987 KB
Newer Older
Pradat Yoann's avatar
Pradat Yoann committed
#version 2.4
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_Position	End_Position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_File	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	HGVSc	HGVSp	HGVSp_Short	Transcript_ID	Exon_Number	t_depth	t_ref_count	t_alt_count	n_depth	n_ref_count	n_alt_count	all_effects	Allele	Gene	Feature	Feature_type	Consequence	cDNA_position	CDS_position	Protein_position	Amino_acids	Codons	Existing_variation	ALLELE_NUM	DISTANCE	STRAND_VEP	SYMBOL	SYMBOL_SOURCE	HGNC_ID	BIOTYPE	CANONICAL	CCDS	ENSP	SWISSPROT	TREMBL	UNIPARC	RefSeq	SIFT	PolyPhen	EXON	INTRON	DOMAINS	AF	AFR_AF	AMR_AF	ASN_AF	EAS_AF	EUR_AF	SAS_AF	AA_AF	EA_AF	CLIN_SIG	SOMATIC	PUBMED	MOTIF_NAME	MOTIF_POS	HIGH_INF_POS	MOTIF_SCORE_CHANGE	IMPACT	PICK	VARIANT_CLASS	TSL	HGVS_OFFSET	PHENO	MINIMISED	ExAC_AF	ExAC_AF_AFR	ExAC_AF_AMR	ExAC_AF_EAS	ExAC_AF_FIN	ExAC_AF_NFE	ExAC_AF_OTH	ExAC_AF_SAS	GENE_PHENO	FILTER	flanking_bps	vcf_id	vcf_qual	ExAC_AF_Adj	ExAC_AC_AN_Adj	ExAC_AC_AN	ExAC_AC_AN_AFR	ExAC_AC_AN_AMR	ExAC_AC_AN_EAS	ExAC_AC_AN_FIN	ExAC_AC_AN_NFE	ExAC_AC_AN_OTH	ExAC_AC_AN_SAS	ExAC_FILTER	gnomAD_AF	gnomAD_AFR_AF	gnomAD_AMR_AF	gnomAD_ASJ_AF	gnomAD_EAS_AF	gnomAD_FIN_AF	gnomAD_NFE_AF	gnomAD_OTH_AF	gnomAD_SAS_AF	vcf_pos
RP11-206L10.9	101930657	.	GRCh37	1	726314	726323	+	3'Flank	DEL	GAATGGAATG	GAATGGAATG	-	rs61728598		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAATGGAATG	GAATGGAATG																			ENST00000591702		3	.	3	0	.	0	RP11-206L10.9,intron_variant,,ENST00000429505,;RP11-206L10.9,intron_variant,,ENST00000585745,;RP11-206L10.9,intron_variant,,ENST00000585768,;RP11-206L10.9,intron_variant,,ENST00000586288,;RP11-206L10.9,intron_variant,,ENST00000587530,;RP11-206L10.9,intron_variant,,ENST00000588951,;RP11-206L10.9,intron_variant,,ENST00000589531,;RP11-206L10.9,intron_variant,,ENST00000590848,;RP11-206L10.9,intron_variant,,ENST00000591440,;RP11-206L10.9,intron_variant,,ENST00000593022,;RP11-206L10.9,downstream_gene_variant,,ENST00000358533,;RP11-206L10.9,downstream_gene_variant,,ENST00000586928,;RP11-206L10.9,downstream_gene_variant,,ENST00000591702,;	-	ENSG00000237491	ENST00000591702	Transcript	downstream_gene_variant						rs61728598	1	3262	1	RP11-206L10.9	Clone_based_vega_gene		lincRNA	YES																												MODIFIER	1	deletion														.	CCGAATGGAATGG	.	.																					726313
AURKAIP1	54998	.	GRCh37	1	1311059	1311059	+	5'Flank	DEL	A	A	-	rs113734584		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000338370		3	.	3	0	.	0	AURKAIP1,upstream_gene_variant,,ENST00000321751,NM_001127230.1;AURKAIP1,upstream_gene_variant,,ENST00000338338,NM_017900.2;AURKAIP1,upstream_gene_variant,,ENST00000338370,;AURKAIP1,upstream_gene_variant,,ENST00000378853,NM_001127229.1;AURKAIP1,upstream_gene_variant,,ENST00000489799,;AURKAIP1,upstream_gene_variant,,ENST00000496905,;RP5-890O3.3,upstream_gene_variant,,ENST00000435351,;,regulatory_region_variant,,ENSR00000000184,;,TF_binding_site_variant,,ENSM00524417562,;,TF_binding_site_variant,,ENSM00524493153,;	-	ENSG00000175756	ENST00000338370	Transcript	upstream_gene_variant						rs113734584	1	522	-1	AURKAIP1	HGNC	24114	protein_coding	YES	CCDS25.1	ENSP00000342676	Q9NWT8		UPI00000709CC																							MODIFIER	1	deletion														.	TTAA	.	.																					1311058
PRDM16	63976	.	GRCh37	1	3098131	3098132	+	Intron	DEL	CA	CA	-	rs199884884		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CA	CA																c.38-4558_38-4557del			ENST00000270722		6	.	3	5	.	5	PRDM16,intron_variant,,ENST00000270722,;PRDM16,intron_variant,,ENST00000378391,;PRDM16,intron_variant,,ENST00000378398,;PRDM16,intron_variant,,ENST00000441472,NM_022114.3;PRDM16,intron_variant,,ENST00000442529,NM_199454.2;PRDM16,intron_variant,,ENST00000511072,;PRDM16,intron_variant,,ENST00000514189,;PRDM16,intron_variant,,ENST00000607632,;	-	ENSG00000142611	ENST00000270722	Transcript	intron_variant						rs199884884	1		1	PRDM16	HGNC	14000	protein_coding	YES	CCDS41236.2	ENSP00000270722	Q9HAZ2		UPI0000458A29					1/16																		MODIFIER	1	deletion													1	.	CGCAG	.	.																					3098130
PRDM16	63976	.	GRCh37	1	3159943	3159943	+	Intron	DEL	A	A	-	rs57900782		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.388-698del			ENST00000270722		3	.	3	0	.	0	PRDM16,intron_variant,,ENST00000270722,;PRDM16,intron_variant,,ENST00000378391,;PRDM16,intron_variant,,ENST00000378398,;PRDM16,intron_variant,,ENST00000441472,NM_022114.3;PRDM16,intron_variant,,ENST00000442529,NM_199454.2;PRDM16,intron_variant,,ENST00000511072,;PRDM16,intron_variant,,ENST00000514189,;PRDM16,upstream_gene_variant,,ENST00000463591,;PRDM16,intron_variant,,ENST00000512462,;	-	ENSG00000142611	ENST00000270722	Transcript	intron_variant						rs57900782	1		1	PRDM16	HGNC	14000	protein_coding	YES	CCDS41236.2	ENSP00000270722	Q9HAZ2		UPI0000458A29					2/16			0.7542	0.7622		0.7698	0.7694	0.7331										MODIFIER	1	deletion													1	.	CCAA	.	.																					3159942
CEP104	9731	.	GRCh37	1	3750216	3750216	+	Intron	DEL	C	C	-	rs35801288		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.1659+210del			ENST00000378230		3	.	3	0	.	0	CEP104,intron_variant,,ENST00000378230,NM_014704.3;CEP104,upstream_gene_variant,,ENST00000438539,;CEP104,downstream_gene_variant,,ENST00000443466,;CEP104,upstream_gene_variant,,ENST00000461667,;CEP104,intron_variant,,ENST00000460038,;CEP104,downstream_gene_variant,,ENST00000494653,;CEP104,upstream_gene_variant,,ENST00000495701,;	-	ENSG00000116198	ENST00000378230	Transcript	intron_variant						rs35801288	1		-1	CEP104	HGNC	24866	protein_coding	YES	CCDS30571.1	ENSP00000367476	O60308		UPI0000139AA8	NM_014704.3				12/21		0.3544	0.2519	0.4971		0.3383	0.4294	0.3313										MODIFIER	1	deletion													1	.	AACA	.	.																					3750215
KLHL21	9903	.	GRCh37	1	6654765	6654765	+	Intron	DEL	A	A	-	rs878994294		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1500+780del			ENST00000377658		6	.	6	0	.	0	KLHL21,3_prime_UTR_variant,,ENST00000377663,;KLHL21,intron_variant,,ENST00000377658,NM_014851.2;KLHL21,intron_variant,,ENST00000463043,;KLHL21,intron_variant,,ENST00000467612,;KLHL21,intron_variant,,ENST00000496707,;	-	ENSG00000162413	ENST00000377658	Transcript	intron_variant						rs878994294	1		-1	KLHL21	HGNC	29041	protein_coding	YES	CCDS30575.1	ENSP00000366886	Q9UJP4	Q2NKK7,K7ESH2,K7EMF2,K7ELI0	UPI0000070D85	NM_014851.2				3/3																		MODIFIER	1	deletion														.	ATAA	.	.																					6654764
CAMTA1	23261	.	GRCh37	1	7328327	7328327	+	Intron	DEL	G	G	-	rs56775847		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.438+18647del			ENST00000303635		5	.	5	0	.	0	CAMTA1,intron_variant,,ENST00000303635,NM_015215.2;CAMTA1,intron_variant,,ENST00000439411,;	-	ENSG00000171735	ENST00000303635	Transcript	intron_variant						rs56775847	1		1	CAMTA1	HGNC	18806	protein_coding	YES	CCDS30576.1	ENSP00000306522	Q9Y6Y1		UPI00001C1D72	NM_015215.2				5/22			0.997	0.9265		0.8333	0.9036	0.8773										MODIFIER	1	deletion													1	.	AAGG	.	.																					7328326
CAMTA1	23261	.	GRCh37	1	7395833	7395833	+	Intron	DEL	A	A	-	rs5772272		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.438+86161del			ENST00000303635		3	.	3	0	.	0	CAMTA1,intron_variant,,ENST00000303635,NM_015215.2;CAMTA1,intron_variant,,ENST00000439411,;,regulatory_region_variant,,ENSR00000920069,;,TF_binding_site_variant,,ENSM00718914870,;	-	ENSG00000171735	ENST00000303635	Transcript	intron_variant						rs5772272	1		1	CAMTA1	HGNC	18806	protein_coding	YES	CCDS30576.1	ENSP00000306522	Q9Y6Y1		UPI00001C1D72	NM_015215.2				5/22																		MODIFIER	1	deletion													1	.	TTAA	.	.																					7395832
CAMTA1	23261	.	GRCh37	1	7588862	7588863	+	Intron	INS	-	-	ATGA	rs3033702		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.510+60935_510+60938dup			ENST00000303635		6	4	2	4	4	0	CAMTA1,intron_variant,,ENST00000303635,NM_015215.2;CAMTA1,intron_variant,,ENST00000439411,;	ATGA	ENSG00000171735	ENST00000303635	Transcript	intron_variant						rs3033702	1		1	CAMTA1	HGNC	18806	protein_coding	YES	CCDS30576.1	ENSP00000306522	Q9Y6Y1		UPI00001C1D72	NM_015215.2				6/22			0.3109	0.1873		0.1935	0.2306	0.3027										MODIFIER	1	insertion													1	.	GGA	.	.																					7588862
RERE	473	.	GRCh37	1	8791841	8791843	+	Intron	DEL	TTG	TTG	-	rs141905642		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTG	TTG																c.-145+60620_-145+60622del			ENST00000337907		3	.	3	0	.	0	RERE,intron_variant,,ENST00000337907,NM_012102.3;RERE,intron_variant,,ENST00000400908,NM_001042681.1;RERE,intron_variant,,ENST00000480342,;	-	ENSG00000142599	ENST00000337907	Transcript	intron_variant						rs141905642	1		-1	RERE	HGNC	9965	protein_coding	YES	CCDS95.1	ENSP00000338629	Q9P2R6	K7EJQ1,K7EIQ4,K7EIE3	UPI00001419CC	NM_012102.3				2/23			0.8691	0.8818		0.9325	0.841	0.6759										MODIFIER	1	deletion													1	.	TTTTGT	.	.																					8791840
UBE4B	10277	.	GRCh37	1	10119867	10119867	+	Intron	DEL	T	T	-	rs912413544		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.25-12211del			ENST00000343090		6	.	3	3	.	0	UBE4B,intron_variant,,ENST00000253251,;UBE4B,intron_variant,,ENST00000343090,NM_001105562.2;UBE4B,intron_variant,,ENST00000377153,;UBE4B,intron_variant,,ENST00000377157,NM_006048.4;PGAM1P11,downstream_gene_variant,,ENST00000416729,;	-	ENSG00000130939	ENST00000343090	Transcript	intron_variant						rs912413544	1		1	UBE4B	HGNC	12500	protein_coding	YES	CCDS41245.1	ENSP00000343001	O95155		UPI0000137944	NM_001105562.2				1/27																		MODIFIER	1	deletion														.	CATT	.	.																					10119866
KIF1B	23095	.	GRCh37	1	10372181	10372183	+	Intron	DEL	TGA	TGA	-	rs36109286		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGA	TGA																c.1978-7916_1978-7914del			ENST00000263934		3	.	3	0	.	0	KIF1B,intron_variant,,ENST00000263934,NM_015074.3;KIF1B,intron_variant,,ENST00000377081,;KIF1B,intron_variant,,ENST00000377086,;KIF1B,downstream_gene_variant,,ENST00000377093,NM_183416.3;	-	ENSG00000054523	ENST00000263934	Transcript	intron_variant						rs36109286	1		1	KIF1B	HGNC	16636	protein_coding	YES	CCDS111.1	ENSP00000263934	O60333	B4DMF3	UPI000013EE7E	NM_015074.3				20/46			0.264	0.3775		0.3472	0.3539	0.2873										MODIFIER	1	deletion													1	.	GCTGAT	.	.																					10372180
APITD1	378708	.	GRCh37	1	10490760	10490768	+	Intron	DEL	TGGCTTAAC	TGGCTTAAC	-	rs35995075		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGGCTTAAC	TGGCTTAAC																c.51+137_51+145del			ENST00000602787		7	.	3	11	.	0	APITD1,intron_variant,,ENST00000309048,NM_199294.2,NM_001270517.1;APITD1-CORT,intron_variant,,ENST00000400900,;APITD1-CORT,intron_variant,,ENST00000470413,;APITD1,intron_variant,,ENST00000602296,NM_199006.2;APITD1,intron_variant,,ENST00000602787,NM_198544.3;APITD1,upstream_gene_variant,,ENST00000477755,;APITD1-CORT,upstream_gene_variant,,ENST00000602446,;RP4-736L20.3,upstream_gene_variant,,ENST00000607572,;APITD1,intron_variant,,ENST00000602486,;APITD1,upstream_gene_variant,,ENST00000462462,;APITD1-CORT,upstream_gene_variant,,ENST00000465026,;,regulatory_region_variant,,ENSR00000001275,;	-	ENSG00000175279	ENST00000602787	Transcript	intron_variant						rs35995075	1		1	APITD1	HGNC	23163	protein_coding	YES	CCDS114.1	ENSP00000473509	Q8N2Z9		UPI000007101C	NM_198544.3				1/4			0.6891	0.6066		0.4643	0.492	0.5879										MODIFIER		deletion														.	GTTGGCTTAACT	.	.																					10490759
Unknown	0	.	GRCh37	1	14212447	14212456	+	IGR	DEL	TGTTTCTCAT	TGTTTCTCAT	-	rs70984293		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGTTTCTCAT	TGTTTCTCAT																					3	.	3	0	.	0		-				intergenic_variant						rs70984293	1																			0.4607	0.2632	0.2925		0.6964	0.4751	0.589										MODIFIER	1	deletion														.	ACTGTTTCTCATC	.	.																					14212446
CROCCP2	84809	.	GRCh37	1	16970870	16970871	+	Intron	INS	-	C	C	rs56378906		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.38+270dup			ENST00000362058		5	.	0	5	.	5	CROCCP2,intron_variant,,ENST00000362058,;MST1P2,upstream_gene_variant,,ENST00000334429,;MST1P2,upstream_gene_variant,,ENST00000418421,;MST1P2,upstream_gene_variant,,ENST00000457982,;,regulatory_region_variant,,ENSR00000002094,;	C	ENSG00000215908	ENST00000362058	Transcript	intron_variant,non_coding_transcript_variant						rs56378906	1		-1	CROCCP2	HGNC	28170	retained_intron	YES										1/5																		MODIFIER	1	insertion														.	CGC	.	.																					16970870
ESPNP	284729	.	GRCh37	1	17039464	17039465	+	Intron	INS	-	-	AAAT	rs61399088		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.195-4895_195-4892dup			ENST00000270691		8	.	4	8	.	0	ESPNP,intron_variant,,ENST00000492551,;ESPNP,intron_variant,,ENST00000270691,;ESPNP,upstream_gene_variant,,ENST00000535711,;,regulatory_region_variant,,ENSR00001493173,;	AAAT	ENSG00000268869	ENST00000270691	Transcript	intron_variant,non_coding_transcript_variant						rs61399088	1		-1	ESPNP	HGNC	23285	transcribed_unprocessed_pseudogene	YES										1/10			0.2141	0.2983		0.3938	0.2664	0.271										MODIFIER	1	insertion														.	AGA	.	.																					17039464
CROCC	9696	.	GRCh37	1	17278378	17278378	+	Intron	DEL	T	T	-	rs35956886		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.3006+772del			ENST00000375541		3	.	3	0	.	0	CROCC,intron_variant,,ENST00000375541,NM_014675.3;CROCC,intron_variant,,ENST00000445545,;CROCC,intron_variant,,ENST00000467938,;CROCC,intron_variant,,ENST00000486318,;CROCC,intron_variant,,ENST00000498688,;CROCC,downstream_gene_variant,,ENST00000477773,;CROCC,intron_variant,,ENST00000494191,;CROCC,upstream_gene_variant,,ENST00000497654,;,regulatory_region_variant,,ENSR00000250481,;,regulatory_region_variant,,ENSR00001493218,;,TF_binding_site_variant,,ENSM00527790104,;	-	ENSG00000058453	ENST00000375541	Transcript	intron_variant						rs35956886	1		1	CROCC	HGNC	21299	protein_coding	YES	CCDS30616.1	ENSP00000364691	Q5TZA2		UPI00001AE5A0	NM_014675.3				20/36			0.6006	0.6441		0.9137	0.6799	0.683										MODIFIER	1	deletion														.	TCTT	.	.																					17278377
Unknown	0	.	GRCh37	1	19159481	19159481	+	IGR	DEL	T	T	-	rs72268125		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					5	.	5	0	.	0		-				intergenic_variant						rs72268125	1																				0.5855	0.6081		0.5417	0.6879	0.6401										MODIFIER	1	deletion														.	TCTT	.	.																					19159480
AKR7L	0	.	GRCh37	1	19592799	19592800	+	3'UTR	INS	-	-	TTTG	rs147772000		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.*991_*994dup			ENST00000420396	5/5	6	.	6	3	.	0	AKR7L,3_prime_UTR_variant,,ENST00000420396,;AKR7L,downstream_gene_variant,,ENST00000493176,;AKR7L,3_prime_UTR_variant,,ENST00000457194,;AKR7L,downstream_gene_variant,,ENST00000429712,;	TTTG	ENSG00000211454	ENST00000420396	Transcript	3_prime_UTR_variant	1793-1794/2115					rs147772000	1		-1	AKR7L	HGNC	24056	protein_coding	YES		ENSP00000406430	Q8NHP1		UPI0000236FED				5/5																			MODIFIER	1	insertion														.	TAT	.	.																					19592799
Unknown	0	.	GRCh37	1	19819989	19819997	+	IGR	DEL	CAGGCTGCT	CAGGCTGCT	-	rs4065220		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAGGCTGCT	CAGGCTGCT																					3	.	3	0	.	0		-				intergenic_variant						rs4065220	1																				0.1989	0.3372		0.5486	0.335	0.4581										MODIFIER	1	deletion														.	CCCAGGCTGCTC	.	.																					19819988
HTR6	3362	.	GRCh37	1	20005323	20005324	+	Intron	DEL	GT	GT	-	rs141362075		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																c.874-77_874-76del			ENST00000289753		4	.	4	0	.	0	HTR6,intron_variant,,ENST00000289753,NM_000871.1;TMCO4,downstream_gene_variant,,ENST00000294543,NM_181719.4;TMCO4,downstream_gene_variant,,ENST00000375122,;TMCO4,downstream_gene_variant,,ENST00000375127,;TMCO4,downstream_gene_variant,,ENST00000489814,;	-	ENSG00000158748	ENST00000289753	Transcript	intron_variant						rs141362075	1		1	HTR6	HGNC	5301	protein_coding	YES	CCDS197.1	ENSP00000289753	P50406		UPI00000503E0	NM_000871.1				2/2			0.0061	0.0043		0.003	0.003	0.001										MODIFIER	1	deletion														.	GCGTG	.	.																					20005322
