	NM_001012338.2				4/18			0.7466	0.2968		0.373	0.3509	0.3896										MODIFIER	1	deletion													1	.	TCCTTCTTCTTCTTCTTCTTCTTC	.	.																					88690736
DECR2	26063	.	GRCh37	16	460579	460579	+	Intron	DEL	T	T	-	rs11315123		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	T	T																c.463-112del			ENST00000219481		3	.	3	0	.	0	DECR2,intron_variant,,ENST00000219481,NM_020664.3;DECR2,intron_variant,,ENST00000424398,;DECR2,downstream_gene_variant,,ENST00000397710,;DECR2,intron_variant,,ENST00000461947,;DECR2,downstream_gene_variant,,ENST00000461802,;DECR2,intron_variant,,ENST00000429116,;DECR2,intron_variant,,ENST00000437024,;DECR2,intron_variant,,ENST00000439661,;DECR2,intron_variant,,ENST00000445291,;DECR2,intron_variant,,ENST00000461749,;DECR2,intron_variant,,ENST00000469922,;NME4,downstream_gene_variant,,ENST00000444498,;DECR2,downstream_gene_variant,,ENST00000465166,;	-	ENSG00000242612	ENST00000219481	Transcript	intron_variant						rs11315123	1		1	DECR2	HGNC	2754	protein_coding	YES	CCDS10409.1	ENSP00000219481	Q9NUI1	Q9H3W9	UPI000003BBDC	NM_020664.3				5/8		0.5094	0.5189	0.5908		0.5089	0.4602	0.4898										MODIFIER	1	deletion														.	CCTG	.	.																					460578
PIGQ	9091	.	GRCh37	16	628995	628998	+	Intron	DEL	GGGC	GGGC	-	rs3842719		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	GGGC	GGGC																c.1223+62_1223+65del			ENST00000026218		41	.	7	17	.	0	PIGQ,intron_variant,,ENST00000026218,NM_148920.2;PIGQ,intron_variant,,ENST00000321878,NM_004204.3;PIGQ,intron_variant,,ENST00000409527,;PIGQ,downstream_gene_variant,,ENST00000293874,;PIGQ,downstream_gene_variant,,ENST00000409439,;PIGQ,downstream_gene_variant,,ENST00000422307,;PIGQ,downstream_gene_variant,,ENST00000439574,;PIGQ,downstream_gene_variant,,ENST00000470411,;PIGQ,upstream_gene_variant,,ENST00000540241,;PIGQ,upstream_gene_variant,,ENST00000540548,;PIGQ,downstream_gene_variant,,ENST00000544860,;PIGQ,intron_variant,,ENST00000420990,;PIGQ,intron_variant,,ENST00000443147,;PIGQ,intron_variant,,ENST00000480424,;PIGQ,upstream_gene_variant,,ENST00000476438,;PIGQ,downstream_gene_variant,,ENST00000537901,;,regulatory_region_variant,,ENSR00000371231,;	-	ENSG00000007541	ENST00000026218	Transcript	intron_variant						rs3842719	1		1	PIGQ	HGNC	14135	protein_coding	YES	CCDS10411.1	ENSP00000026218	Q9BRB3	J3QTH6,B8ZZC7,B8ZZ31,B8ZZ29	UPI000006CC88	NM_148920.2				6/9			0.4796	0.4928		0.6359	0.4324	0.6278										MODIFIER	1	deletion													1	.	CTGGGCG	.	.																					628994
MGRN1	23295	.	GRCh37	16	4700319	4700319	+	Intron	DEL	A	A	-	rs373572089		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	A	A																c.89-30del			ENST00000262370		17	.	3	15	.	0	MGRN1,intron_variant,,ENST00000262370,NM_015246.3;MGRN1,intron_variant,,ENST00000399577,NM_001142290.2;MGRN1,intron_variant,,ENST00000415496,NM_001142291.2,NM_001142289.2;MGRN1,intron_variant,,ENST00000586183,;MGRN1,intron_variant,,ENST00000587747,;MGRN1,intron_variant,,ENST00000588994,;MGRN1,intron_variant,,ENST00000591895,;MGRN1,upstream_gene_variant,,ENST00000590790,;MGRN1,upstream_gene_variant,,ENST00000593224,;MGRN1,intron_variant,,ENST00000536343,;,regulatory_region_variant,,ENSR00000371576,;,regulatory_region_variant,,ENSR00001583164,;	-	ENSG00000102858	ENST00000262370	Transcript	intron_variant						rs373572089	1		1	MGRN1	HGNC	20254	protein_coding	YES	CCDS42115.1	ENSP00000262370	O60291	K7ERA1	UPI000018CE7F	NM_015246.3				1/16																		MODIFIER	1	deletion														.	TCAA	.	.												0.3604	0.2748	0.3628	0.3578	0.3547	0.3812	0.3697	0.3768	0.3588	4700318
CSNK2A2	1459	.	GRCh37	16	58200465	58200466	+	Intron	DEL	CT	CT	-	rs112507755		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	CT	CT																c.827+22_827+23del			ENST00000262506		126	.	13	142	.	7	CSNK2A2,intron_variant,,ENST00000262506,NM_001896.2;CSNK2A2,intron_variant,,ENST00000563307,;CSNK2A2,intron_variant,,ENST00000567730,;CSNK2A2,intron_variant,,ENST00000566813,;	-	ENSG00000070770	ENST00000262506	Transcript	intron_variant						rs112507755	1		-1	CSNK2A2	HGNC	2459	protein_coding	YES	CCDS10794.1	ENSP00000262506	P19784	H3BNI9	UPI0000000C95	NM_001896.2				9/11																		MODIFIER	1	deletion														.	CACTC	.	.												0.2061	0.1364	0.2852	0.3089	0.2254	0.1273	0.1751	0.2383	0.3128	58200464
ADAD2	161931	.	GRCh37	16	84230068	84230080	+	Intron	DEL	CAACCCCTTCGCT	CAACCCCTTCGCT	-	rs3217260		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	CAACCCCTTCGCT	CAACCCCTTCGCT																c.1772+115_1772+127del			ENST00000268624		4	.	4	0	.	0	ADAD2,intron_variant,,ENST00000268624,NM_139174.3;ADAD2,intron_variant,,ENST00000315906,NM_001145400.1;ADAD2,downstream_gene_variant,,ENST00000567685,;RP11-486L19.2,intron_variant,,ENST00000536986,;RP11-486L19.2,intron_variant,,ENST00000565643,;RP11-486L19.2,intron_variant,,ENST00000569834,;RP11-486L19.2,upstream_gene_variant,,ENST00000561900,;ADAD2,downstream_gene_variant,,ENST00000567413,;ADAD2,intron_variant,,ENST00000564430,;ADAD2,intron_variant,,ENST00000566526,;ADAD2,upstream_gene_variant,,ENST00000563849,;ADAD2,downstream_gene_variant,,ENST00000564169,;ADAD2,downstream_gene_variant,,ENST00000569221,;,regulatory_region_variant,,ENSR00001589788,;	-	ENSG00000140955	ENST00000268624	Transcript	intron_variant						rs3217260	1		1	ADAD2	HGNC	30714	protein_coding	YES	CCDS10944.1	ENSP00000268624	Q8NCV1	D3DUL6	UPI000013D7CA	NM_139174.3				9/10																		MODIFIER	1	deletion														.	CGCAACCCCTTCGCTC	.	.																					84230067
ADAD2	161931	.	GRCh37	16	84230083	84230090	+	Intron	DEL	ACCCCTTC	ACCCCTTC	-	rs770359859		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	ACCCCTTC	ACCCCTTC																c.1772+107_1772+114del			ENST00000268624		12	8	4	10	0	0	ADAD2,intron_variant,,ENST00000268624,NM_139174.3;ADAD2,intron_variant,,ENST00000315906,NM_001145400.1;ADAD2,downstream_gene_variant,,ENST00000567685,;RP11-486L19.2,intron_variant,,ENST00000536986,;RP11-486L19.2,intron_variant,,ENST00000565643,;RP11-486L19.2,intron_variant,,ENST00000569834,;RP11-486L19.2,upstream_gene_variant,,ENST00000561900,;ADAD2,downstream_gene_variant,,ENST00000567413,;ADAD2,intron_variant,,ENST00000564430,;ADAD2,intron_variant,,ENST00000566526,;ADAD2,upstream_gene_variant,,ENST00000563849,;ADAD2,downstream_gene_variant,,ENST00000564169,;ADAD2,downstream_gene_variant,,ENST00000569221,;,regulatory_region_variant,,ENSR00001589788,;	-	ENSG00000140955	ENST00000268624	Transcript	intron_variant						rs770359859	1		1	ADAD2	HGNC	30714	protein_coding	YES	CCDS10944.1	ENSP00000268624	Q8NCV1	D3DUL6	UPI000013D7CA	NM_139174.3				9/10																		MODIFIER	1	deletion														.	CAACCCCTTCG	.	.																					84230082
ADAD2	161931	.	GRCh37	16	84230092	84230096	+	Intron	DEL	CTCAA	CTCAA	-	rs879172869		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	CTCAA	CTCAA																c.1772+117_1772+121del			ENST00000268624		11	7	4	12	0	0	ADAD2,intron_variant,,ENST00000268624,NM_139174.3;ADAD2,intron_variant,,ENST00000315906,NM_001145400.1;ADAD2,downstream_gene_variant,,ENST00000567685,;RP11-486L19.2,intron_variant,,ENST00000536986,;RP11-486L19.2,intron_variant,,ENST00000565643,;RP11-486L19.2,intron_variant,,ENST00000569834,;RP11-486L19.2,upstream_gene_variant,,ENST00000561900,;ADAD2,downstream_gene_variant,,ENST00000567413,;ADAD2,intron_variant,,ENST00000564430,;ADAD2,intron_variant,,ENST00000566526,;ADAD2,upstream_gene_variant,,ENST00000563849,;ADAD2,downstream_gene_variant,,ENST00000564169,;ADAD2,downstream_gene_variant,,ENST00000569221,;,regulatory_region_variant,,ENSR00001589788,;	-	ENSG00000140955	ENST00000268624	Transcript	intron_variant						rs879172869	1		1	ADAD2	HGNC	30714	protein_coding	YES	CCDS10944.1	ENSP00000268624	Q8NCV1	D3DUL6	UPI000013D7CA	NM_139174.3				9/10																		MODIFIER	1	deletion														.	CGCTCAAC	.	.																					84230091
ACSF3	197322	.	GRCh37	16	89167075	89167076	+	5'UTR	INS	-	-	CCCAGGAGGCTCCCGGGAG	rs11273288		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.-14_-13insCCAGGAGGCTCCCGGGAGC			ENST00000317447	3/11	3	.	3	0	.	0	ACSF3,5_prime_UTR_variant,,ENST00000317447,NM_174917.3,NM_001127214.2,NM_001243279.1,NM_001284316.1;ACSF3,5_prime_UTR_variant,,ENST00000406948,;ACSF3,5_prime_UTR_variant,,ENST00000537290,;ACSF3,5_prime_UTR_variant,,ENST00000541755,;ACSF3,intron_variant,,ENST00000378345,;ACSF3,intron_variant,,ENST00000537895,;ACSF3,intron_variant,,ENST00000540697,;ACSF3,upstream_gene_variant,,ENST00000538340,;ACSF3,upstream_gene_variant,,ENST00000543676,;ACSF3,upstream_gene_variant,,ENST00000544543,;ACSF3,5_prime_UTR_variant,,ENST00000542688,;	CCCAGGAGGCTCCCGGGAG	ENSG00000176715	ENST00000317447	Transcript	5_prime_UTR_variant	363-364/3664					rs11273288	1		1	ACSF3	HGNC	27288	protein_coding	YES	CCDS10974.1	ENSP00000320646	Q4G176	H3BTS0,F5H755,F5H5A1,F5H3B2,F5H362,F5GX20	UPI00001AF19E	NM_174917.3,NM_001127214.2,NM_001243279.1,NM_001284316.1			3/11				0.5295	0.7233		0.3978	0.7187	0.4642	0.5032	0.6828								MODIFIER	1	insertion			1										1	.	GCC	.	.																					89167075