ZNF436	80818	.	GRCh37	1	23699631	23699631	+	5'Flank	DEL	A	A	-	rs71023203		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000314011		3	.	3	0	.	0	ZNF436,upstream_gene_variant,,ENST00000314011,NM_001077195.1;C1orf213,downstream_gene_variant,,ENST00000335648,;ZNF436,upstream_gene_variant,,ENST00000374608,NM_030634.2;C1orf213,downstream_gene_variant,,ENST00000437367,;C1orf213,downstream_gene_variant,,ENST00000454117,;C1orf213,downstream_gene_variant,,ENST00000518600,;C1orf213,downstream_gene_variant,,ENST00000518821,;Y_RNA,downstream_gene_variant,,ENST00000364535,;C1orf213,downstream_gene_variant,,ENST00000458053,;	-	ENSG00000125945	ENST00000314011	Transcript	upstream_gene_variant						rs71023203	1	3696	-1	ZNF436	HGNC	20814	protein_coding	YES	CCDS233.1	ENSP00000313582	Q9C0F3	Q15921	UPI0000001669	NM_001077195.1							0.3162	0.4971		0.4841	0.5129	0.4499										MODIFIER	1	deletion														.	TCAA	.	.																					23699630
ASAP3	55616	.	GRCh37	1	23759318	23759318	+	Intron	DEL	G	G	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.2323+252del			ENST00000336689		6	4	2	4	4	0	ASAP3,intron_variant,,ENST00000336689,NM_017707.3;ASAP3,intron_variant,,ENST00000437606,NM_001143778.1;ASAP3,intron_variant,,ENST00000465372,;ASAP3,intron_variant,,ENST00000495646,;ASAP3,intron_variant,,ENST00000492982,;ASAP3,downstream_gene_variant,,ENST00000475814,;ASAP3,downstream_gene_variant,,ENST00000484418,;ASAP3,downstream_gene_variant,,ENST00000530874,;	-	ENSG00000088280	ENST00000336689	Transcript	intron_variant							1		-1	ASAP3	HGNC	14987	protein_coding	YES	CCDS235.1	ENSP00000338769	Q8TDY4	H0YER8	UPI0000071371	NM_017707.3				22/24																		MODIFIER	1	deletion														.	GTGG	.	.																					23759317
TCEB3	6924	.	GRCh37	1	24082270	24082270	+	Intron	DEL	A	A	-	rs371132818		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1870-63del			ENST00000418390		4	.	4	0	.	0	TCEB3,intron_variant,,ENST00000418390,NM_003198.2;TCEB3,intron_variant,,ENST00000609199,;RP5-886K2.3,downstream_gene_variant,,ENST00000427796,;TCEB3,downstream_gene_variant,,ENST00000487554,;	-	ENSG00000011007	ENST00000418390	Transcript	intron_variant						rs371132818	1		1	TCEB3	HGNC	11620	protein_coding	YES	CCDS239.2	ENSP00000395574	Q14241		UPI000181BA17	NM_003198.2				7/10			0.3918	0.3689		0.3879	0.3439	0.4008										MODIFIER	1	sequence_alteration														.	TCAA	.	.																					24082269
IL22RA1	58985	.	GRCh37	1	24468503	24468503	+	Intron	DEL	T	T	-	rs5773070		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.43+1027del			ENST00000270800		3	.	3	0	.	0	IL22RA1,intron_variant,,ENST00000270800,NM_021258.3;	-	ENSG00000142677	ENST00000270800	Transcript	intron_variant						rs5773070	1		-1	IL22RA1	HGNC	13700	protein_coding	YES	CCDS247.1	ENSP00000270800	Q8N6P7		UPI0000071143	NM_021258.3				1/6		0.654	0.3056	0.7277		0.9782	0.673	0.7188										MODIFIER	1	deletion														.	GGTC	.	.																					24468502
PPP1R8	5511	.	GRCh37	1	28161891	28161892	+	Intron	INS	-	-	A	rs1334545900		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.117+2567dup			ENST00000311772		4	.	3	2	.	0	PPP1R8,intron_variant,,ENST00000236412,NM_002713.3;PPP1R8,intron_variant,,ENST00000311772,NM_014110.4;PPP1R8,intron_variant,,ENST00000373931,NM_138558.2;PPP1R8,intron_variant,,ENST00000431586,;SCARNA1,downstream_gene_variant,,ENST00000517138,;	A	ENSG00000117751	ENST00000311772	Transcript	intron_variant						rs1334545900	1		1	PPP1R8	HGNC	9296	protein_coding	YES	CCDS311.1	ENSP00000311677	Q12972	Q6ICT4	UPI00001320FD	NM_014110.4				2/6																		MODIFIER	1	insertion														.	TGA	.	.																					28161891
Unknown	0	.	GRCh37	1	29712466	29712470	+	IGR	DEL	TAAAA	TAAAA	-	rs59938613		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAAAA	TAAAA																					4	.	4	0	.	0		-				intergenic_variant						rs59938613	1																				0.5711	0.5		0.7589	0.6312	0.6534										MODIFIER	1	deletion														.	GTTAAAAT	.	.																					29712465
Unknown	0	.	GRCh37	1	30808093	30808094	+	IGR	INS	-	-	ACACAC	rs3045803		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		ACACAC				intergenic_variant						rs3045803	1																																			MODIFIER	1	insertion														.	CAA	.	.																					30808093
CSMD2	114784	.	GRCh37	1	34493442	34493459	+	Intron	DEL	TGGGCAGACAGCCCTACA	TGGGCAGACAGCCCTACA	-	rs6143184		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGGGCAGACAGCCCTACA	TGGGCAGACAGCCCTACA																c.397+4736_397+4753del			ENST00000241312		3	.	3	0	.	0	CSMD2,intron_variant,,ENST00000373381,NM_052896.3,NM_001281956.1;CSMD2,intron_variant,,ENST00000241312,;	-	ENSG00000121904	ENST00000241312	Transcript	intron_variant,NMD_transcript_variant						rs6143184	1		-1	CSMD2	HGNC	19290	nonsense_mediated_decay	YES	CCDS380.1	ENSP00000241312	Q7Z408		UPI00004561AB					3/69			0.6407	0.7291		0.7143	0.8499	0.7434										MODIFIER	1	deletion														.	CCTGGGCAGACAGCCCTACAT	.	.																					34493441
GJB5	2709	.	GRCh37	1	35217822	35217823	+	5'Flank	INS	-	-	GTGT	rs34555460		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000338513		3	.	3	0	.	0	GJB5,upstream_gene_variant,,ENST00000338513,NM_005268.3;SMIM12,intron_variant,,ENST00000426886,;	GTGT	ENSG00000189280	ENST00000338513	Transcript	upstream_gene_variant						rs34555460	1	2825	1	GJB5	HGNC	4287	protein_coding	YES	CCDS382.1	ENSP00000340811	O95377		UPI0000051E62	NM_005268.3																						MODIFIER	1	insertion														.	TGG	.	.																					35217822
SMIM12	113444	.	GRCh37	1	35313521	35313522	+	3'Flank	INS	-	-	GGGCTCAGACCCA	rs6143189		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000521580		3	.	3	0	.	0	SMIM12,downstream_gene_variant,,ENST00000521580,NM_001164825.1,NM_001164824.1,NM_138428.5;RP5-997D16.2,upstream_gene_variant,,ENST00000429293,;SMIM12,intron_variant,,ENST00000426886,;	GGGCTCAGACCCA	ENSG00000163866	ENST00000521580	Transcript	downstream_gene_variant						rs6143189	1	4748	-1	SMIM12	HGNC	25154	protein_coding	YES	CCDS53295.1	ENSP00000428585	Q96EX1	L0R6D7	UPI0000039F00	NM_001164825.1,NM_001164824.1,NM_138428.5							0.9531	0.562		0.2907	0.7674	0.6288										MODIFIER	1	insertion														.	CTG	.	.																					35313521
Unknown	0	.	GRCh37	1	37862830	37862839	+	IGR	DEL	GCACACACAG	GCACACACAG	-	rs61606736		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GCACACACAG	GCACACACAG																					3	.	3	0	.	0		-				intergenic_variant						rs61606736	1																				0.3623	0.6542		0.3512	0.5905	0.6135										MODIFIER	1	deletion														.	TTGCACACACAGG	.	.																					37862829
Unknown	0	.	GRCh37	1	39228508	39228510	+	IGR	DEL	TTG	TTG	-	rs199650803		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTG	TTG																					6	4	2	5	5	0		-				intergenic_variant						rs199650803	1																				0.0091	0.1167		0.003	0.1123	0.1503										MODIFIER	1	deletion														.	TATTGT	.	.																					39228507
KCNQ4	9132	.	GRCh37	1	41265104	41265105	+	Intron	INS	-	-	C	rs149663653		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.314+15034dup			ENST00000347132		4	.	3	3	.	0	KCNQ4,intron_variant,,ENST00000347132,NM_004700.3,NM_172163.2;KCNQ4,intron_variant,,ENST00000509682,;	C	ENSG00000117013	ENST00000347132	Transcript	intron_variant						rs149663653	1		1	KCNQ4	HGNC	6298	protein_coding	YES	CCDS456.1	ENSP00000262916	P56696		UPI000013D35B	NM_004700.3,NM_172163.2				1/13			0.4569	0.3084		0.2331	0.4076	0.4315										MODIFIER	1	insertion													1	.	TGC	.	.																					41265104
FOXJ3	22887	.	GRCh37	1	42639584	42639585	+	3'Flank	INS	-	-	G	rs34687885		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000372572		3	.	3	0	.	0	FOXJ3,downstream_gene_variant,,ENST00000361346,NM_014947.4;FOXJ3,downstream_gene_variant,,ENST00000361776,NM_001198852.1;FOXJ3,downstream_gene_variant,,ENST00000372571,;FOXJ3,downstream_gene_variant,,ENST00000372572,NM_001198851.1;FOXJ3,downstream_gene_variant,,ENST00000372573,NM_001198850.1;FOXJ3,downstream_gene_variant,,ENST00000545068,;,regulatory_region_variant,,ENSR00000251460,;,regulatory_region_variant,,ENSR00000928988,;	G	ENSG00000198815	ENST00000372572	Transcript	downstream_gene_variant						rs34687885	1	2625	-1	FOXJ3	HGNC	29178	protein_coding	YES	CCDS30689.1	ENSP00000361653	Q9UPW0	F6VXT0,C9JXI1	UPI000013D359	NM_001198851.1							0.6573	0.2032		0.252	0.3121	0.4683										MODIFIER	1	insertion														.	TAG	.	.																					42639584
GPBP1L1	60313	.	GRCh37	1	46105726	46105727	+	Intron	INS	-	-	A	rs66580837		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.744+156dup			ENST00000355105		6	.	3	11	.	0	GPBP1L1,intron_variant,,ENST00000290795,;GPBP1L1,intron_variant,,ENST00000355105,NM_021639.4;GPBP1L1,upstream_gene_variant,,ENST00000479235,;GPBP1L1,downstream_gene_variant,,ENST00000498128,;	AA	ENSG00000159592	ENST00000355105	Transcript	intron_variant						rs66580837	2		-1	GPBP1L1	HGNC	28843	protein_coding	YES	CCDS528.1	ENSP00000347224	Q9HC44		UPI0000072AA4	NM_021639.4				8/12			0.2769	0.3127		0.2817	0.2674	0.3405										MODIFIER	1	sequence_alteration														.	AGAA	.	.																					46105725
SSBP3	23648	.	GRCh37	1	54718192	54718213	+	Intron	DEL	GGGACAGGTGGCCACTAGGAGA	GGGACAGGTGGCCACTAGGAGA	-	rs146044344		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GGGACAGGTGGCCACTAGGAGA	GGGACAGGTGGCCACTAGGAGA																c.508-680_508-659del			ENST00000371320		4	.	4	0	.	0	SSBP3,intron_variant,,ENST00000357475,NM_018070.4;SSBP3,intron_variant,,ENST00000371319,NM_001009955.3;SSBP3,intron_variant,,ENST00000371320,NM_145716.3;SSBP3,intron_variant,,ENST00000417664,;SSBP3,intron_variant,,ENST00000525990,;SSBP3,upstream_gene_variant,,ENST00000444533,;SSBP3,intron_variant,,ENST00000326956,;SSBP3,intron_variant,,ENST00000426150,;SSBP3,intron_variant,,ENST00000528787,;SSBP3,intron_variant,,ENST00000533946,;SSBP3,intron_variant,,ENST00000420121,;SSBP3,intron_variant,,ENST00000533209,;SSBP3,upstream_gene_variant,,ENST00000530618,;,regulatory_region_variant,,ENSR00001498350,;	-	ENSG00000157216	ENST00000371320	Transcript	intron_variant						rs146044344	1		-1	SSBP3	HGNC	15674	protein_coding	YES	CCDS591.1	ENSP00000360371	Q9BWW4	Q9NW25,Q9BT57	UPI0000135F96	NM_145716.3				7/17			0.705	0.5346		0.3323	0.5388	0.7587										MODIFIER	1	deletion														.	GCGGGACAGGTGGCCACTAGGAGAG	.	.																					54718191
SNORD112	0	.	GRCh37	1	54994457	54994458	+	3'Flank	INS	-	-	T	rs35728927		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000516837		3	.	3	0	.	0	SNORD112,downstream_gene_variant,,ENST00000516837,;RP5-866L20.2,downstream_gene_variant,,ENST00000444140,;,regulatory_region_variant,,ENSR00000931727,;,regulatory_region_variant,,ENSR00001498393,;	T	ENSG00000252646	ENST00000516837	Transcript	downstream_gene_variant						rs35728927	1	3331	1	SNORD112	RFAM		snoRNA	YES													0.3434	0.1671		0.0744	0.2396	0.1687										MODIFIER		insertion														.	CCT	.	.																					54994457
ENSR00000931830	0	.	GRCh37	1	55415882	55415882	+	IGR	DEL	G	G	-	rs34180821		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																			ENSR00000931830		5	.	5	0	.	0	,regulatory_region_variant,,ENSR00000931830,;,regulatory_region_variant,,ENSR00001498456,;	-		ENSR00000931830	RegulatoryFeature	regulatory_region_variant						rs34180821	1																				0.9516	0.9971		1	0.999	1										MODIFIER	1	deletion														.	GTGG	.	.																					55415881
Unknown	0	.	GRCh37	1	55924558	55924558	+	IGR	DEL	T	T	-	rs77076490		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs77076490	1																				0.6929	0.7032		0.7411	0.7445	0.5511										MODIFIER	1	deletion														.	ACTT	.	.																					55924557
ENSR00001499393	0	.	GRCh37	1	63201490	63201491	+	IGR	DEL	TC	TC	-	rs67630296		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TC	TC																			ENSR00001499393		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001499393,;	-		ENSR00001499393	RegulatoryFeature	regulatory_region_variant						rs67630296	1																				0.705	0.889		0.9821	0.9602	0.8988										MODIFIER	1	deletion														.	TGTCT	.	.																					63201489
RP11-335E6.3	0	.	GRCh37	1	63715991	63715995	+	RNA	DEL	TTTTC	TTTTC	-	rs146971133		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTTC	TTTTC																n.425_429del			ENST00000449140	1/2	3	.	3	0	.	0	RP11-335E6.3,non_coding_transcript_exon_variant,,ENST00000449140,;LINC00466,intron_variant,,ENST00000418086,;LINC00466,intron_variant,,ENST00000455304,;	-	ENSG00000228734	ENST00000449140	Transcript	non_coding_transcript_exon_variant	401-405/859					rs146971133	1		1	RP11-335E6.3	Clone_based_vega_gene		lincRNA	YES									1/2				0.0098	0.0605		0.1349	0.1113	0.2065										MODIFIER	1	deletion														.	TATTTTCT	.	.																					63715990
ROR1	4919	.	GRCh37	1	64441038	64441042	+	Intron	DEL	TTAAG	TTAAG	-	rs147366169		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTAAG	TTAAG																c.92-33936_92-33932del			ENST00000371079		3	.	3	0	.	0	ROR1,intron_variant,,ENST00000371079,NM_005012.3;ROR1,intron_variant,,ENST00000371080,NM_001083592.1;ROR1,intron_variant,,ENST00000482426,;	-	ENSG00000185483	ENST00000371079	Transcript	intron_variant						rs147366169	1		1	ROR1	HGNC	10256	protein_coding	YES	CCDS626.1	ENSP00000360120	Q01973		UPI00001AF82C	NM_005012.3				1/8			0.0023	0.0159			0.0199	0.001										MODIFIER	1	deletion													1	.	GATTAAGT	.	.																					64441037
LEPR	54741	.	GRCh37	1	66074627	66074627	+	Intron	DEL	T	T	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1752+47del			ENST00000349533		16	.	4	25	.	0	LEPR,intron_variant,,ENST00000344610,;LEPR,intron_variant,,ENST00000349533,NM_002303.5;LEPR,intron_variant,,ENST00000371058,NM_001198688.1;LEPR,intron_variant,,ENST00000371059,NM_001198687.1,NM_001003680.3;LEPR,intron_variant,,ENST00000371060,NM_001198689.1,NM_001003679.3;LEPR,intron_variant,,ENST00000406510,;LEPR,intron_variant,,ENST00000462765,;	-	ENSG00000116678	ENST00000349533	Transcript	intron_variant							1		1	LEPR	HGNC	6554	protein_coding	YES	CCDS631.1	ENSP00000330393	P48357	L0I9J6,A2RRQ4	UPI000014C37B	NM_002303.5				12/19																		MODIFIER	1	deletion													1	.	TATT	.	.																					66074626
RNU6-1031P	0	.	GRCh37	1	68011875	68011876	+	3'Flank	INS	-	-	A	rs35008328		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000384773		4	.	4	0	.	0	RNU6-1031P,downstream_gene_variant,,ENST00000384773,;	A	ENSG00000207504	ENST00000384773	Transcript	downstream_gene_variant						rs35008328	1	4959	1	RNU6-1031P	HGNC	47994	snRNA	YES													0.5159	0.5447		0.63	0.5626	0.5869										MODIFIER	1	insertion														.	TCA	.	.																					68011875
NEGR1	257194	.	GRCh37	1	72664947	72664947	+	Intron	DEL	G	G	-	rs35669105		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.176+83055del			ENST00000357731		4	.	4	0	.	0	NEGR1,intron_variant,,ENST00000357731,NM_173808.2;NEGR1,intron_variant,,ENST00000434200,;	-	ENSG00000172260	ENST00000357731	Transcript	intron_variant						rs35669105	1		-1	NEGR1	HGNC	17302	protein_coding	YES	CCDS661.1	ENSP00000350364	Q7Z3B1	Q8N440,Q68DZ8	UPI00000477EE	NM_173808.2				1/6			0.6157	0.3631		0.1815	0.4761	0.3384										MODIFIER	1	deletion														.	CTGG	.	.																					72664946
Unknown	0	.	GRCh37	1	73604846	73604847	+	IGR	INS	-	-	T	rs57040732		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs57040732	1																				0.7118	0.9366		0.9653	0.9622	0.9438										MODIFIER	1	insertion														.	TAT	.	.																					73604846
MSH4	4438	.	GRCh37	1	76326852	76326852	+	Intron	DEL	T	T	-	rs35154985		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1231-6341del			ENST00000263187		5	.	5	0	.	0	MSH4,intron_variant,,ENST00000263187,NM_002440.3;	-	ENSG00000057468	ENST00000263187	Transcript	intron_variant						rs35154985	1		1	MSH4	HGNC	7327	protein_coding	YES	CCDS670.1	ENSP00000263187	O15457	Q5ZEZ0	UPI000006D934	NM_002440.3				8/19			0.8404	0.9914		1	0.999	1										MODIFIER	1	deletion														.	CCTT	.	.																					76326851
GIPC2	54810	.	GRCh37	1	78508992	78508994	+	5'Flank	DEL	AAG	AAG	-	rs140927295		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAG	AAG																			ENST00000370759		10	.	3	9	.	0	GIPC2,upstream_gene_variant,,ENST00000370759,NM_017655.4;GIPC2,intron_variant,,ENST00000476882,;RP11-386I14.2,downstream_gene_variant,,ENST00000265259,;	-	ENSG00000137960	ENST00000370759	Transcript	upstream_gene_variant						rs140927295	1	2592	1	GIPC2	HGNC	18177	protein_coding	YES	CCDS685.1	ENSP00000359795	Q8TF65		UPI000006EB65	NM_017655.4							0.4092	0.7061		0.7619	0.833	0.7045										MODIFIER	1	deletion														.	TAAAGA	.	.																					78508991
Unknown	0	.	GRCh37	1	81177030	81177030	+	IGR	DEL	A	A	-	rs35442612		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	4	0	.	0		-				intergenic_variant						rs35442612	1																				0.7897	0.428		0.6835	0.4354	0.5675										MODIFIER	1	deletion														.	AGAA	.	.																					81177029
Unknown	0	.	GRCh37	1	81499788	81499793	+	IGR	DEL	AAAAAA	AAAAAA	-	rs10573940		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAAAA	AAAAAA																					3	.	3	0	.	0		-				intergenic_variant						rs10573940	1																																			MODIFIER	1	deletion														.	GCAAAAAAA	.	.																					81499787
AGL	178	.	GRCh37	1	100344920	100344920	+	Intron	DEL	C	C	-	rs142035948		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.1612-559del			ENST00000294724		4	.	4	0	.	0	AGL,intron_variant,,ENST00000294724,NM_000028.2;AGL,intron_variant,,ENST00000361302,NM_000646.2;AGL,intron_variant,,ENST00000361522,NM_000645.2;AGL,intron_variant,,ENST00000361915,NM_000642.2;AGL,intron_variant,,ENST00000370161,;AGL,intron_variant,,ENST00000370163,NM_000643.2;AGL,intron_variant,,ENST00000370165,NM_000644.2;AGL,downstream_gene_variant,,ENST00000477753,;	-	ENSG00000162688	ENST00000294724	Transcript	intron_variant						rs142035948	1		1	AGL	HGNC	321	protein_coding	YES	CCDS759.1	ENSP00000294724	P35573	G1UI17	UPI00001694CB	NM_000028.2				12/33		0.1102	0.1203	0.0951		0.0278	0.1541	0.1472										MODIFIER	1	deletion													1	.	ATCA	.	.																					100344919
Unknown	0	.	GRCh37	1	101760945	101760945	+	IGR	DEL	C	C	-	rs150164735		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					5	.	4	3	.	0		-				intergenic_variant						rs150164735	1																				0.2602	0.0908		0.0536	0.1322	0.2239										MODIFIER	1	deletion														.	GGCC	.	.																					101760944
RP11-202K23.1	0	.	GRCh37	1	102810377	102810378	+	Intron	INS	-	-	A	rs35321243		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.340-34494dup			ENST00000447916		4	.	4	0	.	0	RP11-202K23.1,intron_variant,,ENST00000447916,;	A	ENSG00000233359	ENST00000447916	Transcript	intron_variant,non_coding_transcript_variant						rs35321243	1		-1	RP11-202K23.1	Clone_based_vega_gene		lincRNA	YES										4/5			0.5764	0.5692		0.6726	0.7296	0.8006										MODIFIER	1	insertion														.	CCA	.	.																					102810377
COL11A1	1301	.	GRCh37	1	103457391	103457391	+	Intron	DEL	T	T	-	rs5776670		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.2341-2264del			ENST00000370096		3	.	3	0	.	0	COL11A1,intron_variant,,ENST00000353414,NM_001190709.1;COL11A1,intron_variant,,ENST00000358392,NM_080629.2;COL11A1,intron_variant,,ENST00000370096,NM_001854.3;COL11A1,intron_variant,,ENST00000512756,NM_080630.3;	-	ENSG00000060718	ENST00000370096	Transcript	intron_variant						rs5776670	1		-1	COL11A1	HGNC	2186	protein_coding	YES	CCDS778.1	ENSP00000359114	P12107	Q4FAC4,B4DQZ0	UPI00002053EF	NM_001854.3				28/66			0.6089	0.8329		0.9008	0.825	0.8476										MODIFIER	1	deletion													1	.	AATT	.	.																					103457390
Unknown	0	.	GRCh37	1	105036066	105036067	+	IGR	INS	-	-	T	rs796968332		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs796968332	1																																			MODIFIER	1	insertion														.	GCT	.	.																					105036066
Unknown	0	.	GRCh37	1	105722914	105722915	+	IGR	INS	-	-	TT	rs35790489		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	3	3	.	0		TT				intergenic_variant						rs35790489	1																				0.3669	0.4697		0.1925	0.5437	0.3896										MODIFIER	1	insertion														.	GGT	.	.																					105722914
Unknown	0	.	GRCh37	1	105862327	105862328	+	IGR	INS	-	-	T	rs34957996		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		T				intergenic_variant						rs34957996	1																				0.1437	0.428		0.1706	0.4274	0.2679										MODIFIER	1	insertion														.	AAT	.	.																					105862327
Unknown	0	.	GRCh37	1	106090154	106090155	+	IGR	INS	-	-	TATC	rs3053095		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		TATC				intergenic_variant						rs3053095	1																				0.6679	0.4726		0.2242	0.4622	0.5041										MODIFIER	1	insertion														.	ATT	.	.																					106090154
SLC25A24P1	0	.	GRCh37	1	108881906	108881907	+	3'Flank	INS	-	-	A	rs3072975		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000411846		3	.	3	0	.	0	SLC25A24P1,intron_variant,,ENST00000450435,;SLC25A24P1,downstream_gene_variant,,ENST00000411846,;SLC25A24P1,downstream_gene_variant,,ENST00000434803,;	A	ENSG00000241361	ENST00000411846	Transcript	downstream_gene_variant						rs3072975	1	1431	1	SLC25A24P1	HGNC	48933	processed_transcript	YES																												MODIFIER	1	insertion														.	TTA	.	.																					108881906
WDR47	22911	.	GRCh37	1	109560373	109560373	+	Intron	DEL	T	T	-	rs33990918		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.159-150del			ENST00000400794		6	.	4	11	.	0	WDR47,intron_variant,,ENST00000357672,;WDR47,intron_variant,,ENST00000361054,;WDR47,intron_variant,,ENST00000369962,;WDR47,intron_variant,,ENST00000369965,NM_001142551.1,NM_014969.5,NM_001142550.1;WDR47,intron_variant,,ENST00000400794,;WDR47,intron_variant,,ENST00000528747,;WDR47,intron_variant,,ENST00000529074,;WDR47,intron_variant,,ENST00000530772,;WDR47,intron_variant,,ENST00000531337,;	-	ENSG00000085433	ENST00000400794	Transcript	intron_variant						rs33990918	1		-1	WDR47	HGNC	29141	protein_coding	YES	CCDS44186.1	ENSP00000383599	O94967	E9PKZ6	UPI0001639B05					2/14			0.7678	0.8833		0.8948	0.8588	0.9182										MODIFIER	1	deletion														.	AATT	.	.																					109560372
PIFO	128344	.	GRCh37	1	111894729	111894730	+	3'UTR	INS	-	-	ATG	rs79322001		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.*782_*783insGAT			ENST00000369738	6/6	5	.	4	3	.	0	PIFO,3_prime_UTR_variant,,ENST00000369738,NM_181643.4;PIFO,downstream_gene_variant,,ENST00000369737,;PIFO,non_coding_transcript_exon_variant,,ENST00000484512,;PIFO,downstream_gene_variant,,ENST00000468395,;CHIAP3,downstream_gene_variant,,ENST00000423668,;	ATG	ENSG00000173947	ENST00000369738	Transcript	3_prime_UTR_variant	1721-1722/2627					rs79322001	1		1	PIFO	HGNC	27009	protein_coding	YES	CCDS833.1	ENSP00000358753	Q8TCI5		UPI000019790E	NM_181643.4			6/6				0.0802	0.072		0.3185	0.1233	0.183										MODIFIER	1	insertion														.	ACA	.	.																					111894729
Unknown	0	.	GRCh37	1	116082634	116082640	+	IGR	DEL	GATACCT	GATACCT	-	rs35538417		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GATACCT	GATACCT																					3	.	3	0	.	0		-				intergenic_variant						rs35538417	1																				0.6354	0.3732		0.3998	0.3191	0.5849										MODIFIER	1	deletion														.	GGGATACCTG	.	.																					116082633
SPAG17	200162	.	GRCh37	1	118648479	118648480	+	Intron	INS	-	-	A	rs397844630		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.448-3931dup			ENST00000336338		3	.	3	0	.	0	SPAG17,intron_variant,,ENST00000336338,NM_206996.2;	A	ENSG00000155761	ENST00000336338	Transcript	intron_variant						rs397844630	1		-1	SPAG17	HGNC	26620	protein_coding	YES	CCDS899.1	ENSP00000337804	Q6Q759	A7LBF9	UPI00001601FD	NM_206996.2				4/48			0.6853	0.5043		0.4484	0.5487	0.5573										MODIFIER	1	insertion													1	.	AGA	.	.																					118648479
AL592494.5	0	.	GRCh37	1	121141962	121141979	+	Intron	DEL	TGAAATGAAAAGAAATGA	TGAAATGAAAAGAAATGA	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGAAATGAAAAGAAATGA	TGAAATGAAAAGAAATGA																n.551+2798_551+2815del			ENST00000417218		7	.	3	3	.	0	AL592494.5,intron_variant,,ENST00000417218,;RP11-343N15.1,upstream_gene_variant,,ENST00000429055,;RP11-343N15.1,upstream_gene_variant,,ENST00000437515,;	-	ENSG00000227082	ENST00000417218	Transcript	intron_variant,non_coding_transcript_variant							1		1	AL592494.5	Clone_based_vega_gene		lincRNA	YES										1/1																		MODIFIER	1	sequence_alteration														.	ACTGAAATGAAAAGAAATGAT	.	.																					121141961
Unknown	0	.	GRCh37	1	121352300	121352301	+	IGR	INS	-	-	T	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					39	33	6	35	0	0		T				intergenic_variant							1																																			MODIFIER	1	insertion														.	TGT	.	.																					121352300
PDE4DIP	9659	.	GRCh37	1	145058201	145058201	+	Intron	DEL	A	A	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.233+17429del			ENST00000369348		7	.	3	5	.	0	PDE4DIP,intron_variant,,ENST00000369348,NM_022359.5;PDE4DIP,intron_variant,,ENST00000369359,;PDE4DIP,intron_variant,,ENST00000530740,;PDE4DIP,intron_variant,,ENST00000528552,;PDE4DIP,intron_variant,,ENST00000533396,;PDE4DIP,intron_variant,,ENST00000526359,;PDE4DIP,intron_variant,,ENST00000527063,;PDE4DIP,intron_variant,,ENST00000528661,;	-	ENSG00000178104	ENST00000369348	Transcript	intron_variant							1		-1	PDE4DIP	HGNC	15580	protein_coding		CCDS30827.1	ENSP00000358354	Q5VU43		UPI000013F4FC	NM_022359.5				1/6																		MODIFIER	1	deletion													1	.	GGAA	.	.																					145058200
NBPF13P	728989	.	GRCh37	1	146513690	146513691	+	Intron	INS	-	-	AAT	rs34011406		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.2771-610_2771-608dup			ENST00000444082		3	.	3	0	.	0	NBPF13P,intron_variant,,ENST00000444082,;NBPF13P,intron_variant,,ENST00000444680,;	AAT	ENSG00000227242	ENST00000444082	Transcript	intron_variant,non_coding_transcript_variant						rs34011406	1		-1	NBPF13P	HGNC	31995	unprocessed_pseudogene	YES										21/27			0.4622	0.2349		0.5099	0.173	0.2587										MODIFIER	1	insertion														.	CAA	.	.																					146513690
RP11-763B22.6	0	.	GRCh37	1	148848700	148848701	+	5'Flank	INS	-	-	TCATT	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000456469		13	.	4	6	.	0	RP11-763B22.6,upstream_gene_variant,,ENST00000456469,;	TCATT	ENSG00000235887	ENST00000456469	Transcript	upstream_gene_variant							1	3692	1	RP11-763B22.6	Clone_based_vega_gene		lincRNA	YES																												MODIFIER	1	insertion														.	CCT	.	.																					148848700
RP11-763B22.6	0	.	GRCh37	1	148855273	148855298	+	3'Flank	DEL	AAAGCCGCAGCGGCGGGTGGGGGCAG	AAAGCCGCAGCGGCGGGTGGGGGCAG	-	rs71083878,rs782601743		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAGCCGCAGCGGCGGGTGGGGGCAG	AAAGCCGCAGCGGCGGGTGGGGGCAG																			ENST00000456469		3	.	3	0	.	0	RP11-763B22.6,downstream_gene_variant,,ENST00000456469,;RP11-763B22.9,intron_variant,,ENST00000444424,;RP11-763B22.7,upstream_gene_variant,,ENST00000444165,;,regulatory_region_variant,,ENSR00000945681,;	-	ENSG00000235887	ENST00000456469	Transcript	downstream_gene_variant						rs71083878,rs782601743	1	1556	1	RP11-763B22.6	Clone_based_vega_gene		lincRNA	YES																												MODIFIER		deletion														.	AAAAAGCCGCAGCGGCGGGTGGGGGCAGA	.	.																					148855272
LINC00869	57234	.	GRCh37	1	149287128	149287129	+	3'Flank	DEL	CT	CT	-	rs75714611		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CT	CT																			ENST00000424684		16	10	6	9	0	0	LINC00869,downstream_gene_variant,,ENST00000424684,;RP11-403I13.8,upstream_gene_variant,,ENST00000433084,;RNU1-143P,upstream_gene_variant,,ENST00000516296,;	-	ENSG00000226067	ENST00000424684	Transcript	downstream_gene_variant						rs75714611	1	153	1	LINC00869	HGNC	29050	lincRNA	YES																												MODIFIER		deletion														.	GCCTC	.	.																					149287127
RP11-126K1.2	0	.	GRCh37	1	151253892	151253893	+	Intron	INS	-	-	T	rs33967833		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.117+126dup			ENST00000447795		3	.	3	0	.	0	RP11-126K1.2,intron_variant,,ENST00000447795,;ZNF687,upstream_gene_variant,,ENST00000324048,;ZNF687,upstream_gene_variant,,ENST00000336715,;ZNF687,upstream_gene_variant,,ENST00000368879,NM_020832.1;ZNF687,upstream_gene_variant,,ENST00000443959,;RP11-126K1.2,intron_variant,,ENST00000494138,;ZNF687,upstream_gene_variant,,ENST00000449313,;,regulatory_region_variant,,ENSR00000013603,;,TF_binding_site_variant,,ENSM00522872326,;,TF_binding_site_variant,,ENSM00524449609,;	T	ENSG00000232671	ENST00000447795	Transcript	intron_variant						rs33967833	1		-1	RP11-126K1.2	Clone_based_vega_gene		protein_coding	YES		ENSP00000411098		A2A3Q1	UPI00001412D2					1/1																		MODIFIER	1	insertion														.	GGT	.	.																					151253892
TUFT1	7286	.	GRCh37	1	151557322	151557322	+	3'Flank	DEL	C	C	-	rs35861463		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENST00000368849		3	.	3	0	.	0	TUFT1,downstream_gene_variant,,ENST00000353024,;TUFT1,downstream_gene_variant,,ENST00000368848,NM_001126337.1;TUFT1,downstream_gene_variant,,ENST00000368849,NM_020127.2;TUFT1,downstream_gene_variant,,ENST00000392712,;TUFT1,downstream_gene_variant,,ENST00000538902,;,regulatory_region_variant,,ENSR00000946197,;	-	ENSG00000143367	ENST00000368849	Transcript	downstream_gene_variant						rs35861463	1	1263	1	TUFT1	HGNC	12422	protein_coding	YES	CCDS1000.1	ENSP00000357842	Q9NNX1		UPI0000037BFA	NM_020127.2						0.4597	0.2837	0.5447		0.4206	0.663	0.4683										MODIFIER	1	deletion														.	GGCT	.	.																					151557321
Unknown	0	.	GRCh37	1	152513511	152513512	+	IGR	DEL	CA	CA	-	rs5777815		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CA	CA																					3	.	3	0	.	0		-				intergenic_variant						rs5777815	1																				0.497	0.5519		0.6081	0.6193	0.6002										MODIFIER	1	deletion														.	GCCAC	.	.																					152513510
S100A7	6278	.	GRCh37	1	153433913	153433914	+	5'Flank	INS	-	-	CCCCGCAG	rs56152346		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000368723		3	.	3	0	.	0	S100A7,upstream_gene_variant,,ENST00000368722,;S100A7,upstream_gene_variant,,ENST00000368723,NM_002963.3;,regulatory_region_variant,,ENSR00000946595,;	CCCCGCAG	ENSG00000143556	ENST00000368723	Transcript	upstream_gene_variant						rs56152346	1	736	-1	S100A7	HGNC	10497	protein_coding	YES	CCDS1039.1	ENSP00000357712	P31151		UPI000013D90F	NM_002963.3							0.8578	0.853		0.7292	0.8231	0.6595										MODIFIER	1	insertion													1	.	CCC	.	.																					153433913
ENSR00000947323	0	.	GRCh37	1	156153489	156153496	+	IGR	DEL	TGTGTGTG	TGTGTGTG	-	rs71080752		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGTGTGTG	TGTGTGTG																			ENSR00000947323		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00000947323,;	-		ENSR00000947323	RegulatoryFeature	regulatory_region_variant						rs71080752	1																																			MODIFIER	1	deletion														.	TTTGTGTGTGT	.	.																					156153488
ETV3	2117	.	GRCh37	1	157088339	157088344	+	3'Flank	DEL	TTTCTT	TTTCTT	-	rs10522191		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTCTT	TTTCTT																			ENST00000368192		4	.	4	0	.	0	ETV3,downstream_gene_variant,,ENST00000368192,NM_001145312.1;	-	ENSG00000117036	ENST00000368192	Transcript	downstream_gene_variant						rs10522191	1	2639	-1	ETV3	HGNC	3492	protein_coding	YES	CCDS44250.1	ENSP00000357175	P41162		UPI0000071047	NM_001145312.1							0.5136	0.4597		0.7173	0.2972	0.5552										MODIFIER	1	deletion														.	TCTTTCTTT	.	.																					157088338
FCRL3	115352	.	GRCh37	1	157669293	157669294	+	Intron	INS	-	-	A	rs74599050		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.52+189dup			ENST00000368184		15	.	5	13	.	0	FCRL3,intron_variant,,ENST00000368184,NM_052939.3;FCRL3,intron_variant,,ENST00000368186,;FCRL3,intron_variant,,ENST00000496769,;RP11-367J7.3,downstream_gene_variant,,ENST00000453692,;FCRL3,intron_variant,,ENST00000480682,;FCRL3,intron_variant,,ENST00000494724,;FCRL3,upstream_gene_variant,,ENST00000473231,;FCRL3,upstream_gene_variant,,ENST00000478179,;FCRL3,intron_variant,,ENST00000477837,;FCRL3,intron_variant,,ENST00000485028,;FCRL3,intron_variant,,ENST00000492769,;	AA	ENSG00000160856	ENST00000368184	Transcript	intron_variant						rs74599050	1		-1	FCRL3	HGNC	18506	protein_coding	YES	CCDS1167.1	ENSP00000357167	Q96P31	R4GNJ6	UPI000006D60E	NM_052939.3				3/14																		MODIFIER	1	sequence_alteration													1	.	AGAA	.	.																					157669292
Unknown	0	.	GRCh37	1	159649896	159649896	+	IGR	DEL	T	T	-	rs34098113		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs34098113	1																																			MODIFIER	1	deletion														.	TCTT	.	.																					159649895
IGSF9	57549	.	GRCh37	1	159907173	159907174	+	Intron	INS	-	-	C	rs35861479		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.400+302dup			ENST00000368094		5	.	4	6	.	0	IGSF9,intron_variant,,ENST00000361509,NM_020789.3;IGSF9,intron_variant,,ENST00000368094,NM_001135050.1;IGSF9,intron_variant,,ENST00000476102,;IGSF9,upstream_gene_variant,,ENST00000493195,;IGSF9,upstream_gene_variant,,ENST00000496645,;,regulatory_region_variant,,ENSR00001506765,;	C	ENSG00000085552	ENST00000368094	Transcript	intron_variant						rs35861479	1		-1	IGSF9	HGNC	18132	protein_coding	YES	CCDS44254.1	ENSP00000357073	Q9P2J2	Q6XYD8	UPI000004A10B	NM_001135050.1				4/20			0.4191	0.4092		0.4643	0.4016	0.4018										MODIFIER	1	insertion														.	AGC	.	.																					159907173