YWHAE	7531	.	GRCh37	17	1264612	1264612	+	Intron	DEL	A	A	-	rs55734488		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	A	A																c.372-20del			ENST00000264335		32	.	5	26	.	0	YWHAE,intron_variant,,ENST00000264335,NM_006761.4;YWHAE,intron_variant,,ENST00000571732,;YWHAE,intron_variant,,ENST00000573026,;YWHAE,intron_variant,,ENST00000575977,;YWHAE,upstream_gene_variant,,ENST00000496706,;YWHAE,intron_variant,,ENST00000466227,;YWHAE,intron_variant,,ENST00000573196,;YWHAE,downstream_gene_variant,,ENST00000469398,;YWHAE,downstream_gene_variant,,ENST00000486241,;YWHAE,downstream_gene_variant,,ENST00000489287,;,regulatory_region_variant,,ENSR00001590983,;	-	ENSG00000108953	ENST00000264335	Transcript	intron_variant						rs55734488	1		-1	YWHAE	HGNC	12851	protein_coding	YES	CCDS11001.1	ENSP00000264335	P62258	B7ZA86	UPI0000021A46	NM_006761.4				3/5			0.4191	0.5202		0.4514	0.4105	0.4673										MODIFIER	1	deletion													1	.	TTAA	.	.												0.4478	0.4579	0.4971	0.4432	0.4751	0.4459	0.4302	0.4415	0.4605	1264611
MNT	4335	.	GRCh37	17	2297572	2297573	+	Intron	DEL	CA	CA	-	rs35367394		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	CA	CA																c.695+26_695+27del			ENST00000174618		7	.	7	0	.	0	MNT,intron_variant,,ENST00000174618,NM_020310.2;MNT,intron_variant,,ENST00000575394,;MNT,upstream_gene_variant,,ENST00000571232,;MNT,downstream_gene_variant,,ENST00000571836,;MNT,upstream_gene_variant,,ENST00000572892,;MNT,downstream_gene_variant,,ENST00000574559,;MNT,upstream_gene_variant,,ENST00000575374,;MNT,upstream_gene_variant,,ENST00000575402,;,regulatory_region_variant,,ENSR00000282087,;	-	ENSG00000070444	ENST00000174618	Transcript	intron_variant						rs35367394	1		-1	MNT	HGNC	7188	protein_coding	YES	CCDS11018.1	ENSP00000174618	Q99583	K7ES66	UPI000012F2C6	NM_020310.2				3/5																		MODIFIER	1	deletion														.	CGCAC	.	.																					2297571
SPATA22	84690	.	GRCh37	17	3352494	3352495	+	Intron	INS	-	-	A	rs35147573		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.330-52dup			ENST00000573128		20	.	3	26	.	0	SPATA22,intron_variant,,ENST00000268981,NM_001170699.1;SPATA22,intron_variant,,ENST00000355380,NM_001170696.1;SPATA22,intron_variant,,ENST00000397168,NM_032598.4;SPATA22,intron_variant,,ENST00000541913,;SPATA22,intron_variant,,ENST00000571553,;SPATA22,intron_variant,,ENST00000571607,;SPATA22,intron_variant,,ENST00000572582,;SPATA22,intron_variant,,ENST00000572969,NM_001170698.1;SPATA22,intron_variant,,ENST00000573128,;SPATA22,intron_variant,,ENST00000574051,;SPATA22,intron_variant,,ENST00000574797,;SPATA22,intron_variant,,ENST00000575375,NM_001170697.1,NM_001170695.1;	A	ENSG00000141255	ENST00000573128	Transcript	intron_variant						rs35147573	1		-1	SPATA22	HGNC	30705	protein_coding	YES	CCDS11027.1	ENSP00000459580	Q8NHS9	I3L517,I3L4D7,I3L2B9,I3L1L5	UPI0000140D16					5/8			0.2209	0.3501		0.4187	0.1809	0.2014	0.1994	0.1555								MODIFIER	1	insertion														.	ACA	.	.												0.1589	0.1586	0.2349	0.1283	0.2933	0.2218	0.1151	0.1568	0.139	3352494
CHRNE	1145	.	GRCh37	17	4802256	4802275	+	Intron	DEL	GCCTCTGCCTCGCTCCACCC	GCCTCTGCCTCGCTCCACCC	-	rs147753790		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	GCCTCTGCCTCGCTCCACCC	GCCTCTGCCTCGCTCCACCC																c.1326+21_1326+40del			ENST00000293780		13	.	6	5	.	