USP21	27005	.	GRCh37	1	161135142	161135142	+	Splice_Region	DEL	C	C	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.1608-4del			ENST00000368002		75	.	55	49	.	47	USP21,splice_region_variant,,ENST00000289865,NM_012475.4;USP21,splice_region_variant,,ENST00000368001,;USP21,splice_region_variant,,ENST00000368002,NM_001014443.2;PPOX,upstream_gene_variant,,ENST00000352210,NM_000309.3;PPOX,upstream_gene_variant,,ENST00000367999,NM_001122764.1;PPOX,upstream_gene_variant,,ENST00000432542,;USP21,downstream_gene_variant,,ENST00000479344,;USP21,downstream_gene_variant,,ENST00000492950,;PPOX,upstream_gene_variant,,ENST00000535223,;PPOX,upstream_gene_variant,,ENST00000537523,;PPOX,upstream_gene_variant,,ENST00000537829,;PPOX,upstream_gene_variant,,ENST00000544598,;USP21,splice_region_variant,,ENST00000493054,;PPOX,upstream_gene_variant,,ENST00000460611,;PPOX,upstream_gene_variant,,ENST00000462866,;PPOX,upstream_gene_variant,,ENST00000462977,;PPOX,upstream_gene_variant,,ENST00000466452,;PPOX,upstream_gene_variant,,ENST00000470607,;USP21,downstream_gene_variant,,ENST00000486299,;PPOX,upstream_gene_variant,,ENST00000490768,;PPOX,upstream_gene_variant,,ENST00000494216,;PPOX,upstream_gene_variant,,ENST00000495483,;PPOX,upstream_gene_variant,,ENST00000497522,;USP21,splice_region_variant,,ENST00000485277,;USP21,splice_region_variant,,ENST00000487163,;PPOX,upstream_gene_variant,,ENST00000468968,;PPOX,upstream_gene_variant,,ENST00000479246,;USP21,downstream_gene_variant,,ENST00000482385,;PPOX,upstream_gene_variant,,ENST00000539753,;PPOX,upstream_gene_variant,,ENST00000541818,;	-	ENSG00000143258	ENST00000368002	Transcript	splice_region_variant,intron_variant							1		1	USP21	HGNC	12620	protein_coding	YES	CCDS30920.1	ENSP00000356981	Q9UK80		UPI00001379FD	NM_001014443.2				13/13																		LOW	1	deletion														.	TTCC	.	.																					161135141
Unknown	0	.	GRCh37	1	163627527	163627528	+	IGR	INS	-	-	T	rs35669231		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	3	4	.	0		T				intergenic_variant						rs35669231	1																																			MODIFIER	1	insertion														.	GAT	.	.																					163627527
Unknown	0	.	GRCh37	1	163883031	163883032	+	IGR	INS	-	-	TA	rs80104661		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		TA				intergenic_variant						rs80104661	1																				0.2284	0.2622		0.0248	0.4205	0.1166										MODIFIER	1	insertion														.	AGT	.	.																					163883031
FMO9P	116123	.	GRCh37	1	166594483	166594484	+	3'Flank	DEL	TT	TT	-	rs3032708		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																			ENST00000477875		6	.	4	1	.	0	FMO9P,downstream_gene_variant,,ENST00000477875,;FMO9P,intron_variant,,ENST00000488458,;	-	ENSG00000215834	ENST00000477875	Transcript	downstream_gene_variant						rs3032708	1	8	1	FMO9P	HGNC	32210	processed_transcript	YES													0.6974	0.4424		0.3373	0.6103	0.3211										MODIFIER	1	deletion														.	TCTTT	.	.																					166594482
RP11-277B15.1	0	.	GRCh37	1	167131443	167131446	+	3'Flank	DEL	ACTC	ACTC	-	rs35496966		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACTC	ACTC																			ENST00000450126		4	.	4	0	.	0	RP11-277B15.1,downstream_gene_variant,,ENST00000450126,;,regulatory_region_variant,,ENSR00000949688,;	-	ENSG00000213068	ENST00000450126	Transcript	downstream_gene_variant						rs35496966	1	214	-1	RP11-277B15.1	Clone_based_vega_gene		processed_pseudogene	YES													0.3737	0.1585		0.5962	0.163	0.2127										MODIFIER	1	deletion														.	TAACTCA	.	.																					167131442
MPZL1	9019	.	GRCh37	1	167734559	167734559	+	Intron	DEL	A	A	-	rs34061385		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.92-252del			ENST00000359523		4	.	3	3	.	0	MPZL1,intron_variant,,ENST00000359523,NM_024569.4,NM_003953.5;MPZL1,intron_variant,,ENST00000392121,NM_001146191.1;MPZL1,intron_variant,,ENST00000474859,;MPZL1,upstream_gene_variant,,ENST00000367853,;MPZL1,non_coding_transcript_exon_variant,,ENST00000474729,;MPZL1,intron_variant,,ENST00000448405,;MPZL1,intron_variant,,ENST00000464954,;MPZL1,intron_variant,,ENST00000465787,;	-	ENSG00000197965	ENST00000359523	Transcript	intron_variant						rs34061385	1		1	MPZL1	HGNC	7226	protein_coding	YES	CCDS1264.1	ENSP00000352513	O95297	A8K5D4	UPI000004BA6A	NM_024569.4,NM_003953.5				1/5			0.0991	0.3689		0.3661	0.164	0.1554										MODIFIER	1	deletion														.	TTAA	.	.																					167734558
Unknown	0	.	GRCh37	1	169464231	169464231	+	IGR	DEL	A	A	-	rs5778617		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	4	0	.	0		-				intergenic_variant						rs5778617	1																																			MODIFIER	1	deletion														.	TCAA	.	.																					169464230
KIFAP3	22920	.	GRCh37	1	169920149	169920150	+	Intron	INS	-	-	A	rs66584019		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2273+3002dup			ENST00000361580		4	.	4	0	.	0	KIFAP3,intron_variant,,ENST00000361580,NM_014970.3;KIFAP3,intron_variant,,ENST00000367765,NM_001204517.1;KIFAP3,intron_variant,,ENST00000367767,NM_001204516.1;KIFAP3,intron_variant,,ENST00000538366,NM_001204514.1;KIFAP3,intron_variant,,ENST00000540905,;	A	ENSG00000075945	ENST00000361580	Transcript	intron_variant						rs66584019	1		-1	KIFAP3	HGNC	17060	protein_coding	YES	CCDS1288.1	ENSP00000354560	Q92845	B7Z7E7	UPI000006CD6C	NM_014970.3				19/19			0.8654	0.8141		0.875	0.83	0.818										MODIFIER	1	insertion														.	TTA	.	.																					169920149
MYOC	4653	.	GRCh37	1	171606757	171606757	+	Intron	DEL	T	T	-	rs1242075694		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.731-908del			ENST00000037502		3	.	3	0	.	0	MYOC,intron_variant,,ENST00000037502,NM_000261.1;	-	ENSG00000034971	ENST00000037502	Transcript	intron_variant						rs1242075694	1		-1	MYOC	HGNC	7610	protein_coding	YES	CCDS1297.1	ENSP00000037502	Q99972	B4DV60	UPI00000012D6	NM_000261.1				2/2																		MODIFIER	1	deletion													1	.	TATT	.	.																					171606756
DNM3	26052	.	GRCh37	1	171905499	171905500	+	Intron	INS	-	-	AAAGAAAG	rs3051605		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.235+14547_235+14554dup			ENST00000358155		3	.	3	0	.	0	DNM3,intron_variant,,ENST00000355305,;DNM3,intron_variant,,ENST00000358155,NM_015569.4;DNM3,intron_variant,,ENST00000367731,NM_001136127.2;DNM3,intron_variant,,ENST00000367733,NM_001278252.1;DNM3,intron_variant,,ENST00000520906,;	AAAGAAAG	ENSG00000197959	ENST00000358155	Transcript	intron_variant						rs3051605	1		1	DNM3	HGNC	29125	protein_coding	YES	CCDS53431.1	ENSP00000350876	Q9UQ16	E5RIK2	UPI0000251D91	NM_015569.4				2/20			0.6899	0.6009		0.5417	0.6412	0.6544										MODIFIER	1	insertion														.	GAA	.	.																					171905499
Unknown	0	.	GRCh37	1	172657258	172657259	+	IGR	INS	-	-	TG	rs141767478		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					7	4	3	4	4	0		TG				intergenic_variant						rs141767478	1																																			MODIFIER	1	insertion														.	TAT	.	.																					172657258
TNN	63923	.	GRCh37	1	175093824	175093831	+	Intron	DEL	CAAACAAA	CAAACAAA	-	rs59814606		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAAACAAA	CAAACAAA																c.2914+1046_2914+1053del			ENST00000239462		3	.	3	0	.	0	TNN,intron_variant,,ENST00000239462,NM_022093.1;	-	ENSG00000120332	ENST00000239462	Transcript	intron_variant						rs59814606	1		1	TNN	HGNC	22942	protein_coding	YES	CCDS30943.1	ENSP00000239462	Q9UQP3		UPI00001D7DA9	NM_022093.1				12/18																		MODIFIER	1	deletion														.	AGCAAACAAAC	.	.																					175093823
Unknown	0	.	GRCh37	1	177288341	177288342	+	IGR	INS	-	-	GTGT	rs3066140		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		GTGT				intergenic_variant						rs3066140	1																				0.5098	0.6326		0.5317	0.5268	0.5746										MODIFIER	1	insertion														.	GAG	.	.																					177288341
C1ORF220	0	.	GRCh37	1	178507387	178507390	+	5'Flank	DEL	GAGT	GAGT	-	rs5778993		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAGT	GAGT																			ENST00000367636		3	.	3	0	.	0	C1ORF220,upstream_gene_variant,,ENST00000367636,;C1orf220,upstream_gene_variant,,ENST00000367638,;C1orf220,upstream_gene_variant,,ENST00000521244,;TEX35,intron_variant,,ENST00000419909,;	-	ENSG00000184909	ENST00000367636	Transcript	upstream_gene_variant						rs5778993	1	4560	1	C1ORF220	Uniprot_gn		protein_coding	YES		ENSP00000356608			UPI00001405B8								0.174	0.4207		0.3839	0.3956	0.317										MODIFIER	1	deletion														.	AGGAGTG	.	.																					178507386
ABL2	27	.	GRCh37	1	179118036	179118037	+	Intron	DEL	AA	AA	-	rs35904029		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																c.158-15528_158-15527del			ENST00000502732		3	.	3	0	.	0	ABL2,intron_variant,,ENST00000367623,;ABL2,intron_variant,,ENST00000392043,NM_001136001.1;ABL2,intron_variant,,ENST00000502732,NM_001168237.1,NM_007314.3,NM_001168238.1,NM_001168236.1;ABL2,intron_variant,,ENST00000507173,;ABL2,intron_variant,,ENST00000511413,;	-	ENSG00000143322	ENST00000502732	Transcript	intron_variant						rs35904029	1		-1	ABL2	HGNC	77	protein_coding	YES	CCDS30947.1	ENSP00000427562	P42684		UPI0000125140	NM_001168237.1,NM_007314.3,NM_001168238.1,NM_001168236.1				1/11																		MODIFIER	1	deletion													1	.	TGAAA	.	.																					179118035
SOAT1	6646	.	GRCh37	1	179317896	179317921	+	Intron	DEL	TGTGTGTGTGTGTGTGTGTGTGTGTG	TGTGTGTGTGTGTGTGTGTGTGTGTG	-	rs71111912		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGTGTGTGTGTGTGTGTGTGTGTGTG	TGTGTGTGTGTGTGTGTGTGTGTGTG																c.1216-54_1216-29del			ENST00000367619		58	.	19	43	.	7	SOAT1,intron_variant,,ENST00000367619,NM_003101.5;SOAT1,intron_variant,,ENST00000535686,;SOAT1,intron_variant,,ENST00000539888,NM_001252512.1;SOAT1,intron_variant,,ENST00000540564,NM_001252511.1;	-	ENSG00000057252	ENST00000367619	Transcript	intron_variant						rs71111912	1		1	SOAT1	HGNC	11177	protein_coding	YES	CCDS1330.1	ENSP00000356591	P35610	B4DFD8,B1APM4	UPI0000071233	NM_003101.5				12/15																		MODIFIER	1	deletion														.	GATGTGTGTGTGTGTGTGTGTGTGTGTGT	.	.																					179317895
AXDND1	126859	.	GRCh37	1	179476914	179476914	+	Intron	DEL	A	A	-	rs5779029		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.2389-1507del			ENST00000367618		3	.	3	0	.	0	AXDND1,intron_variant,,ENST00000367618,NM_144696.5;AXDND1,intron_variant,,ENST00000434088,;AXDND1,intron_variant,,ENST00000484883,;AXDND1,intron_variant,,ENST00000511157,;	-	ENSG00000162779	ENST00000367618	Transcript	intron_variant						rs5779029	1		1	AXDND1	HGNC	26564	protein_coding	YES	CCDS30948.1	ENSP00000356590	Q5T1B0	D6REE1,D6RDY4,D6RCN1,D6RB87,D6R9B7	UPI000022AC91	NM_144696.5				20/25			0.4312	0.7767		0.8006	0.7416	0.8149										MODIFIER	1	deletion														.	TTAA	.	.																					179476913
NPHS2	7827	.	GRCh37	1	179536133	179536134	+	Intron	INS	-	-	G	rs199642250		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.275-2206dup			ENST00000367615		3	.	3	0	.	0	NPHS2,intron_variant,,ENST00000367615,NM_014625.2;NPHS2,intron_variant,,ENST00000367616,;	G	ENSG00000116218	ENST00000367615	Transcript	intron_variant						rs199642250	1		-1	NPHS2	HGNC	13394	protein_coding	YES	CCDS1331.1	ENSP00000356587	Q9NP85		UPI000003F549	NM_014625.2				1/7			0.0772	0.2853		0.3839	0.3111	0.3967										MODIFIER	1	insertion													1	.	GTG	.	.																					179536133
Unknown	0	.	GRCh37	1	184753319	184753320	+	IGR	INS	-	-	TCTTTGTGACCTAC	rs11272701		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TCTTTGTGACCTAC				intergenic_variant						rs11272701	1																				0.6725	0.4582		0.6508	0.4304	0.5164										MODIFIER	1	insertion														.	GAT	.	.																					184753319
LINC01036	0	.	GRCh37	1	187145740	187145741	+	Intron	INS	-	-	T	rs755253160		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.105+83675dup			ENST00000458683		4	.	4	0	.	0	LINC01036,intron_variant,,ENST00000458683,;	T	ENSG00000236030	ENST00000458683	Transcript	intron_variant,non_coding_transcript_variant						rs755253160	1		1	LINC01036	HGNC	49024	lincRNA	YES										1/3																		MODIFIER	1	insertion														.	CCT	.	.																					187145740
Unknown	0	.	GRCh37	1	188081583	188081583	+	IGR	DEL	T	T	-	rs78473107		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	3	3	.	0		-				intergenic_variant						rs78473107	1																			0.1677	0.0151	0.2262		0.1944	0.3022	0.1667										MODIFIER	1	deletion														.	AATG	.	.																					188081582
Unknown	0	.	GRCh37	1	188444582	188444585	+	IGR	DEL	CTCT	CTCT	-	rs71831047		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTCT	CTCT																					7	.	7	0	.	0		-				intergenic_variant						rs71831047	1																				0.2186	0.3372		0.1518	0.4135	0.2393										MODIFIER	1	deletion														.	CCCTCTC	.	.																					188444581
RP11-316I3.1	0	.	GRCh37	1	188676257	188676258	+	Intron	INS	-	-	TTT	rs111862098		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.71-844_71-842dup			ENST00000432976		3	.	3	0	.	0	RP11-316I3.1,intron_variant,,ENST00000432976,;,regulatory_region_variant,,ENSR00001509878,;,TF_binding_site_variant,,ENSM00527054436,;	TTT	ENSG00000237283	ENST00000432976	Transcript	intron_variant,non_coding_transcript_variant						rs111862098	1		-1	RP11-316I3.1	Clone_based_vega_gene		lincRNA	YES										1/1																		MODIFIER	1	insertion														.	AAT	.	.																					188676257
Unknown	0	.	GRCh37	1	189039065	189039066	+	IGR	DEL	CA	CA	-	rs10534294		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CA	CA																					3	.	3	0	.	0		-				intergenic_variant						rs10534294	1																			0.5288	0.4251	0.5879		0.5754	0.5199	0.5879										MODIFIER	1	deletion														.	TTCAG	.	.																					189039064
ENSR00000954480	0	.	GRCh37	1	190833179	190833202	+	IGR	DEL	TTGTTGTTGTTGTTGTTGTTATTG	TTGTTGTTGTTGTTGTTGTTATTG	-	rs71103687		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTGTTGTTGTTGTTGTTGTTATTG	TTGTTGTTGTTGTTGTTGTTATTG																			ENSR00000954480		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00000954480,;,regulatory_region_variant,,ENSR00001509966,;	-		ENSR00000954480	RegulatoryFeature	regulatory_region_variant						rs71103687	1																																			MODIFIER	1	deletion														.	TATTGTTGTTGTTGTTGTTGTTATTGT	.	.																					190833178
Unknown	0	.	GRCh37	1	191586637	191586638	+	IGR	INS	-	-	TCTA	rs144979501		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TCTA				intergenic_variant						rs144979501	1																				0.2126	0.3545		0.4921	0.4533	0.4335										MODIFIER	1	insertion														.	TCT	.	.																					191586637
RP11-21J7.1	0	.	GRCh37	1	193661778	193661778	+	Intron	DEL	A	-	-	rs61395568		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																n.112+13644del			ENST00000448412		6	.	0	3	.	3	RP11-21J7.1,intron_variant,,ENST00000448412,;RP11-98G13.1,upstream_gene_variant,,ENST00000447056,;	-	ENSG00000226640	ENST00000448412	Transcript	intron_variant,non_coding_transcript_variant						rs61395568	1		1	RP11-21J7.1	Clone_based_vega_gene		lincRNA	YES										1/2																		MODIFIER	1	deletion														.	CTAA	.	.																					193661777
Unknown	0	.	GRCh37	1	193981407	193981407	+	IGR	DEL	A	-	-	rs139326553		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					6	3	3	3	0	0		-				intergenic_variant						rs139326553	1																				0.0015	0.0432		0.0119	0.0557	0.0164										MODIFIER	1	deletion														.	ATAA	.	.																					193981406
Unknown	0	.	GRCh37	1	194252845	194252845	+	IGR	DEL	A	A	-	rs11341664		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	3	2	.	0		-				intergenic_variant						rs11341664	1																				0.5401	0.7882		0.9077	0.7962	0.8221										MODIFIER	1	deletion														.	AGAA	.	.																					194252844
Unknown	0	.	GRCh37	1	195126697	195126698	+	IGR	DEL	AG	AG	-	rs112739796		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																					4	.	4	0	.	0		-				intergenic_variant						rs112739796	1																																			MODIFIER	1	deletion														.	TAAGA	.	.																					195126696
Unknown	0	.	GRCh37	1	196996391	196996392	+	IGR	DEL	TT	TT	-	rs66823348		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																					3	.	3	0	.	0		-				intergenic_variant						rs66823348	1																																			MODIFIER	1	deletion														.	TCTTT	.	.																					196996390
NR5A2	2494	.	GRCh37	1	200056370	200056373	+	Intron	DEL	ACAC	ACAC	-	rs34917175		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACAC	ACAC																c.1111-23938_1111-23935del			ENST00000367362		3	.	3	0	.	0	NR5A2,intron_variant,,ENST00000236914,NM_003822.4;NR5A2,intron_variant,,ENST00000367362,NM_205860.2;NR5A2,intron_variant,,ENST00000544748,NM_001276464.1;	-	ENSG00000116833	ENST00000367362	Transcript	intron_variant						rs34917175	1		1	NR5A2	HGNC	7984	protein_coding	YES	CCDS1401.1	ENSP00000356331	O00482	Q8WY08,B4E2P3	UPI0000130482	NM_205860.2				5/7																		MODIFIER	1	deletion														.	CAACACA	.	.																					200056369
DDX59	83479	.	GRCh37	1	200607760	200607760	+	Intron	DEL	T	T	-	rs34715492		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1596+9807del			ENST00000447706		3	.	3	0	.	0	DDX59,intron_variant,,ENST00000447706,;DDX59,downstream_gene_variant,,ENST00000367348,;DDX59,downstream_gene_variant,,ENST00000413408,;DDX59,downstream_gene_variant,,ENST00000452560,;	-	ENSG00000118197	ENST00000447706	Transcript	intron_variant						rs34715492	1		-1	DDX59	HGNC	25360	protein_coding			ENSP00000394367	Q5T1V6	Q5T1V5,B7ZBU4	UPI0000037B2C					7/7			0.8812	0.7378		0.8145	0.7147	0.819										MODIFIER	1	deletion													1	.	CATT	.	.																					200607759
RNPEP	6051	.	GRCh37	1	201955667	201955668	+	Intron	INS	-	-	C	rs55711441		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.448-2365_448-2364insC			ENST00000295640		3	.	3	0	.	0	RNPEP,intron_variant,,ENST00000295640,NM_020216.3;RNPEP,intron_variant,,ENST00000367286,;RNPEP,intron_variant,,ENST00000447312,;RNPEP,intron_variant,,ENST00000471105,;RNPEP,intron_variant,,ENST00000478617,;RNPEP,intron_variant,,ENST00000479726,;RNPEP,intron_variant,,ENST00000481780,;RNPEP,intron_variant,,ENST00000487116,;RNPEP,intron_variant,,ENST00000492587,;RNPEP,intron_variant,,ENST00000492849,;	C	ENSG00000176393	ENST00000295640	Transcript	intron_variant						rs55711441	1		1	RNPEP	HGNC	10078	protein_coding	YES	CCDS1418.1	ENSP00000295640	Q9H4A4		UPI00000463FA	NM_020216.3				1/10			0.8169	0.9597		0.9861	0.9722	0.9836										MODIFIER	1	insertion														.	TTT	.	.																					201955667
TMCC2	9911	.	GRCh37	1	205244159	205244161	+	3'Flank	DEL	AAC	AAC	-	rs143823297		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAC	AAC																			ENST00000358024		3	.	3	0	.	0	TMCC2,downstream_gene_variant,,ENST00000329800,;TMCC2,downstream_gene_variant,,ENST00000330675,;TMCC2,downstream_gene_variant,,ENST00000358024,NM_014858.3;TMCC2,downstream_gene_variant,,ENST00000545499,NM_001242925.1;TMCC2,downstream_gene_variant,,ENST00000468846,;TMCC2,downstream_gene_variant,,ENST00000481950,;TMCC2,downstream_gene_variant,,ENST00000495538,;,regulatory_region_variant,,ENSR00001511536,;	-	ENSG00000133069	ENST00000358024	Transcript	downstream_gene_variant						rs143823297	1	1688	1	TMCC2	HGNC	24239	protein_coding	YES	CCDS30984.1	ENSP00000350718	O75069		UPI00002056FC	NM_014858.3							0.0227	0.1542		0.0317	0.3231	0.0644										MODIFIER	1	deletion														.	AAAACA	.	.																					205244158
CR1L	1379	.	GRCh37	1	207848618	207848619	+	Intron	INS	-	-	ATC	rs75729926		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.98-2114_98-2113insCAT			ENST00000508064		4	.	4	0	.	0	CR1L,intron_variant,,ENST00000508064,NM_175710.1;CR1L,intron_variant,,ENST00000430248,;CR1L,intron_variant,,ENST00000530905,;CR1L,intron_variant,,ENST00000531844,;CR1L,upstream_gene_variant,,ENST00000294997,;	ATC	ENSG00000197721	ENST00000508064	Transcript	intron_variant						rs75729926	1		1	CR1L	HGNC	2335	protein_coding	YES	CCDS44310.1	ENSP00000421736	Q2VPA4		UPI0000DD792A	NM_175710.1				1/11			0.298	0.3026		0.3353	0.3787	0.3221										MODIFIER	1	insertion														.	TTA	.	.																					207848618
ENSR00001512330	0	.	GRCh37	1	211692529	211692540	+	IGR	DEL	ATATATATATAT	ATATATATATAT	-	rs58127111		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATATATATATAT	ATATATATATAT																			ENSR00001512330		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001512330,;	-		ENSR00001512330	RegulatoryFeature	regulatory_region_variant						rs58127111	1																																			MODIFIER	1	deletion														.	TGATATATATATATA	.	.																					211692528
Unknown	0	.	GRCh37	1	212060545	212060546	+	IGR	INS	-	-	G	rs5780664		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					7	.	4	5	.	0		G				intergenic_variant						rs5780664	1																				0.5688	0.5533		0.7688	0.3767	0.4703										MODIFIER	1	insertion														.	GTG	.	.																					212060545
Unknown	0	.	GRCh37	1	212086961	212086962	+	IGR	DEL	AC	AC	-	rs68045282		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																					3	.	3	0	.	0		-				intergenic_variant						rs68045282	1																																			MODIFIER	1	deletion														.	GAACA	.	.																					212086960
INTS7	25896	.	GRCh37	1	212188060	212188061	+	Intron	INS	-	-	T	rs369061478		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.509+2167dup			ENST00000366994		3	.	3	0	.	0	INTS7,intron_variant,,ENST00000366992,;INTS7,intron_variant,,ENST00000366993,;INTS7,intron_variant,,ENST00000366994,NM_001199811.1,NM_015434.3,NM_001199812.1;INTS7,intron_variant,,ENST00000440600,NM_001199809.1;INTS7,intron_variant,,ENST00000469606,;INTS7,upstream_gene_variant,,ENST00000460867,;	T	ENSG00000143493	ENST00000366994	Transcript	intron_variant						rs369061478	1		-1	INTS7	HGNC	24484	protein_coding	YES	CCDS1501.1	ENSP00000355961	Q9NVH2		UPI000006FE2E	NM_001199811.1,NM_015434.3,NM_001199812.1				4/19			0.0439	0.2695		0.254	0.4264	0.3671										MODIFIER	1	insertion														.	TAT	.	.																					212188060
TATDN3	128387	.	GRCh37	1	212970082	212970082	+	Intron	DEL	T	T	-	rs76166503		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.173+159del			ENST00000532324		6	.	6	0	.	0	TATDN3,intron_variant,,ENST00000366973,;TATDN3,intron_variant,,ENST00000366974,NM_001042553.2,NM_001146171.1,NM_001146169.1,NM_001042552.2;TATDN3,intron_variant,,ENST00000488246,;TATDN3,intron_variant,,ENST00000526641,NM_001146170.1;TATDN3,intron_variant,,ENST00000526997,;TATDN3,intron_variant,,ENST00000530399,;TATDN3,intron_variant,,ENST00000530441,;TATDN3,intron_variant,,ENST00000531963,;TATDN3,intron_variant,,ENST00000532324,;NSL1,upstream_gene_variant,,ENST00000366975,;NSL1,upstream_gene_variant,,ENST00000366976,;NSL1,upstream_gene_variant,,ENST00000366977,NM_015471.3;NSL1,upstream_gene_variant,,ENST00000422588,NM_001042549.1;TATDN3,upstream_gene_variant,,ENST00000606486,;TATDN3,intron_variant,,ENST00000497768,;TATDN3,intron_variant,,ENST00000525569,;TATDN3,intron_variant,,ENST00000530392,;NSL1,upstream_gene_variant,,ENST00000487995,;TATDN3,non_coding_transcript_exon_variant,,ENST00000532433,;TATDN3,intron_variant,,ENST00000525574,;TATDN3,intron_variant,,ENST00000533650,;	-	ENSG00000203705	ENST00000532324	Transcript	intron_variant						rs76166503	1		1	TATDN3	HGNC	27010	protein_coding	YES	CCDS53475.1	ENSP00000431376	Q17R31		UPI0000205E43					3/9			0.3222	0.1037		0.252	0.1481	0.2076										MODIFIER	1	deletion														.	CCTT	.	.																					212970081
Unknown	0	.	GRCh37	1	213575825	213575826	+	IGR	INS	-	-	TA	rs3085101		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		TA				intergenic_variant						rs3085101	1																				0.6225	0.879		0.9891	0.836	0.8967										MODIFIER	1	insertion														.	TTG	.	.																					213575825
PROX1	5629	.	GRCh37	1	214159851	214159852	+	5'Flank	INS	-	-	GT	rs35146556		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000366958		5	.	5	0	.	0	PROX1,intron_variant,,ENST00000471129,;PROX1,upstream_gene_variant,,ENST00000366958,NM_001270616.1;PROX1,upstream_gene_variant,,ENST00000435016,NM_002763.4;PROX1,upstream_gene_variant,,ENST00000498508,;PROX1,upstream_gene_variant,,ENST00000607425,;PROX1-AS1,intron_variant,,ENST00000598091,;PROX1-AS1,upstream_gene_variant,,ENST00000451396,;PROX1,upstream_gene_variant,,ENST00000607726,;,regulatory_region_variant,,ENSR00001512609,;	GT	ENSG00000117707	ENST00000366958	Transcript	upstream_gene_variant						rs35146556	1	1434	1	PROX1	HGNC	9459	protein_coding	YES	CCDS31021.1	ENSP00000355925	Q92786	U3KPY6,C9JU29,B4DP41	UPI0000071D14	NM_001270616.1							0.2231	0.4885		0.5437	0.496	0.5348										MODIFIER	1	insertion														.	GAG	.	.																					214159851
KCNK2	3776	.	GRCh37	1	215398566	215398566	+	Intron	DEL	G	G	-	rs55750248		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.964-9604del			ENST00000444842		6	.	6	0	.	0	KCNK2,intron_variant,,ENST00000391894,;KCNK2,intron_variant,,ENST00000391895,NM_001017424.2;KCNK2,intron_variant,,ENST00000444842,NM_014217.3,NM_001017425.2;KCNK2,intron_variant,,ENST00000467031,;KCNK2,intron_variant,,ENST00000474771,;KCNK2,intron_variant,,ENST00000486921,;	-	ENSG00000082482	ENST00000444842	Transcript	intron_variant						rs55750248	1		1	KCNK2	HGNC	6277	protein_coding	YES	CCDS41467.1	ENSP00000394033	O95069	C9JXY2,C9JDK1	UPI000013D4B8	NM_014217.3,NM_001017425.2				6/6			0.3684	0.1398		0.0804	0.1928	0.1155										MODIFIER	1	deletion														.	TTGG	.	.																					215398565
EPRS	2058	.	GRCh37	1	220224557	220224557	+	5'Flank	DEL	A	A	-	rs749407537		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000366923		4	.	4	0	.	0	EPRS,upstream_gene_variant,,ENST00000366923,NM_004446.2;EPRS,upstream_gene_variant,,ENST00000609181,;EPRS,upstream_gene_variant,,ENST00000477030,;	-	ENSG00000136628	ENST00000366923	Transcript	upstream_gene_variant						rs749407537	1	4557	-1	EPRS	HGNC	3418	protein_coding	YES	CCDS31027.1	ENSP00000355890	P07814		UPI0000205E8C	NM_004446.2																						MODIFIER	1	deletion													1	.	CTAA	.	.																					220224556
ENSR00001513538	0	.	GRCh37	1	223235630	223235631	+	IGR	INS	-	-	G	rs75853898		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001513538		6	.	3	1	.	0	,regulatory_region_variant,,ENSR00001513538,;	G		ENSR00001513538	RegulatoryFeature	regulatory_region_variant						rs75853898	1																				0.264	0.3228		0.2748	0.3579	0.3793										MODIFIER	1	insertion														.	ATG	.	.																					223235630
CAPN8	388743	.	GRCh37	1	223826063	223826064	+	Intron	DEL	GT	GT	-	rs34370642		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																c.308-9582_308-9581del			ENST00000366872		3	.	3	0	.	0	CAPN8,intron_variant,,ENST00000366872,;CAPN8,intron_variant,,ENST00000366873,;CAPN8,intron_variant,,ENST00000419193,NM_001143962.1;CAPN8,intron_variant,,ENST00000467384,;	-	ENSG00000203697	ENST00000366872	Transcript	intron_variant						rs34370642	1		-1	CAPN8	HGNC	1485	protein_coding	YES		ENSP00000355837	A6NHC0		UPI0001AE7978					2/19																		MODIFIER	1	deletion														.	GGGTG	.	.																					223826062
CAPN2	824	.	GRCh37	1	223962514	223962515	+	Intron	INS	-	-	T	rs533089157		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2080-22dup			ENST00000295006		55	.	12	34	.	0	CAPN2,intron_variant,,ENST00000295006,NM_001748.4;CAPN2,intron_variant,,ENST00000433674,NM_001146068.1;CAPN2,intron_variant,,ENST00000463997,;CAPN2,intron_variant,,ENST00000474026,;CAPN2,intron_variant,,ENST00000487223,;CAPN2,downstream_gene_variant,,ENST00000472601,;CAPN2,downstream_gene_variant,,ENST00000492664,;CAPN2,downstream_gene_variant,,ENST00000498027,;,regulatory_region_variant,,ENSR00000961642,;	TT	ENSG00000162909	ENST00000295006	Transcript	intron_variant						rs533089157	1		1	CAPN2	HGNC	1479	protein_coding	YES	CCDS31035.1	ENSP00000295006	P17655		UPI000059D0B9	NM_001748.4				20/20									0.002345	0.003635								MODIFIER	1	sequence_alteration														.	ACTT	.	.												0.003013	0.001327	0.003802	0.001496	0.001562	0.002184	0.002865	0.004306	0.005596	223962513
Unknown	0	.	GRCh37	1	225858522	225858522	+	IGR	DEL	C	C	-	rs554945276		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					3	.	3	0	.	0		-				intergenic_variant						rs554945276	1																																			MODIFIER	1	deletion														.	TGCC	.	.																					225858521
PRSS38	339501	.	GRCh37	1	227998535	227998535	+	5'Flank	DEL	A	A	-	rs55865777		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000366757		3	.	3	0	.	0	PRSS38,upstream_gene_variant,,ENST00000366757,NM_183062.2;	-	ENSG00000185888	ENST00000366757	Transcript	upstream_gene_variant						rs55865777	1	4859	1	PRSS38	HGNC	29625	protein_coding	YES	CCDS1563.1	ENSP00000355719	A1L453		UPI00001BBB34	NM_183062.2							0.2156	0.1801		0.125	0.2485	0.1769										MODIFIER	1	deletion														.	TGAA	.	.																					227998534
RNF187	149603	.	GRCh37	1	228673071	228673071	+	5'Flank	DEL	T	T	-	rs11320436		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000305943		9	.	9	0	.	0	RNF187,upstream_gene_variant,,ENST00000305943,NM_001010858.2;RNF187,upstream_gene_variant,,ENST00000482739,;RNF187,upstream_gene_variant,,ENST00000484293,;	-	ENSG00000168159	ENST00000305943	Transcript	upstream_gene_variant						rs11320436	1	1691	1	RNF187	HGNC	27146	protein_coding	YES		ENSP00000306396	Q5TA31		UPI0000470B86	NM_001010858.2							0.9402	0.9265		1	0.8091	0.9049										MODIFIER	1	deletion														.	GCTT	.	.																					228673070
Unknown	0	.	GRCh37	1	229991220	229991221	+	IGR	INS	-	-	TG	rs5781554		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TG				intergenic_variant						rs5781554	1																				0.9039	0.6974		0.6101	0.5547	0.5481										MODIFIER	1	insertion														.	AAT	.	.																					229991220
Unknown	0	.	GRCh37	1	230588349	230588349	+	IGR	DEL	C	C	-	rs11288302		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					5	.	5	0	.	0		-				intergenic_variant						rs11288302	1																				0.1694	0.4914		0.379	0.4056	0.1943										MODIFIER	1	deletion														.	CACC	.	.																					230588348
PCNXL2	80003	.	GRCh37	1	233137226	233137229	+	Intron	DEL	ATAA	-	-	rs4027365		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATAA	ATAA																c.5097+54_5097+57del			ENST00000258229		8	.	3	4	.	0	PCNXL2,intron_variant,,ENST00000258229,NM_014801.3;PCNXL2,intron_variant,,ENST00000344698,;PCNXL2,intron_variant,,ENST00000462233,;PCNXL2,upstream_gene_variant,,ENST00000497623,;	-	ENSG00000135749	ENST00000258229	Transcript	intron_variant						rs4027365	1		-1	PCNXL2	HGNC	8736	protein_coding	YES	CCDS44335.1	ENSP00000258229	A6NKB5	B3KNZ5	UPI0000F58F23	NM_014801.3				29/33			0.9531	0.9251		0.9117	0.9463	0.9151										MODIFIER	1	deletion														.	TCATAAA	.	.																					233137225
Unknown	0	.	GRCh37	1	238618799	238618800	+	IGR	INS	-	-	AT	rs1201803204		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AT				intergenic_variant						rs1201803204	1																																			MODIFIER	1	insertion														.	CCA	.	.																					238618799
RGS7	6000	.	GRCh37	1	240942804	240942804	+	Intron	DEL	A	A	-	rs35230381		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1414-3291del			ENST00000366565		4	.	4	0	.	0	RGS7,intron_variant,,ENST00000331110,;RGS7,intron_variant,,ENST00000348120,NM_001282773.1;RGS7,intron_variant,,ENST00000366562,;RGS7,intron_variant,,ENST00000366563,NM_001282775.1;RGS7,intron_variant,,ENST00000366564,NM_001282778.1;RGS7,intron_variant,,ENST00000366565,NM_002924.4;RGS7,intron_variant,,ENST00000440928,;RGS7,intron_variant,,ENST00000446183,;	-	ENSG00000182901	ENST00000366565	Transcript	intron_variant						rs35230381	1		-1	RGS7	HGNC	10003	protein_coding	YES	CCDS31071.1	ENSP00000355523	P49802		UPI000040E182	NM_002924.4				17/17		0.2165	0.5197	0.1009		0.124	0.1133	0.09										MODIFIER	1	deletion													1	.	CCAG	.	.																					240942803
WDR64	128025	.	GRCh37	1	241950968	241950968	+	Intron	DEL	A	A	-	rs58063137		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.2676-167del			ENST00000366552		10	.	3	12	.	0	WDR64,intron_variant,,ENST00000366552,NM_144625.4;WDR64,intron_variant,,ENST00000414635,;WDR64,intron_variant,,ENST00000425826,;WDR64,intron_variant,,ENST00000437684,;WDR64,intron_variant,,ENST00000468967,;WDR64,intron_variant,,ENST00000472717,;WDR64,intron_variant,,ENST00000478331,;	-	ENSG00000162843	ENST00000366552	Transcript	intron_variant						rs58063137	1		1	WDR64	HGNC	26570	protein_coding	YES		ENSP00000355510	B1ANS9	D6RCR1	UPI0000519142	NM_144625.4				22/26																		MODIFIER	1	deletion														.	TCAA	.	.																					241950967