0	CHRNE,intron_variant,,ENST00000293780,NM_000080.3;MINK1,downstream_gene_variant,,ENST00000347992,NM_170663.4;MINK1,downstream_gene_variant,,ENST00000355280,NM_001024937.3,NM_015716.4,NM_153827.4;C17orf107,upstream_gene_variant,,ENST00000381365,NM_001145536.1;MINK1,downstream_gene_variant,,ENST00000453408,;C17orf107,upstream_gene_variant,,ENST00000521575,;MINK1,downstream_gene_variant,,ENST00000576037,;CHRNE,downstream_gene_variant,,ENST00000575637,;CHRNE,intron_variant,,ENST00000572438,;MINK1,downstream_gene_variant,,ENST00000571207,;MINK1,downstream_gene_variant,,ENST00000572304,;MINK1,downstream_gene_variant,,ENST00000572330,;MINK1,downstream_gene_variant,,ENST00000574453,;MINK1,downstream_gene_variant,,ENST00000574871,;MINK1,downstream_gene_variant,,ENST00000575511,;,regulatory_region_variant,,ENSR00000090557,;	-	ENSG00000108556	ENST00000293780	Transcript	intron_variant						rs147753790	1		-1	CHRNE	HGNC	1966	protein_coding	YES	CCDS11058.1	ENSP00000293780	Q04844	Q8N731	UPI0000125262	NM_000080.3				11/11									0.02746	0.07156								MODIFIER	1	deletion													1	.	GGGCCTCTGCCTCGCTCCACCCG	.	.												0.1776	0.02954	0.1431	0.137	0.5296	0.1362	0.08897	0.1373	0.3504	4802255
SCPEP1	59342	.	GRCh37	17	55075671	55075671	+	Intron	DEL	A	A	-	rs367630962		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	A	A																c.881-75del			ENST00000262288		36	.	8	31	.	0	SCPEP1,intron_variant,,ENST00000262288,NM_021626.2;SCPEP1,intron_variant,,ENST00000573239,;SCPEP1,downstream_gene_variant,,ENST00000575395,;AC007114.1,upstream_gene_variant,,ENST00000580911,;SCPEP1,downstream_gene_variant,,ENST00000571345,;SCPEP1,downstream_gene_variant,,ENST00000571898,;SCPEP1,non_coding_transcript_exon_variant,,ENST00000570479,;SCPEP1,non_coding_transcript_exon_variant,,ENST00000570505,;SCPEP1,intron_variant,,ENST00000575423,;SCPEP1,intron_variant,,ENST00000576154,;SCPEP1,downstream_gene_variant,,ENST00000570480,;SCPEP1,downstream_gene_variant,,ENST00000570589,;SCPEP1,downstream_gene_variant,,ENST00000572591,;SCPEP1,downstream_gene_variant,,ENST00000573789,;	-	ENSG00000121064	ENST00000262288	Transcript	intron_variant						rs367630962	2		1	SCPEP1	HGNC	29507	protein_coding	YES	CCDS11593.1	ENSP00000262288	Q9HB40	I3L506	UPI0000038BD2	NM_021626.2				9/12																		MODIFIER	1	sequence_alteration														.	TCAA	.	.																					55075670
APPBP2	10513	.	GRCh37	17	58525217	58525217	+	Intron	DEL	A	A	-	rs572924329		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	A	A																c.1505-22del			ENST00000083182		3	.	3	0	.	0	APPBP2,intron_variant,,ENST00000083182,NM_006380.2,NM_001282476.1;APPBP2,intron_variant,,ENST00000589341,;	-	ENSG00000062725	ENST00000083182	Transcript	intron_variant						rs572924329	1		-1	APPBP2	HGNC	622	protein_coding	YES	CCDS32699.1	ENSP00000083182	Q92624	K7EIZ9	UPI000006D959	NM_006380.2,NM_001282476.1				12/12									0.2135	0.22								MODIFIER	1	deletion														.	GGAA	.	.												0.2813	0.2856	0.3084	0.2964	0.2815	0.2519	0.2729	0.2913	0.3088	58525216
ABCA6	23460	.	GRCh37	17	67101528	67101528	+	Intron	DEL	C	C	-	rs920437473		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	C	C																c.2740+75del			ENST00000284425		3	.	3	0	.	0	ABCA6,intron_variant,,ENST00000284425,NM_080284.2;ABCA6,non_coding_transcript_exon_variant,,ENST00000590311,;ABCA6,downstream_gene_variant,,ENST00000589803,;	-	ENSG00000154262	ENST00000284425	Transcript	intron_variant						rs920437473	1		-1	ABCA6	HGNC	36	protein_coding	YES	CCDS11683.1	ENSP00000284425	Q8N139		UPI000013DD9D	NM_080284.2				20/38																		MODIFIER	1	deletion														.	TTCC	.	.																					67101527
DNAH17	8632	.	GRCh37	17	76456460	76456460	+	Intron	INS	A	A	GCA	novel		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	A	A																c.9298-121_9298-120insGC			ENST00000389840		44	37	7	34	0	0	DNAH17,intron_variant,,ENST00000389840,;DNAH17,intron_variant,,ENST00000585328,NM_173628.3;DNAH17,intron_variant,,ENST00000586052,;DNAH17,upstream_gene_variant,,ENST00000592152,;DNAH17,intron_variant,,ENST00000591369,;	AGTGTGCA	ENSG00000187775	ENST00000389840	Transcript	intron_variant							2		-1	DNAH17	HGNC	2946	protein_coding	YES		ENSP00000374490	Q9UFH2		UPI0001A5EE11					58/80																		MODIFIER	1	sequence_alteration													1	.	TGAGTGTAT	.	.																					76456454