BECN1P1	0	.	GRCh37	1	242116811	242116811	+	5'Flank	DEL	A	A	-	rs71570920		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000356052		5	.	5	0	.	0	BECN1P1,upstream_gene_variant,,ENST00000356052,;BECN1P1,upstream_gene_variant,,ENST00000419583,;	-	ENSG00000196289	ENST00000356052	Transcript	upstream_gene_variant						rs71570920	1	4231	1	BECN1P1	HGNC	38606	processed_pseudogene	YES												0.2947	0.3026	0.3271		0.244	0.3459	0.2607										MODIFIER	1	deletion														.	CTAT	.	.																					242116810
PLD5	200150	.	GRCh37	1	242396456	242396457	+	Intron	INS	-	-	AATG	rs55916345		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.608-13043_608-13040dup			ENST00000536534		7	.	7	0	.	0	PLD5,intron_variant,,ENST00000427495,NM_001195811.1,NM_001195812.1;PLD5,intron_variant,,ENST00000442594,NM_152666.2;PLD5,intron_variant,,ENST00000536534,;PLD5,downstream_gene_variant,,ENST00000474177,;PLD5,intron_variant,,ENST00000314833,;PLD5,intron_variant,,ENST00000366545,;PLD5,intron_variant,,ENST00000467561,;	AATG	ENSG00000180287	ENST00000536534	Transcript	intron_variant						rs55916345	1		-1	PLD5	HGNC	26879	protein_coding	YES	CCDS1621.2	ENSP00000440896	Q8N7P1	J3KP61	UPI000040E1A4					4/9																		MODIFIER	1	insertion														.	CAA	.	.																					242396456
PLD5	200150	.	GRCh37	1	242470115	242470116	+	Intron	INS	-	-	T	rs34920004		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.327-18284dup			ENST00000536534		3	.	3	0	.	0	PLD5,intron_variant,,ENST00000427495,NM_001195811.1,NM_001195812.1;PLD5,intron_variant,,ENST00000442594,NM_152666.2;PLD5,intron_variant,,ENST00000459864,;PLD5,intron_variant,,ENST00000536534,;PLD5,intron_variant,,ENST00000314833,;PLD5,intron_variant,,ENST00000366545,;PLD5,intron_variant,,ENST00000467561,;	T	ENSG00000180287	ENST00000536534	Transcript	intron_variant						rs34920004	1		-1	PLD5	HGNC	26879	protein_coding	YES	CCDS1621.2	ENSP00000440896	Q8N7P1	J3KP61	UPI000040E1A4					2/9			0.8865	0.9438		0.9593	0.9046	0.9376										MODIFIER	1	insertion														.	TCT	.	.																					242470115
Unknown	0	.	GRCh37	1	242796694	242796695	+	IGR	INS	-	-	TAT	rs55937230		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	3	4	.	0		TAT				intergenic_variant						rs55937230	1																				0.0076	0.0375			0.0477	0.0245										MODIFIER	1	insertion														.	TGT	.	.																					242796694
SMYD3	64754	.	GRCh37	1	246375887	246375888	+	Intron	INS	-	-	A	rs35077215		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.531+114615_531+114616insT			ENST00000388985		6	.	3	4	.	0	SMYD3,intron_variant,,ENST00000388985,;SMYD3,intron_variant,,ENST00000453676,;SMYD3,intron_variant,,ENST00000490107,NM_001167740.1;SMYD3,intron_variant,,ENST00000541742,NM_022743.2;SMYD3,intron_variant,,ENST00000462422,;SMYD3,intron_variant,,ENST00000492487,;	A	ENSG00000185420	ENST00000388985	Transcript	intron_variant						rs35077215	1		-1	SMYD3	HGNC	15513	protein_coding	YES	CCDS53486.1	ENSP00000373637	Q9H7B4	B3KN46,B0QZA0,B0QZ99,A8MXR1	UPI000022AFDA					5/11		0.2228	0.1286	0.3199		0.3562	0.1441	0.2249										MODIFIER	1	insertion														.	CCG	.	.																					246375887
RP11-488L18.10	0	.	GRCh37	1	247348801	247348802	+	3'Flank	DEL	TC	TC	-	rs67409799		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TC	TC																			ENST00000566446		13	.	3	7	.	0	RP11-488L18.10,downstream_gene_variant,,ENST00000566446,;RP11-488L18.3,upstream_gene_variant,,ENST00000400933,;MIR3916,downstream_gene_variant,,ENST00000421406,;MIR3916,downstream_gene_variant,,ENST00000452874,;	-	ENSG00000259865	ENST00000566446	Transcript	downstream_gene_variant						rs67409799	1	1781	-1	RP11-488L18.10	Clone_based_vega_gene		lincRNA	YES																												MODIFIER		deletion														.	TTTCT	.	.																					247348800
OR1C1	26188	.	GRCh37	1	247920509	247920510	+	3'Flank	DEL	TA	TA	-	rs35325984		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TA	TA																			ENST00000408896		6	.	3	7	.	0	OR1C1,downstream_gene_variant,,ENST00000408896,NM_012353.2;	-	ENSG00000221888	ENST00000408896	Transcript	downstream_gene_variant						rs35325984	1	166	-1	OR1C1	HGNC	8182	protein_coding	YES	CCDS41481.1	ENSP00000386138	Q15619		UPI000004B1DC	NM_012353.2							0.5575	0.9236		0.9851	0.9592	0.8793										MODIFIER	1	deletion														.	ACTAT	.	.																					247920508
LINC01115	339822	.	GRCh37	2	849913	849914	+	Intron	DEL	GG	GG	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GG	GG																n.310-18_310-17del			ENST00000414556		4	.	4	0	.	0	LINC01115,intron_variant,,ENST00000414556,;LINC01115,intron_variant,,ENST00000415700,;,regulatory_region_variant,,ENSR00001614300,;,regulatory_region_variant,,ENSR00001614301,;	-	ENSG00000237667	ENST00000414556	Transcript	intron_variant,non_coding_transcript_variant							1		-1	LINC01115	HGNC	49258	lincRNA	YES										1/3																		MODIFIER	1	deletion														.	AAGGG	.	.																					849912
SNTG2	54221	.	GRCh37	2	1292271	1292272	+	Intron	DEL	CA	-	-	rs56238543		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CA	CA																c.1285-19989_1285-19988del			ENST00000308624		6	.	0	4	.	4	SNTG2,intron_variant,,ENST00000308624,NM_018968.3;SNTG2,intron_variant,,ENST00000407292,;SNTG2,intron_variant,,ENST00000471239,;	-	ENSG00000172554	ENST00000308624	Transcript	intron_variant						rs56238543	1		1	SNTG2	HGNC	13741	protein_coding	YES	CCDS46220.1	ENSP00000311837	Q9NY99		UPI0000456D73	NM_018968.3				14/16			0.1528	0.3329		0.2798	0.3728	0.3067										MODIFIER	1	deletion														.	TTCAC	.	.																					1292270
Unknown	0	.	GRCh37	2	2423265	2423265	+	IGR	DEL	T	T	-	rs34142183		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs34142183	1																				0.1505	0.3199		0.2688	0.5169	0.3722										MODIFIER	1	deletion														.	GATT	.	.																					2423264
Unknown	0	.	GRCh37	2	3854136	3854136	+	IGR	DEL	T	T	-	rs34504660		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	4	0	.	0		-				intergenic_variant						rs34504660	1																				0.6831	0.6801		0.9018	0.6362	0.7761										MODIFIER	1	deletion														.	TCTT	.	.																					3854135
Unknown	0	.	GRCh37	2	3863612	3863613	+	IGR	INS	-	-	TAAC	rs145376684		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	3	2	.	0		TAAC				intergenic_variant						rs145376684	1																				0.0166	0.0836		0.0139	0.1859	0.1002										MODIFIER	1	insertion														.	GAT	.	.																					3863612
Unknown	0	.	GRCh37	2	4580016	4580017	+	IGR	DEL	GA	GA	-	rs763169311		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GA	GA																					3	.	3	0	.	0		-				intergenic_variant						rs763169311	1																																			MODIFIER	1	deletion														.	GTGAG	.	.																					4580015
AC021021.2	0	.	GRCh37	2	6640529	6640530	+	Intron	DEL	AC	AC	-	rs35309858		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																n.251-2320_251-2319del			ENST00000436082		7	.	3	2	.	0	AC021021.2,intron_variant,,ENST00000436082,;AC021021.1,upstream_gene_variant,,ENST00000454229,;	-	ENSG00000226488	ENST00000436082	Transcript	intron_variant,non_coding_transcript_variant						rs35309858	1		1	AC021021.2	Clone_based_vega_gene		lincRNA	YES										1/2			0.2511	0.5548		0.4821	0.5308	0.5757										MODIFIER	1	deletion														.	ATACA	.	.																					6640528
Unknown	0	.	GRCh37	2	10700547	10700552	+	IGR	DEL	CCAGCC	CCAGCC	-	rs61032112		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCAGCC	CCAGCC																					6	.	6	4	.	0		-				intergenic_variant						rs61032112	1																				0.1566	0.2277		0.1885	0.3777	0.2853										MODIFIER	1	deletion														.	TGCCAGCCC	.	.																					10700546
ENSR00000289735	0	.	GRCh37	2	11040691	11040692	+	IGR	INS	-	-	G	rs386389530		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00000289735		5	.	5	0	.	0	,regulatory_region_variant,,ENSR00000289735,;,regulatory_region_variant,,ENSR00001168169,;	G		ENSR00000289735	RegulatoryFeature	regulatory_region_variant						rs386389530	1																				0.0756	0.3473		0.3611	0.5646	0.3354										MODIFIER	1	insertion														.	TTG	.	.																					11040691
GREB1	9687	.	GRCh37	2	11678736	11678787	+	Intron	DEL	TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC	TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC	-	rs66497558		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC	TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC																c.-162+4384_-162+4435del			ENST00000381486		3	.	3	0	.	0	GREB1,intron_variant,,ENST00000381486,NM_014668.3;GREB1,upstream_gene_variant,,ENST00000263834,NM_148903.2;GREB1,upstream_gene_variant,,ENST00000381483,NM_033090.2;GREB1,upstream_gene_variant,,ENST00000389825,;MIR4429,downstream_gene_variant,,ENST00000580105,;	-	ENSG00000196208	ENST00000381486	Transcript	intron_variant						rs66497558	1		1	GREB1	HGNC	24885	protein_coding	YES	CCDS42655.1	ENSP00000370896	Q4ZG55		UPI0000163937	NM_014668.3				1/32																		MODIFIER	1	deletion														.	TGTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	.	.																					11678735
MIR4262	100422996	.	GRCh37	2	11976013	11976014	+	3'Flank	INS	-	-	T	rs34989285		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000578394		3	.	3	0	.	0	MIR4262,downstream_gene_variant,,ENST00000578394,;	T	ENSG00000265172	ENST00000578394	Transcript	downstream_gene_variant						rs34989285	1	1045	-1	MIR4262	HGNC	38308	miRNA	YES													0.0454	0.2666		0.0446	0.4145	0.2628										MODIFIER	1	insertion														.	TGT	.	.																					11976013
AC096559.1	100506457	.	GRCh37	2	12370907	12370908	+	Intron	INS	-	-	A	rs34884472		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.315+63940dup			ENST00000412294		4	.	4	0	.	0	AC096559.1,intron_variant,,ENST00000412294,;AC096559.1,intron_variant,,ENST00000438292,;	A	ENSG00000224184	ENST00000412294	Transcript	intron_variant,non_coding_transcript_variant						rs34884472	1		1	AC096559.1	Clone_based_vega_gene		lincRNA	YES										3/5			0.5424	0.1037		0.0456	0.1302	0.1585										MODIFIER	1	insertion														.	ATA	.	.																					12370907
AC096559.1	100506457	.	GRCh37	2	12577342	12577343	+	Intron	INS	-	-	TG	rs34645282		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.413-120956_413-120955dup			ENST00000412294		3	.	3	0	.	0	AC096559.1,intron_variant,,ENST00000412294,;AC096559.1,intron_variant,,ENST00000412606,;,regulatory_region_variant,,ENSR00001615618,;	TG	ENSG00000224184	ENST00000412294	Transcript	intron_variant,non_coding_transcript_variant						rs34645282	1		1	AC096559.1	Clone_based_vega_gene		lincRNA	YES										4/5																		MODIFIER	1	insertion														.	TAT	.	.																					12577342
AC008271.1	101926966	.	GRCh37	2	15865924	15865925	+	Intron	INS	-	-	G	rs35632910		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.283-17684dup			ENST00000436967		6	.	6	0	.	0	AC008271.1,intron_variant,,ENST00000436967,;	G	ENSG00000231031	ENST00000436967	Transcript	intron_variant						rs35632910	1		1	AC008271.1	Clone_based_vega_gene		protein_coding	YES		ENSP00000399192			UPI000173A3E9					2/3			0.3903	0.5072		0.2649	0.4761	0.547										MODIFIER	1	insertion														.	GAG	.	.																					15865924
Unknown	0	.	GRCh37	2	19006827	19006828	+	IGR	INS	-	-	CA	rs66707718		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		CA				intergenic_variant						rs66707718	1																				0.7277	0.7349		0.8938	0.7584	0.8712										MODIFIER	1	insertion														.	TGC	.	.																					19006827
Unknown	0	.	GRCh37	2	19722695	19722696	+	IGR	INS	-	-	CCC	rs5829703		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		CCC				intergenic_variant						rs5829703	1																				0.2398	0.3905		0.1994	0.494	0.4407										MODIFIER	1	insertion														.	GAC	.	.																					19722695
Unknown	0	.	GRCh37	2	19750374	19750387	+	IGR	DEL	TGGGTAAGACAGGC	TGGGTAAGACAGGC	-	rs67622352		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGGGTAAGACAGGC	TGGGTAAGACAGGC																					4	.	4	0	.	0		-				intergenic_variant						rs67622352	1																			0.0573	0.1513	0.036			0.0457	0.0164										MODIFIER	1	deletion														.	AATGGGTAAGACAGGCA	.	.																					19750373
AC067959.1	0	.	GRCh37	2	21784677	21784679	+	Intron	DEL	TTG	TTG	-	rs140656890		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTG	TTG																n.193+32576_193+32578del			ENST00000435237		4	.	4	0	.	0	AC067959.1,intron_variant,,ENST00000435237,;AC011752.1,downstream_gene_variant,,ENST00000451476,;	-	ENSG00000233005	ENST00000435237	Transcript	intron_variant,non_coding_transcript_variant						rs140656890	1		1	AC067959.1	Clone_based_vega_gene		lincRNA											3/5			0.6331	0.9092		0.8075	0.9334	0.9458										MODIFIER	1	deletion														.	TTTTGT	.	.																					21784676
ADCY3	109	.	GRCh37	2	25104680	25104681	+	Intron	DEL	GT	GT	-	rs3037312		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																c.676-9093_676-9092del			ENST00000260600		5	.	3	3	.	0	ADCY3,intron_variant,,ENST00000260600,NM_004036.3;ADCY3,intron_variant,,ENST00000435135,;ADCY3,upstream_gene_variant,,ENST00000433852,;,regulatory_region_variant,,ENSR00000383672,;,regulatory_region_variant,,ENSR00001171087,;	-	ENSG00000138031	ENST00000260600	Transcript	intron_variant						rs3037312	1		-1	ADCY3	HGNC	234	protein_coding	YES	CCDS1715.1	ENSP00000260600	O60266	Q8NBM1,C9J969	UPI000013D0ED	NM_004036.3				1/20			0.3971	0.2752		0.4792	0.3877	0.4274										MODIFIER	1	deletion														.	CAGTG	.	.																					25104679
DTNB	1838	.	GRCh37	2	25788482	25788482	+	Intron	DEL	T	T	-	rs5829980		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.876+11225del			ENST00000406818		4	.	4	0	.	0	DTNB,intron_variant,,ENST00000288642,;DTNB,intron_variant,,ENST00000404103,NM_033147.3;DTNB,intron_variant,,ENST00000405222,NM_183361.2;DTNB,intron_variant,,ENST00000406818,NM_001256303.1,NM_021907.4;DTNB,intron_variant,,ENST00000407038,NM_033148.3;DTNB,intron_variant,,ENST00000407186,;DTNB,intron_variant,,ENST00000407661,NM_183360.2,NM_001256304.1;DTNB,intron_variant,,ENST00000496972,NM_001256308.1;DTNB,intron_variant,,ENST00000545439,;DTNB,intron_variant,,ENST00000356599,;DTNB,intron_variant,,ENST00000398951,;DTNB,intron_variant,,ENST00000485845,;,regulatory_region_variant,,ENSR00001616863,;	-	ENSG00000138101	ENST00000406818	Transcript	intron_variant						rs5829980	1		-1	DTNB	HGNC	3058	protein_coding	YES	CCDS46237.1	ENSP00000384084	O60941	Q53TC8,Q53T51,Q53SF9,Q53QV1,F8W9U0,E9PE76,E7ES64	UPI0000129949	NM_001256303.1,NM_021907.4				8/20			0.5998	0.3098		0.4534	0.2366	0.2393										MODIFIER	1	deletion														.	CATT	.	.																					25788481
OTOF	9381	.	GRCh37	2	26748998	26748999	+	Intron	INS	-	-	GGA	rs70950195		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.227+1699_227+1701dup			ENST00000272371		5	.	4	3	.	0	OTOF,intron_variant,,ENST00000272371,NM_194248.2;OTOF,intron_variant,,ENST00000403946,NM_001287489.1;	GGA	ENSG00000115155	ENST00000272371	Transcript	intron_variant						rs70950195	1		-1	OTOF	HGNC	8515	protein_coding	YES	CCDS1725.1	ENSP00000272371	Q9HC10		UPI000013D94D	NM_194248.2				3/46			0.2837	0.8228		0.7143	0.8618	0.865										MODIFIER	1	insertion													1	.	ATG	.	.																					26748998
BRE	9577	.	GRCh37	2	28443979	28443982	+	Intron	DEL	CTCT	CTCT	-	rs72394956		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTCT	CTCT																c.681-16073_681-16070del			ENST00000344773		3	.	3	0	.	0	BRE,intron_variant,,ENST00000342045,NM_199194.2;BRE,intron_variant,,ENST00000344773,NM_004899.4;BRE,intron_variant,,ENST00000361704,NM_199192.2;BRE,intron_variant,,ENST00000379624,NM_001261840.1,NM_199191.2;BRE,intron_variant,,ENST00000379629,;BRE,intron_variant,,ENST00000379632,NM_199193.2;	-	ENSG00000158019	ENST00000344773	Transcript	intron_variant						rs72394956	1		1	BRE	HGNC	1106	protein_coding	YES	CCDS1764.1	ENSP00000343412	Q9NXR7	C9J2G0	UPI0000072A9C	NM_004899.4				7/12			0.208	0.098		0.006	0.1918	0.1074										MODIFIER	1	deletion														.	TCCTCTC	.	.																					28443978