ATP5A1	498	.	GRCh37	18	43666304	43666305	+	Intron	INS	-	-	T	rs1555694804		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.1284+48_1284+49insA			ENST00000282050		35	.	35	36	.	36	ATP5A1,intron_variant,,ENST00000282050,NM_001001937.1;ATP5A1,intron_variant,,ENST00000398752,NM_004046.5,NM_001001935.2;ATP5A1,intron_variant,,ENST00000590665,NM_001257334.1;ATP5A1,intron_variant,,ENST00000593152,NM_001257335.1;ATP5A1,downstream_gene_variant,,ENST00000589252,;ATP5A1,downstream_gene_variant,,ENST00000589869,;ATP5A1,downstream_gene_variant,,ENST00000590324,;ATP5A1,downstream_gene_variant,,ENST00000590406,;ATP5A1,downstream_gene_variant,,ENST00000592989,;ATP5A1,non_coding_transcript_exon_variant,,ENST00000586523,;ATP5A1,intron_variant,,ENST00000586592,;ATP5A1,intron_variant,,ENST00000587902,;ATP5A1,intron_variant,,ENST00000590156,;ATP5A1,intron_variant,,ENST00000592364,;ATP5A1,downstream_gene_variant,,ENST00000585650,;ATP5A1,downstream_gene_variant,,ENST00000589611,;ATP5A1,downstream_gene_variant,,ENST00000590448,;ATP5A1,downstream_gene_variant,,ENST00000591981,;	AGTTAATATATTAATACCTTAAGAT	ENSG00000152234	ENST00000282050	Transcript	intron_variant						rs1555694804,COSV56359510	2		-1	ATP5A1	HGNC	823	protein_coding	YES	CCDS11927.1	ENSP00000282050	P25705	K7EQH4,K7ERX7,K7EK77,K7EJP1,B4DGW3	UPI000006221A	NM_001001937.1				10/12									0.04878	0.2361		0,1						MODIFIER	1	sequence_alteration			0,1										1	.	ATAGTTAATATATTAATACCTTAAGAT	.	.																					43666280
ZNF57	126295	.	GRCh37	19	2901115	2901124	+	Intron	DEL	GCCGAAGTCT	GCCGAAGTCT	-	rs11279103		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	GCCGAAGTCT	GCCGAAGTCT																c.3+71_3+80del			ENST00000306908		18	.	5	4	.	0	ZNF57,intron_variant,,ENST00000306908,NM_173480.2;AC119403.1,upstream_gene_variant,,ENST00000590960,;,regulatory_region_variant,,ENSR00000105958,;	-	ENSG00000171970	ENST00000306908	Transcript	intron_variant						rs11279103	1		1	ZNF57	HGNC	13125	protein_coding	YES	CCDS12098.1	ENSP00000303696	Q68EA5	K7ERB8,G3V131,E5RHE3,A5HJR3	UPI000006FE5C	NM_173480.2				1/3			0.6097	0.8112		0.7212	0.8777	0.771	0.6039	0.8337								MODIFIER	1	deletion														.	CCGCCGAAGTCTG	.	.																					2901114
ANKRD24	170961	.	GRCh37	19	4199809	4199810	+	Intron	INS	-	-	A	rs112892199		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.123+43_123+44insA			ENST00000600132		8	.	5	3	.	0	ANKRD24,intron_variant,,ENST00000262970,;ANKRD24,intron_variant,,ENST00000318934,;ANKRD24,intron_variant,,ENST00000597689,;ANKRD24,intron_variant,,ENST00000600132,NM_133475.1;ANKRD24,intron_variant,,ENST00000595928,;,regulatory_region_variant,,ENSR00001154223,;,regulatory_region_variant,,ENSR00001608547,;	A	ENSG00000089847	ENST00000600132	Transcript	intron_variant						rs112892199	1		1	ANKRD24	HGNC	29424	protein_coding	YES	CCDS45925.1	ENSP00000471252	Q8TF21		UPI000041F5A9	NM_133475.1				3/21		0.3622	0.3843	0.3127		0.3234	0.4622	0.3047	0.3898	0.4136								MODIFIER	1	insertion														.	TCG	.	.												0.3727	0.3854	0.2761	0.3553	0.3441	0.4804	0.4255	0.405	0.308	4199809
EPS15L1	58513	.	GRCh37	19	16513358	16513358	+	Intron	DEL	T	T	-	rs34782743		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	T	T																c.1627-62del			ENST00000455140		4	.	4	0	.	0	EPS15L1,intron_variant,,ENST00000248070,NM_021235.2;EPS15L1,intron_variant,,ENST00000455140,NM_001258374.1;EPS15L1,intron_variant,,ENST00000535753,NM_001258375.1;EPS15L1,intron_variant,,ENST00000594975,;EPS15L1,intron_variant,,ENST00000597937,NM_001258376.1;EPS15L1,intron_variant,,ENST00000599790,;EPS15L1,intron_variant,,ENST00000602009,;RN7SL844P,upstream_gene_variant,,ENST00000473320,;EPS15L1,intron_variant,,ENST00000592031,;EPS15L1,intron_variant,,ENST00000602022,;	-	ENSG00000127527	ENST00000455140	Transcript	intron_variant						rs34782743	1		-1	EPS15L1	HGNC	24634	protein_coding	YES	CCDS58654.1	ENSP00000393313	Q9UBC2		UPI0000D4C04A	NM_001258374.1				15/23			0.1362	0.1037		0.119	0.1769	0.184										MODIFIER	1	deletion													1	.	GCTT	.	.																					16513357
SPTBN4	57731	.	GRCh37	19	41062903	41062903	+	Intron	DEL	C	C	-	rs34510741		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	C	C																c.5290-16del			ENST00000352632		46	.	9	20	.	0	SPTBN4,intron_variant,,ENST00000338932,;SPTBN4,intron_variant,,ENST00000352632,;SPTBN4,intron_variant,,ENST00000392023,NM_025213.2;SPTBN4,intron_variant,,ENST00000392025,;SPTBN4,intron_variant,,ENST00000595535,;SPTBN4,intron_variant,,ENST00000598249,NM_020971.2;SPTBN4,intron_variant,,ENST00000597389,;SPTBN4,downstream_gene_variant,,ENST00000596900,;	-	ENSG00000160460	ENST00000352632	Transcript	intron_variant						rs34510741	1		1	SPTBN4	HGNC	14896	protein_coding	YES	CCDS12559.1	ENSP00000263373	Q9H254		UPI0000135DBB					25/35																		MODIFIER	1	deletion														.	TACC	.	.												0.459	0.4639	0.4607	0.46	0.4564	0.4579	0.4597	0.446	0.4547	41062902