FOSL2	2355	.	GRCh37	2	28628596	28628596	+	Intron	DEL	G	G	-	rs11340945		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.354+1374del			ENST00000264716		3	.	3	0	.	0	FOSL2,intron_variant,,ENST00000264716,NM_005253.3;FOSL2,intron_variant,,ENST00000379619,;FOSL2,intron_variant,,ENST00000436647,;FOSL2,intron_variant,,ENST00000545753,;FOSL2,intron_variant,,ENST00000460736,;,regulatory_region_variant,,ENSR00001617286,;	-	ENSG00000075426	ENST00000264716	Transcript	intron_variant						rs11340945	1		1	FOSL2	HGNC	3798	protein_coding	YES	CCDS1766.1	ENSP00000264716	P15408	C9JCN8	UPI000004F8AB	NM_005253.3				2/3			0.2231	0.2233		0.1766	0.4006	0.4499										MODIFIER	1	deletion														.	TTGG	.	.																					28628595
SNRPGP7	0	.	GRCh37	2	28684317	28684322	+	5'Flank	DEL	CAGTAC	CAGTAC	-	rs55822322		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAGTAC	CAGTAC																			ENST00000469016		3	.	3	0	.	0	PLB1,intron_variant,,ENST00000416713,;SNRPGP7,upstream_gene_variant,,ENST00000469016,;,regulatory_region_variant,,ENSR00001617299,;	-	ENSG00000242915	ENST00000469016	Transcript	upstream_gene_variant						rs55822322	1	1089	-1	SNRPGP7	HGNC	39326	processed_pseudogene	YES													0.2511	0.4524		0.3095	0.5229	0.6145										MODIFIER	1	deletion														.	TACAGTACC	.	.																					28684316
AC009499.1	0	.	GRCh37	2	34106106	34106107	+	Intron	DEL	AT	AT	-	rs58877876		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																n.134+25286_134+25287del			ENST00000366209		3	.	3	0	.	0	AC009499.1,intron_variant,,ENST00000366209,;AC009499.1,intron_variant,,ENST00000442026,;	-	ENSG00000203386	ENST00000366209	Transcript	intron_variant,non_coding_transcript_variant						rs58877876	1		1	AC009499.1	Clone_based_vega_gene		lincRNA	YES										2/5		0.3043	0.1596	0.353		0.3125	0.3996	0.3589										MODIFIER	1	deletion														.	ACATG	.	.																					34106105
Unknown	0	.	GRCh37	2	35468231	35468232	+	IGR	INS	-	-	AA	rs72248337		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		AA				intergenic_variant						rs72248337	1																				0.587	0.696		0.9514	0.5447	0.8599										MODIFIER	1	insertion														.	ATA	.	.																					35468231
STRN	6801	.	GRCh37	2	37141133	37141133	+	Intron	DEL	T	T	-	rs887137743		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.412+2088del			ENST00000263918		3	.	3	0	.	0	STRN,intron_variant,,ENST00000263918,NM_003162.3;STRN,intron_variant,,ENST00000379213,;,regulatory_region_variant,,ENSR00000384067,;	-	ENSG00000115808	ENST00000263918	Transcript	intron_variant						rs887137743	1		-1	STRN	HGNC	11424	protein_coding	YES	CCDS1784.1	ENSP00000263918	O43815		UPI000013D48A	NM_003162.3				3/17																		MODIFIER	1	deletion													1	.	GATT	.	.																					37141132
SLC8A1	6546	.	GRCh37	2	40359906	40359906	+	Intron	DEL	T	T	-	rs147809272		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.2545+6635del			ENST00000403092		3	.	3	0	.	0	SLC8A1,intron_variant,,ENST00000332839,NM_021097.2;SLC8A1,intron_variant,,ENST00000402441,NM_001112802.1;SLC8A1,intron_variant,,ENST00000403092,;SLC8A1,intron_variant,,ENST00000405269,;SLC8A1,intron_variant,,ENST00000405901,NM_001112800.1;SLC8A1,intron_variant,,ENST00000406391,;SLC8A1,intron_variant,,ENST00000406785,;SLC8A1,intron_variant,,ENST00000408028,NM_001252624.1;SLC8A1,intron_variant,,ENST00000542024,;SLC8A1,intron_variant,,ENST00000542756,;SLC8A1-AS1,intron_variant,,ENST00000435515,;SLC8A1-AS1,intron_variant,,ENST00000444629,;SLC8A1-AS1,intron_variant,,ENST00000593848,;SLC8A1-AS1,intron_variant,,ENST00000593878,;SLC8A1-AS1,intron_variant,,ENST00000596532,;SLC8A1-AS1,intron_variant,,ENST00000597170,;SLC8A1-AS1,intron_variant,,ENST00000597385,;SLC8A1-AS1,intron_variant,,ENST00000598247,;SLC8A1-AS1,intron_variant,,ENST00000599268,;SLC8A1-AS1,intron_variant,,ENST00000599740,;SLC8A1-AS1,intron_variant,,ENST00000599956,;SLC8A1-AS1,intron_variant,,ENST00000601679,;SLC8A1,intron_variant,,ENST00000407929,;	-	ENSG00000183023	ENST00000403092	Transcript	intron_variant						rs147809272	1		-1	SLC8A1	HGNC	11068	protein_coding	YES	CCDS1806.1	ENSP00000384763	P32418	Q6LAJ9,Q6LAJ8,Q4QQH3,E9PCL8,E9PB98	UPI000012FC46					10/10		0.1088	0.2368	0.0865		0.0079	0.0984	0.0665										MODIFIER	1	deletion														.	AATA	.	.																					40359905
SLC8A1	6546	.	GRCh37	2	40414799	40414799	+	Intron	DEL	G	G	-	rs34653594		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.1809-9166del			ENST00000403092		3	.	3	0	.	0	SLC8A1,intron_variant,,ENST00000332839,NM_021097.2;SLC8A1,intron_variant,,ENST00000402441,NM_001112802.1;SLC8A1,intron_variant,,ENST00000403092,;SLC8A1,intron_variant,,ENST00000405269,;SLC8A1,intron_variant,,ENST00000405901,NM_001112800.1;SLC8A1,intron_variant,,ENST00000406391,;SLC8A1,intron_variant,,ENST00000406785,;SLC8A1,intron_variant,,ENST00000408028,NM_001252624.1;SLC8A1,intron_variant,,ENST00000542024,;SLC8A1,intron_variant,,ENST00000542756,;SLC8A1-AS1,intron_variant,,ENST00000435515,;SLC8A1-AS1,intron_variant,,ENST00000444629,;SLC8A1-AS1,intron_variant,,ENST00000593848,;SLC8A1-AS1,intron_variant,,ENST00000593878,;SLC8A1-AS1,intron_variant,,ENST00000596532,;SLC8A1-AS1,intron_variant,,ENST00000597170,;SLC8A1-AS1,intron_variant,,ENST00000597385,;SLC8A1-AS1,intron_variant,,ENST00000598247,;SLC8A1-AS1,intron_variant,,ENST00000599268,;SLC8A1-AS1,intron_variant,,ENST00000599740,;SLC8A1-AS1,intron_variant,,ENST00000599956,;SLC8A1-AS1,intron_variant,,ENST00000601679,;SLC8A1,intron_variant,,ENST00000407929,;	-	ENSG00000183023	ENST00000403092	Transcript	intron_variant						rs34653594	1		-1	SLC8A1	HGNC	11068	protein_coding	YES	CCDS1806.1	ENSP00000384763	P32418	Q6LAJ9,Q6LAJ8,Q4QQH3,E9PCL8,E9PB98	UPI000012FC46					2/10		0.1356	0.1528	0.2349		0.1627	0.0974	0.0532										MODIFIER	1	deletion														.	TTGT	.	.																					40414798
Unknown	0	.	GRCh37	2	41447665	41447665	+	IGR	DEL	A	A	-	rs10714182		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					6	.	3	3	.	0		-				intergenic_variant						rs10714182	1																				0.8631	0.6729		0.5179	0.6759	0.7536										MODIFIER	1	deletion														.	TTAA	.	.																					41447664
Unknown	0	.	GRCh37	2	41455736	41455737	+	IGR	INS	-	-	A	rs11443068		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	6	0	.	0		A				intergenic_variant						rs11443068	1																				0.7269	0.6657		0.5446	0.6819	0.7495										MODIFIER	1	insertion														.	ATA	.	.																					41455736
AC012354.6	0	.	GRCh37	2	45180422	45180422	+	5'Flank	DEL	C	C	-	rs5830817		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENST00000425325		3	.	3	0	.	0	AC012354.6,upstream_gene_variant,,ENST00000425325,;	-	ENSG00000225156	ENST00000425325	Transcript	upstream_gene_variant						rs5830817	1	1381	1	AC012354.6	Clone_based_vega_gene		lincRNA	YES																												MODIFIER	1	deletion														.	GGCC	.	.																					45180421
AC007682.1	730100	.	GRCh37	2	52513038	52513049	+	Intron	DEL	AAAAAAAAAAAA	AAAAAAAAAAAA	-	rs10527778		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAAAAAAAAAA	AAAAAAAAAAAA																n.880-30322_880-30311del			ENST00000440698		3	.	3	0	.	0	AC007682.1,intron_variant,,ENST00000440698,;	-	ENSG00000231918	ENST00000440698	Transcript	intron_variant,non_coding_transcript_variant						rs10527778	1		1	AC007682.1	Clone_based_vega_gene		lincRNA	YES										7/10																		MODIFIER	1	deletion														.	TCAAAAAAAAAAAAA	.	.																					52513037
AC010967.2	0	.	GRCh37	2	52971052	52971053	+	Intron	INS	-	-	TT	rs67773714		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.120-11139_120-11138dup			ENST00000421575		5	.	3	3	.	0	AC010967.2,intron_variant,,ENST00000421575,;AC010967.2,intron_variant,,ENST00000443237,;	TT	ENSG00000228033	ENST00000421575	Transcript	intron_variant,non_coding_transcript_variant						rs67773714	1		-1	AC010967.2	Clone_based_vega_gene		lincRNA	YES										2/4			0.1112	0.0692		0.001	0.1103	0.1043										MODIFIER	1	insertion														.	CAT	.	.																					52971052
Unknown	0	.	GRCh37	2	53226860	53226863	+	IGR	DEL	ATTT	ATTT	-	rs141425914		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATTT	ATTT																					4	.	4	0	.	0		-				intergenic_variant						rs141425914	1																				0.3654	0.1643		0.1052	0.1889	0.2301										MODIFIER	1	deletion														.	AAATTTA	.	.																					53226859
Unknown	0	.	GRCh37	2	57485831	57485832	+	IGR	INS	-	-	AATA	rs5831457		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	6	0	.	0		AATA				intergenic_variant						rs5831457	1																				0.6611	0.6484		0.7173	0.7038	0.6217										MODIFIER	1	insertion														.	TTA	.	.																					57485831
LINC01122	0	.	GRCh37	2	59219072	59219073	+	Intron	INS	-	-	A	rs11383630		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.816-11998dup			ENST00000452840		3	.	3	0	.	0	LINC01122,intron_variant,,ENST00000427421,;LINC01122,intron_variant,,ENST00000449448,;LINC01122,intron_variant,,ENST00000452840,;	A	ENSG00000233723	ENST00000452840	Transcript	intron_variant,non_coding_transcript_variant						rs11383630	1		1	LINC01122	HGNC	49267	lincRNA	YES										6/11			0.73	0.3487		0.3016	0.4076	0.5123										MODIFIER	1	insertion														.	CTA	.	.																					59219072
Unknown	0	.	GRCh37	2	59402220	59402225	+	IGR	DEL	CCGCTG	CCGCTG	-	rs11278170		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCGCTG	CCGCTG																					3	.	3	0	.	0		-				intergenic_variant						rs11278170	1																				0.8533	0.5533		0.7143	0.6481	0.6483										MODIFIER	1	deletion														.	TCCCGCTGC	.	.																					59402219
ENSR00001178401	0	.	GRCh37	2	60792434	60792434	+	IGR	DEL	T	T	-	rs145463538		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENSR00001178401		6	.	3	3	.	0	,regulatory_region_variant,,ENSR00001178401,;	-		ENSR00001178401	RegulatoryFeature	regulatory_region_variant						rs145463538	1																				0.0166	0.1455		0.005	0.2634	0.0603										MODIFIER	1	deletion														.	GATT	.	.																					60792433
Unknown	0	.	GRCh37	2	65102387	65102388	+	IGR	DEL	AA	AA	-	rs11294808		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																					4	.	4	0	.	0		-				intergenic_variant						rs11294808	1																																			MODIFIER	1	deletion														.	GCAAA	.	.																					65102386
RAB1A	5861	.	GRCh37	2	65325265	65325266	+	Intron	INS	-	-	A	rs199607937		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.97-65dup			ENST00000409784		8	.	8	0	.	0	RAB1A,intron_variant,,ENST00000260638,;RAB1A,intron_variant,,ENST00000356214,;RAB1A,intron_variant,,ENST00000398529,NM_015543.1;RAB1A,intron_variant,,ENST00000409751,;RAB1A,intron_variant,,ENST00000409784,NM_004161.4;RAB1A,intron_variant,,ENST00000409892,;RAB1A,intron_variant,,ENST00000494188,;	AA	ENSG00000138069	ENST00000409784	Transcript	intron_variant						rs199607937	1		-1	RAB1A	HGNC	9758	protein_coding	YES	CCDS46306.1	ENSP00000387286	P62820	Q96RD8,Q5U0I6	UPI0000001259	NM_004161.4				2/5																		MODIFIER	1	sequence_alteration														.	GGAA	.	.																					65325264
FBXO48	554251	.	GRCh37	2	68691329	68691329	+	3'UTR	DEL	T	T	-	rs755534404		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.*12del			ENST00000377957	4/4	195	.	108	149	.	144	FBXO48,3_prime_UTR_variant,,ENST00000377957,NM_001024680.1;APLF,upstream_gene_variant,,ENST00000303795,NM_173545.2;APLF,upstream_gene_variant,,ENST00000445692,;APLF,upstream_gene_variant,,ENST00000529851,;	-	ENSG00000204923	ENST00000377957	Transcript	3_prime_UTR_variant	888/5666					rs755534404	1		-1	FBXO48	HGNC	33857	protein_coding	YES	CCDS33213.1	ENSP00000367193	Q5FWF7		UPI00004C96E0	NM_001024680.1			4/4																			MODIFIER	1	sequence_alteration														.	GATT	.	.												4.013e-06						8.843e-06			68691328
LRRTM4	80059	.	GRCh37	2	77041031	77041032	+	Intron	INS	-	-	ATT	rs3055932		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1552-64992_1552-64990dup			ENST00000409093		3	.	3	0	.	0	LRRTM4,intron_variant,,ENST00000409093,;LRRTM4,intron_variant,,ENST00000409884,;LRRTM4,intron_variant,,ENST00000409911,NM_001282924.1,NM_001134745.1;	ATT	ENSG00000176204	ENST00000409093	Transcript	intron_variant						rs3055932	1		-1	LRRTM4	HGNC	19411	protein_coding	YES	CCDS46346.1	ENSP00000386357	Q86VH4	C9JM64	UPI0000047808					3/3			0.5893	0.611		0.744	0.3996	0.5307										MODIFIER	1	insertion														.	CAA	.	.																					77041031
ENSR00001622499	0	.	GRCh37	2	79227130	79227131	+	IGR	INS	-	-	ACAAATACCCA	rs67005065		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001622499		4	.	4	0	.	0	,regulatory_region_variant,,ENSR00001622499,;	ACAAATACCCA		ENSR00001622499	RegulatoryFeature	regulatory_region_variant						rs67005065	1																				0.5893	0.755		0.7937	0.659	0.7249										MODIFIER	1	insertion														.	GCA	.	.																					79227130
SFTPB	6439	.	GRCh37	2	85897400	85897400	+	5'Flank	DEL	T	T	-	rs34248947		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000393822		6	.	3	4	.	0	SFTPB,upstream_gene_variant,,ENST00000342375,NM_000542.3,NM_198843.2;SFTPB,upstream_gene_variant,,ENST00000393822,;SFTPB,upstream_gene_variant,,ENST00000409383,;SFTPB,upstream_gene_variant,,ENST00000428225,;SFTPB,upstream_gene_variant,,ENST00000519937,;SFTPB,upstream_gene_variant,,ENST00000473692,;	-	ENSG00000168878	ENST00000393822	Transcript	upstream_gene_variant						rs34248947	1	1536	-1	SFTPB	HGNC	10801	protein_coding	YES	CCDS1983.2	ENSP00000377409		D6W5L6	UPI0000421A06								0.7526	0.598		0.629	0.5825	0.6626										MODIFIER	1	deletion													1	.	TCTT	.	.																					85897399
PTCD3	55037	.	GRCh37	2	86369181	86369181	+	3'UTR	DEL	G	G	-	rs58330825		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.*4504del			ENST00000254630	24/24	4	.	4	0	.	0	PTCD3,3_prime_UTR_variant,,ENST00000254630,NM_017952.5;IMMT,downstream_gene_variant,,ENST00000254636,;IMMT,downstream_gene_variant,,ENST00000409051,;IMMT,downstream_gene_variant,,ENST00000410111,NM_001100169.1,NM_006839.2,NM_001100170.1;IMMT,downstream_gene_variant,,ENST00000419070,;IMMT,downstream_gene_variant,,ENST00000442664,;IMMT,downstream_gene_variant,,ENST00000449247,;,regulatory_region_variant,,ENSR00001183288,;	-	ENSG00000132300	ENST00000254630	Transcript	3_prime_UTR_variant	6635/6734					rs58330825	1		1	PTCD3	HGNC	24717	protein_coding	YES	CCDS33235.1	ENSP00000254630	Q96EY7		UPI0000208870	NM_017952.5			24/24				0.5545	0.8401		0.753	0.8489	0.8906										MODIFIER	1	deletion														.	AAGG	.	.																					86369180
ANKRD36BP2	645784	.	GRCh37	2	89083543	89083543	+	Intron	DEL	G	G	-	rs142584977		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																n.577-570del			ENST00000393525		16	.	5	17	.	0	ANKRD36BP2,intron_variant,,ENST00000393515,;ANKRD36BP2,intron_variant,,ENST00000393525,;ANKRD36BP2,downstream_gene_variant,,ENST00000421951,;ANKRD36BP2,intron_variant,,ENST00000575193,;	-	ENSG00000230006	ENST00000393525	Transcript	intron_variant,non_coding_transcript_variant						rs142584977	1		1	ANKRD36BP2	HGNC	33607	processed_transcript	YES										5/14																		MODIFIER	1	deletion														.	ATGG	.	.																					89083542
ANKRD36BP2	645784	.	GRCh37	2	89105282	89105282	+	Intron	DEL	G	G	-	rs1225469355		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																n.4899-347del			ENST00000393525		6	4	2	4	4	0	ANKRD36BP2,intron_variant,,ENST00000393515,;ANKRD36BP2,intron_variant,,ENST00000393525,;AC096579.13,downstream_gene_variant,,ENST00000452230,;ANKRD36BP2,non_coding_transcript_exon_variant,,ENST00000454490,;ANKRD36BP2,downstream_gene_variant,,ENST00000575193,;	-	ENSG00000230006	ENST00000393525	Transcript	intron_variant,non_coding_transcript_variant						rs1225469355	1		1	ANKRD36BP2	HGNC	33607	processed_transcript	YES										14/14																		MODIFIER	1	deletion														.	AAGG	.	.																					89105281
Unknown	0	.	GRCh37	2	89871441	89871442	+	IGR	INS	-	-	C	rs377041336		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					9	.	1	8	.	5		C				intergenic_variant						rs377041336	1																																			MODIFIER	1	insertion														.	ATT	.	.																					89871441
Unknown	0	.	GRCh37	2	90413338	90413339	+	IGR	INS	-	-	T	rs796235929		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs796235929	1																				0.4637	0.902		0.9187	0.9026	0.9376										MODIFIER	1	insertion														.	CCG	.	.																					90413338
Unknown	0	.	GRCh37	2	90417245	90417247	+	IGR	DEL	GAG	GAG	-	rs1213758606		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAG	GAG																					6	4	2	4	4	0		-				intergenic_variant						rs1213758606	1																																			MODIFIER	1	deletion														.	ATGAGG	.	.																					90417244