SNX5	27131	.	GRCh37	20	17928176	17928178	+	In_Frame_Del	DEL	CTG	CTG	-	novel		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	CTG	CTG																c.1030_1032del	p.Gln344del	p.Q344del	ENST00000377768	12/14	330	.	239	255	.	249	SNX5,inframe_deletion,p.Gln344del,ENST00000377768,NM_152227.1;SNX5,inframe_deletion,p.Gln344del,ENST00000377759,NM_014426.2;SNX5,downstream_gene_variant,,ENST00000419004,;SNX5,downstream_gene_variant,,ENST00000431277,;SNX5,non_coding_transcript_exon_variant,,ENST00000483485,;SNX5,non_coding_transcript_exon_variant,,ENST00000490175,;SNX5,non_coding_transcript_exon_variant,,ENST00000476648,;SNX5,non_coding_transcript_exon_variant,,ENST00000491090,;SNX5,downstream_gene_variant,,ENST00000474883,;SNX5,downstream_gene_variant,,ENST00000494401,;SNX5,non_coding_transcript_exon_variant,,ENST00000463050,;SNX5,upstream_gene_variant,,ENST00000484809,;SNX5,upstream_gene_variant,,ENST00000606570,;	-	ENSG00000089006	ENST00000377768	Transcript	inframe_deletion	1343-1345/2288	1030-1032/1215	344/404	Q/-	CAG/-		1		-1	SNX5	HGNC	14969	protein_coding	YES	CCDS13130.1	ENSP00000366998	Q9Y5X3		UPI0000135B43	NM_152227.1			12/14		Pfam:PF09325,PIRSF:PIRSF036924,PANTHER:PTHR10555,PANTHER:PTHR10555:SF6,Superfamily:SSF103657																	MODERATE	1	deletion														.	TCCTGC	.	.																					17928175
DEFB124	245937	.	GRCh37	20	30060721	30060722	+	Intron	DEL	CA	CA	-	rs34150499		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	CA	CA																c.58+37_58+38del			ENST00000317676		54	.	40	40	.	37	DEFB124,intron_variant,,ENST00000317676,NM_001037500.1;REM1,upstream_gene_variant,,ENST00000201979,NM_014012.5;DEFB124,non_coding_transcript_exon_variant,,ENST00000481595,;	-	ENSG00000180383	ENST00000317676	Transcript	intron_variant						rs34150499	1		-1	DEFB124	HGNC	18104	protein_coding	YES	CCDS33457.1	ENSP00000326309	Q8NES8		UPI00005E4A77	NM_001037500.1				1/1																		MODIFIER	1	deletion														.	TGCAC	.	.												0.03977	0.002389	0.04327	0.03699	0.04636	0.03243	0.04198	0.03237	0.0579	30060720
TPX2	22974	.	GRCh37	20	30354259	30354260	+	Intron	INS	-	-	GT	rs35700111		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.230-101_230-100dup			ENST00000300403		41	.	3	48	.	1	TPX2,intron_variant,,ENST00000300403,NM_012112.4;TPX2,intron_variant,,ENST00000340513,;	GTGT	ENSG00000088325	ENST00000300403	Transcript	intron_variant						rs35700111	1		1	TPX2	HGNC	1249	protein_coding	YES	CCDS13190.1	ENSP00000300403	Q9ULW0	Q96FC3,Q643R0,B3KM90	UPI00000015BB	NM_012112.4				4/17																		MODIFIER	1	sequence_alteration														.	GGGTG	.	.																					30354257
NCOA3	8202	.	GRCh37	20	46279834	46279836	+	In_Frame_Del	DEL	CAA	CAA	-	rs767107142		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	CAA	CAA																c.3762_3764del	p.Gln1276del	p.Q1276del	ENST00000371998	20/23	118	107	11	70	0	0	NCOA3,inframe_deletion,p.Gln1272del,ENST00000372004,NM_006534.3,NM_181659.2,NM_001174088.1,NM_001174087.1;NCOA3,inframe_deletion,p.Gln1202del,ENST00000341724,;NCOA3,inframe_deletion,p.Gln1267del,ENST00000371997,;NCOA3,inframe_deletion,p.Gln1276del,ENST00000371998,;	-	ENSG00000124151	ENST00000371998	Transcript	inframe_deletion	3951-3953/4668	3760-3762/4275	1254/1424	Q/-	CAA/-	rs767107142	1		1	NCOA3	HGNC	7670	protein_coding	YES	CCDS13407.1	ENSP00000361066	Q9Y6Q9	Q569F6,B4DYT5	UPI000012FE45				20/23		Coiled-coils_(Ncoils):Coil,PIRSF:PIRSF038181,PANTHER:PTHR10684,PANTHER:PTHR10684:SF3,Low_complexity_(Seg):seg																	MODERATE	1	deletion		2												.	AGCAAC	.	.												0.0002913	0.0001254	2.92e-05		0.002922	4.766e-05	9.211e-05		0.0001334	46279833
LTN1	26046	.	GRCh37	21	30338153	30338154	+	Intron	INS	-	-	A	rs71335064		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.2301+33dup			ENST00000389194		3	.	3	0	.	0	LTN1,intron_variant,,ENST00000361371,;LTN1,intron_variant,,ENST00000389194,NM_015565.2;LTN1,intron_variant,,ENST00000389195,;LTN1,downstream_gene_variant,,ENST00000483326,;	A	ENSG00000198862	ENST00000389194	Transcript	intron_variant						rs71335064	1		-1	LTN1	HGNC	13082	protein_coding	YES	CCDS33527.2	ENSP00000373846	O94822	G1UI34	UPI000049DF6C	NM_015565.2				11/29									0.07002	0.07561								MODIFIER	1	insertion														.	ACA	.	.												0.1059	0.1156	0.1356	0.1134	0.1198	0.03406	0.0989	0.1127	0.1603	30338153
IFNAR1	3454	.	GRCh37	21	34726106	34726107	+	Intron	INS	-	-	T	rs772509641		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.1440+24dup			ENST00000270139		253	.	148	229	.	191	IFNAR1,intron_variant,,ENST00000270139,NM_000629.2;IFNAR1,intron_variant,,ENST00000416947,;IFNAR1,intron_variant,,ENST00000442357,;	T	ENSG00000142166	ENST00000270139	Transcript	intron_variant						rs772509641	1		1	IFNAR1	HGNC	5432	protein_coding	YES	CCDS13624.1	ENSP00000270139	P17181	B4DNT3	UPI000006FE3C	NM_000629.2				10/10																		MODIFIER	1	insertion														.	TAT	.	.												5.992e-05	7.422e-05		0.0001161			0.0001004			34726106
DSCAM	1826	.	GRCh37	21	41384834	41384835	+	3'UTR	INS	-	-	TT	rs11451228		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.*125_*126dup			ENST00000400454	33/33	6	.	3	4	.	0	DSCAM,3_prime_UTR_variant,,ENST00000400454,NM_001271534.1,NM_001389.3;DSCAM,3_prime_UTR_variant,,ENST00000404019,;	TT	ENSG00000171587	ENST00000400454	Transcript	3_prime_UTR_variant	6643-6644/8552					rs11451228	1		-1	DSCAM	HGNC	3039	protein_coding	YES	CCDS42929.1	ENSP00000383303	O60469		UPI00000422DF	NM_001271534.1,NM_001389.3			33/33				0.2451	0.2277		0.1389	0.3738	0.2423										MODIFIER	1	insertion														.	TCT	.	.																					41384834
AIRE	326	.	GRCh37	21	45712358	45712358	+	Intron	DEL	C	C	-	rs5844181		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	C	C																c.1095+78del			ENST00000291582		8	.	4	3	.	0	AIRE,intron_variant,,ENST00000291582,NM_000383.3;AIRE,intron_variant,,ENST00000329347,;AIRE,intron_variant,,ENST00000355347,;AIRE,intron_variant,,ENST00000337909,;AIRE,intron_variant,,ENST00000397994,;AIRE,intron_variant,,ENST00000527919,;AIRE,intron_variant,,ENST00000530812,;	-	ENSG00000160224	ENST00000291582	Transcript	intron_variant						rs5844181	1		1	AIRE	HGNC	360	protein_coding	YES	CCDS13706.1	ENSP00000291582	O43918		UPI0000030FA6	NM_000383.3				9/13																		MODIFIER	1	deletion													1	.	CACC	.	.																					45712357
OSBP2	23762	.	GRCh37	22	31301792	31301793	+	Intron	INS	-	-	GCCACC	rs201836388		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.2376-19_2376-14dup			ENST00000332585		4	.	4	0	.	0	OSBP2,intron_variant,,ENST00000332585,NM_030758.3;OSBP2,intron_variant,,ENST00000382310,;OSBP2,intron_variant,,ENST00000401475,NM_001282740.1;OSBP2,intron_variant,,ENST00000403222,NM_001282738.1;OSBP2,intron_variant,,ENST00000407373,;OSBP2,intron_variant,,ENST00000431368,;OSBP2,intron_variant,,ENST00000437268,NM_001282741.1;OSBP2,intron_variant,,ENST00000446658,NM_001282739.1;OSBP2,intron_variant,,ENST00000452656,;OSBP2,intron_variant,,ENST00000535268,NM_001282742.1;EIF4HP2,downstream_gene_variant,,ENST00000424380,;	GCCACC	ENSG00000184792	ENST00000332585	Transcript	intron_variant						rs201836388	1		1	OSBP2	HGNC	8504	protein_coding	YES	CCDS43002.1	ENSP00000332576	Q969R2	C9JS84,C9J7J0	UPI0000161E15	NM_030758.3				12/13			0.003	0.0303			0.0487	0.0072	0.007321	0.04166								MODIFIER	1	insertion														.	CAG	.	.												0.03039	0.006374	0.02086	0.08495	0.0001156	0.0256	0.04123	0.03983	0.01713	31301792
ACO2	50	.	GRCh37	22	41918654	41918654	+	Intron	DEL	T	T	-	rs11331024		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	T	T																c.1139-179del			ENST00000216254		4	.	4	2	.	0	ACO2,intron_variant,,ENST00000216254,NM_001098.2;ACO2,intron_variant,,ENST00000396512,;POLR3H,downstream_gene_variant,,ENST00000355209,NM_001018050.2;POLR3H,downstream_gene_variant,,ENST00000396504,NM_138338.3,NM_001282885.1,NM_001282884.1;ACO2,downstream_gene_variant,,ENST00000466237,;	-	ENSG00000100412	ENST00000216254	Transcript	intron_variant						rs11331024	1		1	ACO2	HGNC	118	protein_coding	YES	CCDS14017.1	ENSP00000216254	Q99798	B4DZ08,B4DEC3	UPI000003CA3B	NM_001098.2				9/17			0.0272	0.4308		0.0546	0.2137	0.3262										MODIFIER	1	deletion													1	.	AGTT	.	.																					41918653
ACOT9	23597	.	GRCh37	X	23724676	23724678	+	Intron	DEL	AAA	AAA	-	rs35002168		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	AAA	AAA																c.842+67_842+69del			ENST00000379303		20	.	3	28	.	0	ACOT9,intron_variant,,ENST00000336430,NM_001033583.2;ACOT9,intron_variant,,ENST00000379295,;ACOT9,intron_variant,,ENST00000379303,NM_001037171.1;ACOT9,intron_variant,,ENST00000473710,;ACOT9,downstream_gene_variant,,ENST00000492081,;ACOT9,intron_variant,,ENST00000379297,;ACOT9,intron_variant,,ENST00000494361,;ACOT9,downstream_gene_variant,,ENST00000449612,;	-	ENSG00000123130	ENST00000379303	Transcript	intron_variant						rs35002168	1		-1	ACOT9	HGNC	17152	protein_coding	YES	CCDS43924.1	ENSP00000368605	Q9Y305	Q9H2R8	UPI00003D7D31	NM_001037171.1				11/15																		MODIFIER	1	sequence_alteration														.	TCAAAA	.	.																					23724675
PFKFB1	5207	.	GRCh37	X	54972154	54972155	+	Intron	INS	-	-	GT	rs779266579		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.994-180_994-179dup			ENST00000375006		8	6	2	13	0	0	PFKFB1,intron_variant,,ENST00000374992,;PFKFB1,intron_variant,,ENST00000375006,NM_001271804.1,NM_002625.3;PFKFB1,intron_variant,,ENST00000545676,NM_001271805.1;	GT	ENSG00000158571	ENST00000375006	Transcript	intron_variant						rs779266579	1		-1	PFKFB1	HGNC	8872	protein_coding	YES	CCDS14364.1	ENSP00000364145	P16118	I1Z9G4,I1Z9G3	UPI000012A3ED	NM_001271804.1,NM_002625.3				9/13																		MODIFIER	1	insertion														.	GCG	.	.																					54972154
APEX2	27301	.	GRCh37	X	55027965	55027965	+	Intron	DEL	T	T	-	rs375803683		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	T	T																c.158-5del			ENST00000374987		5	.	5	0	.	0	APEX2,intron_variant,,ENST00000374987,NM_014481.3;PFKFB1,upstream_gene_variant,,ENST00000545676,NM_001271805.1;APEX2,intron_variant,,ENST00000471758,;,regulatory_region_variant,,ENSR00000246753,;	-	ENSG00000169188	ENST00000374987	Transcript	intron_variant						rs375803683	1		1	APEX2	HGNC	17889	protein_coding	YES	CCDS14365.1	ENSP00000364126	Q9UBZ4	E5KN95,B7ZA71	UPI0000071F5B	NM_014481.3				1/5			0.2233	0.021			0.0039	0.007	0.2698	0.0537								MODIFIER	1	deletion														.	CATT	.	.												0.04282	0.3202	0.02557	0.006513	0.004537	0.004107	0.009142	0.02567	0.003995	55027964
MED12	9968	.	GRCh37	X	70361652	70361652	+	Intron	DEL	A	A	-	rs371432455		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	A	A																c.6409-81del			ENST00000374080		35	.	5	39	.	0	MED12,intron_variant,,ENST00000333646,NM_005120.2;MED12,intron_variant,,ENST00000374080,;MED12,intron_variant,,ENST00000374102,;NLGN3,upstream_gene_variant,,ENST00000358741,NM_181303.1;NLGN3,upstream_gene_variant,,ENST00000374051,NM_018977.3;NLGN3,upstream_gene_variant,,ENST00000395855,;MED12,downstream_gene_variant,,ENST00000444034,;NLGN3,upstream_gene_variant,,ENST00000536169,NM_001166660.1;AL590764.1,downstream_gene_variant,,ENST00000579622,;	-	ENSG00000184634	ENST00000374080	Transcript	intron_variant						rs371432455	2		1	MED12	HGNC	11957	protein_coding	YES	CCDS43970.1	ENSP00000363193	Q93074	Q7Z2F4,Q7Z2F1,Q7Z2E0	UPI00004257E2					43/44																		MODIFIER	1	sequence_alteration													1	.	TCAA	.	.																					70361651
PIH1D3	139212	.	GRCh37	X	106461964	106461964	+	Intron	DEL	A	A	-	rs1234164779		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	A	A																c.227-121del			ENST00000535523		13	.	3	23	.	0	PIH1D3,intron_variant,,ENST00000336387,;PIH1D3,intron_variant,,ENST00000372453,NM_173494.1;PIH1D3,intron_variant,,ENST00000535523,NM_001169154.1;	-	ENSG00000080572	ENST00000535523	Transcript	intron_variant						rs1234164779	1		1	PIH1D3	HGNC	28570	protein_coding	YES	CCDS14528.1	ENSP00000441930	Q9NQM4		UPI0000073CF5	NM_001169154.1				4/7																		MODIFIER	1	deletion													1	.	TCAA	.	.																					106461963
ELF4	2000	.	GRCh37	X	129203198	129203199	+	Intron	INS	-	-	A	rs367640579		TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09	-	-																c.1187+76dup			ENST00000308167		9	.	3	11	.	0	ELF4,intron_variant,,ENST00000308167,NM_001421.3;ELF4,intron_variant,,ENST00000335997,NM_001127197.1;ELF4,downstream_gene_variant,,ENST00000434609,;	A	ENSG00000102034	ENST00000308167	Transcript	intron_variant						rs367640579	1		-1	ELF4	HGNC	3319	protein_coding	YES	CCDS14617.1	ENSP00000311280	Q99607	B1AL80	UPI0000072B32	NM_001421.3				8/8																		MODIFIER	1	insertion													1	.	TCA	.	.																					129203198