AC116050.1	0	.	GRCh37	2	91793868	91793868	+	Intron	DEL	C	C	-	rs112963259		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																n.542-1649del			ENST00000443031		13	.	8	10	.	10	AC116050.1,intron_variant,,ENST00000443031,;	-	ENSG00000233991	ENST00000443031	Transcript	intron_variant,non_coding_transcript_variant						rs112963259	1		1	AC116050.1	Clone_based_vega_gene		unprocessed_pseudogene	YES										2/4																		MODIFIER	1	deletion														.	GTCC	.	.																					91793867
AC027612.6	654342	.	GRCh37	2	91822551	91822552	+	3'Flank	INS	-	-	A	rs113222391		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000544283		5	.	5	0	.	0	AC027612.6,intron_variant,,ENST00000608501,;AC027612.6,intron_variant,,ENST00000609777,;AC027612.6,downstream_gene_variant,,ENST00000544283,;AC027612.6,downstream_gene_variant,,ENST00000608018,;AC027612.6,downstream_gene_variant,,ENST00000271699,;,regulatory_region_variant,,ENSR00001184173,;	A	ENSG00000143429	ENST00000544283	Transcript	downstream_gene_variant						rs113222391	1	714	-1	AC027612.6	Clone_based_vega_gene		processed_transcript	YES													0.4047	0.5115		0.505	0.5169	0.5245										MODIFIER	1	insertion														.	AGA	.	.																					91822551
ENSR00001623455	0	.	GRCh37	2	95729185	95729186	+	IGR	INS	-	-	T	rs56106066		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001623455		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001623455,;	T		ENSR00001623455	RegulatoryFeature	regulatory_region_variant						rs56106066	1																				0.4274	0.3862		0.381	0.5189	0.5235										MODIFIER	1	insertion														.	AAT	.	.																					95729185
ANKRD36C	0	.	GRCh37	2	96526347	96526348	+	Intron	INS	-	-	AA	rs75959480		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.764-526_764-525insTT			ENST00000419039		8	4	4	4	4	0	ANKRD36C,intron_variant,,ENST00000419039,;ANKRD36C,intron_variant,,ENST00000420871,;ANKRD36C,intron_variant,,ENST00000456556,;ANKRD36C,intron_variant,,ENST00000531153,;ANKRD36C,intron_variant,,ENST00000534304,;ANKRD36C,upstream_gene_variant,,ENST00000488721,;	AA	ENSG00000174501	ENST00000419039	Transcript	intron_variant						rs75959480	1		-1	ANKRD36C	HGNC	32946	protein_coding			ENSP00000407838		I1Z9D5,I1Z9D4,I1Z9D3,I1Z9D2,F8WEX4	UPI0002065901					52/57																		MODIFIER		insertion														.	ACT	.	.																					96526347
VWA3B	200403	.	GRCh37	2	98902743	98902753	+	Intron	DEL	TACTGGCTAGA	TACTGGCTAGA	-	rs151031310		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TACTGGCTAGA	TACTGGCTAGA																c.3046-4231_3046-4221del			ENST00000477737		3	.	3	0	.	0	VWA3B,intron_variant,,ENST00000473149,;VWA3B,intron_variant,,ENST00000477737,NM_144992.4;VWA3B,intron_variant,,ENST00000490947,;VWA3B,intron_variant,,ENST00000409460,;VWA3B,intron_variant,,ENST00000432242,;VWA3B,intron_variant,,ENST00000489630,;VWA3B,intron_variant,,ENST00000495571,;	-	ENSG00000168658	ENST00000477737	Transcript	intron_variant						rs151031310	1		1	VWA3B	HGNC	28385	protein_coding	YES	CCDS42718.1	ENSP00000417955	Q502W6	Q53RD3	UPI0000E9B173	NM_144992.4				22/27		0.0733	0.0492	0.1124		0.0258	0.1571	0.0409										MODIFIER	1	deletion														.	TGTACTGGCTAGAA	.	.																					98902742
Unknown	0	.	GRCh37	2	99579503	99579511	+	IGR	DEL	GTATTTTTA	GTATTTTTA	-	rs111887919		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GTATTTTTA	GTATTTTTA																					3	.	3	0	.	0		-				intergenic_variant						rs111887919	1																				0.6256	0.4337		0.126	0.2594	0.3313										MODIFIER	1	deletion														.	TTGTATTTTTAG	.	.																					99579502
ENSR00001624280	0	.	GRCh37	2	101944533	101944534	+	IGR	INS	-	-	GGAGATGATTATGGAGCCAT	rs371443609		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001624280		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001624280,;,TF_binding_site_variant,,ENSM00530259200,;,TF_binding_site_variant,,ENSM00908974550,;	GGAGATGATTATGGAGCCAT		ENSR00001624280	RegulatoryFeature	regulatory_region_variant						rs371443609	1																				0.0045	0.0043			0.0159	0.0041										MODIFIER		insertion														.	ACG	.	.																					101944533
LINC01158	100506421	.	GRCh37	2	105440965	105440966	+	Intron	INS	-	-	TGG	rs376797707		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.148-11655_148-11653dup			ENST00000458253		7	3	4	4	4	0	LINC01158,intron_variant,,ENST00000413121,;LINC01158,intron_variant,,ENST00000443988,;LINC01158,intron_variant,,ENST00000447876,;LINC01158,intron_variant,,ENST00000454729,;LINC01158,intron_variant,,ENST00000458253,;	TGG	ENSG00000233639	ENST00000458253	Transcript	intron_variant,non_coding_transcript_variant						rs376797707	1		-1	LINC01158	HGNC	49513	antisense	YES										1/3																		MODIFIER	1	insertion														.	GAT	.	.																					105440965
AC023672.2	0	.	GRCh37	2	108661091	108661091	+	3'Flank	DEL	A	A	-	rs11354001		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000424355		4	.	4	0	.	0	AC023672.2,downstream_gene_variant,,ENST00000424355,;	-	ENSG00000231221	ENST00000424355	Transcript	downstream_gene_variant						rs11354001	1	4565	-1	AC023672.2	Clone_based_vega_gene		lincRNA	YES													0.9244	0.9784		1	0.9781	0.9775										MODIFIER	1	deletion														.	AGAA	.	.																					108661090
BCL2L11	10018	.	GRCh37	2	111881264	111881264	+	Intron	DEL	T	T	-	rs372903612		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.-13-36del			ENST00000393256		11	.	3	5	.	0	BCL2L11,intron_variant,,ENST00000308659,;BCL2L11,intron_variant,,ENST00000337565,NM_207002.3;BCL2L11,intron_variant,,ENST00000357757,;BCL2L11,intron_variant,,ENST00000393252,;BCL2L11,intron_variant,,ENST00000393253,;BCL2L11,intron_variant,,ENST00000393256,NM_006538.4,NM_001204106.1,NM_138621.4,NM_138627.3;BCL2L11,intron_variant,,ENST00000432179,;BCL2L11,upstream_gene_variant,,ENST00000405953,;BCL2L11,upstream_gene_variant,,ENST00000438054,NM_001204113.1;BCL2L11,intron_variant,,ENST00000433098,;BCL2L11,upstream_gene_variant,,ENST00000361493,;BCL2L11,upstream_gene_variant,,ENST00000415458,NM_001204112.1;BCL2L11,upstream_gene_variant,,ENST00000431217,NM_138624.3;BCL2L11,upstream_gene_variant,,ENST00000436733,NM_001204109.1;BCL2L11,upstream_gene_variant,,ENST00000437029,;BCL2L11,upstream_gene_variant,,ENST00000439718,;BCL2L11,upstream_gene_variant,,ENST00000452231,NM_001204110.1;,regulatory_region_variant,,ENSR00000292932,;	-	ENSG00000153094	ENST00000393256	Transcript	intron_variant						rs372903612	1		1	BCL2L11	HGNC	994	protein_coding	YES	CCDS2089.1	ENSP00000376943	O43521	E9PAM9,C9J417	UPI0000033ABA	NM_006538.4,NM_001204106.1,NM_138621.4,NM_138627.3				1/3																		MODIFIER	1	deletion														.	GATT	.	.																					111881263
MIR4435-1HG	112597	.	GRCh37	2	111999898	111999899	+	5'Flank	INS	-	-	A	rs560827012		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000371162		3	.	3	0	.	0	MIR4435-1HG,intron_variant,,ENST00000431385,;MIR4435-1HG,intron_variant,,ENST00000439362,;MIR4435-1HG,intron_variant,,ENST00000443467,;MIR4435-1HG,intron_variant,,ENST00000609220,;MIR4435-1HG,intron_variant,,ENST00000609902,;MIR4435-1HG,upstream_gene_variant,,ENST00000371162,;	A	ENSG00000172965	ENST00000371162	Transcript	upstream_gene_variant						rs560827012	1	3274	-1	MIR4435-1HG	HGNC	35163	lincRNA	YES													0.0794	0.0821		0.0982	0.17	0.1084										MODIFIER	1	insertion														.	TCA	.	.																					111999898
POLR1B	84172	.	GRCh37	2	113300960	113300960	+	Intron	DEL	A	A	-	rs11298106		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.177+713del			ENST00000263331		4	.	4	0	.	0	POLR1B,intron_variant,,ENST00000263331,NM_019014.4;POLR1B,intron_variant,,ENST00000409894,NM_001282774.1;POLR1B,intron_variant,,ENST00000417433,NM_001137604.1;POLR1B,intron_variant,,ENST00000430769,;POLR1B,intron_variant,,ENST00000438748,;POLR1B,intron_variant,,ENST00000537335,NM_001282776.1;POLR1B,intron_variant,,ENST00000541869,NM_001282772.1;TTL,downstream_gene_variant,,ENST00000233336,NM_153712.4;POLR1B,intron_variant,,ENST00000496238,;POLR1B,intron_variant,,ENST00000333990,NM_001282777.1;POLR1B,intron_variant,,ENST00000424062,;POLR1B,intron_variant,,ENST00000430293,;POLR1B,intron_variant,,ENST00000448770,;POLR1B,upstream_gene_variant,,ENST00000468475,;,regulatory_region_variant,,ENSR00000121947,;	-	ENSG00000125630	ENST00000263331	Transcript	intron_variant						rs11298106	1		1	POLR1B	HGNC	20454	protein_coding	YES	CCDS2097.1	ENSP00000263331	Q9H9Y6	Q9BSR4,Q6DKI9,F5H643,C9JS83,C9JJG2,B7Z1W6	UPI00001B6B03	NM_019014.4				1/14			0.7776	0.7853		0.7063	0.7803	0.7986										MODIFIER	1	deletion														.	ATAA	.	.																					113300959
ENSR00000121968	0	.	GRCh37	2	113463917	113463918	+	IGR	INS	-	-	CTCTCCA	rs11282964		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00000121968		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00000121968,;	CTCTCCA		ENSR00000121968	RegulatoryFeature	regulatory_region_variant						rs11282964	1																				0.5484	0.3862		0.1706	0.497	0.4836										MODIFIER	1	insertion														.	CTC	.	.																					113463917
CKAP2L	150468	.	GRCh37	2	113504675	113504675	+	Intron	DEL	T	T	-	rs11365193		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1603-523del			ENST00000302450		3	.	3	0	.	0	CKAP2L,intron_variant,,ENST00000302450,NM_152515.3;CKAP2L,intron_variant,,ENST00000541405,;NT5DC4,downstream_gene_variant,,ENST00000327581,;CKAP2L,intron_variant,,ENST00000435431,;CKAP2L,intron_variant,,ENST00000474331,;	-	ENSG00000169607	ENST00000302450	Transcript	intron_variant						rs11365193	1		-1	CKAP2L	HGNC	26877	protein_coding	YES	CCDS2100.1	ENSP00000305204	Q8IYA6	F5H0M5	UPI0000207D64	NM_152515.3				5/8			0.792	0.4222		0.3323	0.4543	0.5297										MODIFIER	1	deletion													1	.	TCTT	.	.																					113504674
Unknown	0	.	GRCh37	2	115099817	115099817	+	IGR	DEL	T	T	-	rs70937274		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs70937274	1																				0.6271	0.9179		0.9097	0.8946	0.9366										MODIFIER	1	deletion														.	TCTT	.	.																					115099816
DPP10	57628	.	GRCh37	2	116593676	116593679	+	Intron	DEL	TGTG	TGTG	-	rs10549769		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGTG	TGTG																c.1963-57_1963-54del			ENST00000393147		14	.	4	11	.	0	DPP10,intron_variant,,ENST00000310323,NM_001004360.3;DPP10,intron_variant,,ENST00000393147,NM_001178034.1;DPP10,intron_variant,,ENST00000409163,NM_001178036.1;DPP10,intron_variant,,ENST00000410059,NM_001178037.1,NM_020868.3;DPP10,intron_variant,,ENST00000473362,;	-	ENSG00000175497	ENST00000393147	Transcript	intron_variant						rs10549769	2		1	DPP10	HGNC	20823	protein_coding	YES	CCDS54388.1	ENSP00000376855	Q8N608	J3KQK8,C9J4M8	UPI00015E0A22	NM_001178034.1				21/25																		MODIFIER	1	sequence_alteration													1	.	TATGTGT	.	.																					116593675
Unknown	0	.	GRCh37	2	116962896	116962900	+	IGR	DEL	CTAGT	CTAGT	-	rs560165376		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTAGT	CTAGT																					3	.	3	0	.	0		-				intergenic_variant						rs560165376	1																					0.0086			0.005	0.002										MODIFIER	1	deletion														.	TGCTAGTC	.	.																					116962895
CCDC93	54520	.	GRCh37	2	118771683	118771685	+	5'UTR	DEL	GCC	GCC	-	rs58181584		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GCC	GCC																c.-114_-112del			ENST00000376300	1/24	5	.	3	5	.	0	CCDC93,5_prime_UTR_variant,,ENST00000376300,NM_019044.4;CCDC93,5_prime_UTR_variant,,ENST00000319432,;RN7SL111P,upstream_gene_variant,,ENST00000468841,;AC009303.1,downstream_gene_variant,,ENST00000588042,;AC009303.1,downstream_gene_variant,,ENST00000590516,;,regulatory_region_variant,,ENSR00000122209,;	-	ENSG00000125633	ENST00000376300	Transcript	5_prime_UTR_variant	25-27/6899					rs58181584	1		-1	CCDC93	HGNC	25611	protein_coding	YES	CCDS2121.2	ENSP00000365477	Q567U6		UPI0000207DEC	NM_019044.4			1/24																			MODIFIER	1	deletion														.	CTGCCG	.	.												0.2537	0.44	0.1624	0.3222	0.2084	0.1606	0.2757	0.2824	0.2973	118771682
TFCP2L1	29842	.	GRCh37	2	121989684	121989693	+	Intron	DEL	TTTTGTTTTG	TTTTGTTTTG	-	rs3835787		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTTGTTTTG	TTTTGTTTTG																c.1199-149_1199-140del			ENST00000263707		14	.	3	20	.	6	TFCP2L1,intron_variant,,ENST00000263707,NM_014553.2;TFCP2L1,intron_variant,,ENST00000464621,;	-	ENSG00000115112	ENST00000263707	Transcript	intron_variant						rs3835787	1		-1	TFCP2L1	HGNC	17925	protein_coding	YES	CCDS2134.1	ENSP00000263707	Q9NZI6	Q5JV87,Q53RS7	UPI0000072817	NM_014553.2				12/14																		MODIFIER	1	deletion														.	CTTTTTGTTTTGT	.	.																					121989683
CNTNAP5	129684	.	GRCh37	2	125394472	125394473	+	Intron	INS	-	-	CTCTGTCTCTTTTTCTCCTCTC	rs779505626		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1874-10859_1874-10858insGTCTCTTTTTCTCCTCTCCTCT			ENST00000431078		3	.	3	0	.	0	CNTNAP5,intron_variant,,ENST00000431078,NM_130773.3;	CTCTGTCTCTTTTTCTCCTCTC	ENSG00000155052	ENST00000431078	Transcript	intron_variant						rs779505626	1		1	CNTNAP5	HGNC	18748	protein_coding	YES	CCDS46401.1	ENSP00000399013	Q8WYK1		UPI0000071988	NM_130773.3				12/23																		MODIFIER	1	insertion														.	ATC	.	.																					125394472
HS6ST1	9394	.	GRCh37	2	129025599	129025600	+	3'UTR	INS	-	-	T	rs139353260		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.*136dup			ENST00000259241	2/2	4	.	4	0	.	0	HS6ST1,3_prime_UTR_variant,,ENST00000259241,NM_004807.2;HS6ST1,intron_variant,,ENST00000469019,;HS6ST1,downstream_gene_variant,,ENST00000463963,;,regulatory_region_variant,,ENSR00001626817,;	T	ENSG00000136720	ENST00000259241	Transcript	3_prime_UTR_variant	1386-1387/3932					rs139353260	1		-1	HS6ST1	HGNC	5201	protein_coding	YES	CCDS42748.1	ENSP00000259241	O60243	B4E2L3	UPI0000D61231	NM_004807.2			2/2																			MODIFIER	1	insertion													1	.	TGT	.	.																					129025599
ENSR00001190989	0	.	GRCh37	2	129320994	129321016	+	IGR	DEL	GGAGCTCCTCCAAGGCTGGAGCT	GGAGCTCCTCCAAGGCTGGAGCT	-	rs11275589		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GGAGCTCCTCCAAGGCTGGAGCT	GGAGCTCCTCCAAGGCTGGAGCT																			ENSR00001190989		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001190989,;	-		ENSR00001190989	RegulatoryFeature	regulatory_region_variant						rs11275589	1																				0.9554	0.9741		0.9663	0.9652	0.9611										MODIFIER	1	deletion														.	TGGGAGCTCCTCCAAGGCTGGAGCTG	.	.																					129320993
Unknown	0	.	GRCh37	2	132813521	132813522	+	IGR	INS	-	-	T	rs3080952		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs3080952	1																				0.1997	0.3948		0.3462	0.4583	0.3037										MODIFIER	1	insertion														.	ACT	.	.																					132813521
AC097532.2	0	.	GRCh37	2	133052507	133052508	+	5'Flank	INS	-	-	G	rs10928344		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000440802		6	.	6	0	.	0	AC097532.2,upstream_gene_variant,,ENST00000440802,;	G	ENSG00000230803	ENST00000440802	Transcript	upstream_gene_variant						rs10928344	1	557	-1	AC097532.2	Clone_based_vega_gene		lincRNA	YES																												MODIFIER	1	insertion														.	CAT	.	.																					133052507
CCNT2	905	.	GRCh37	2	135678923	135678924	+	Intron	INS	-	-	T	rs66839618		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.240+1472dup			ENST00000264157		6	.	6	0	.	0	CCNT2,intron_variant,,ENST00000264157,NM_058241.2,NM_001241.3;CCNT2,intron_variant,,ENST00000295238,;CCNT2,intron_variant,,ENST00000446247,;CCNT2,intron_variant,,ENST00000537343,;CCNT2-AS1,upstream_gene_variant,,ENST00000392929,;CCNT2-AS1,upstream_gene_variant,,ENST00000413962,;CCNT2-AS1,upstream_gene_variant,,ENST00000428857,;CCNT2-AS1,upstream_gene_variant,,ENST00000537615,;CCNT2,intron_variant,,ENST00000417175,;CCNT2,intron_variant,,ENST00000419781,;CCNT2,intron_variant,,ENST00000452839,;CCNT2,intron_variant,,ENST00000475094,;CCNT2,downstream_gene_variant,,ENST00000464932,;,regulatory_region_variant,,ENSR00000123487,;	T	ENSG00000082258	ENST00000264157	Transcript	intron_variant						rs66839618	1		1	CCNT2	HGNC	1600	protein_coding	YES	CCDS2174.1	ENSP00000264157	O60583		UPI000013E228	NM_058241.2,NM_001241.3				2/8			0.4894	0.3401		0.4871	0.327	0.3906										MODIFIER	1	insertion														.	AAT	.	.																					135678923
Unknown	0	.	GRCh37	2	138486605	138486606	+	IGR	DEL	TG	TG	-	rs67366963		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																					4	.	4	0	.	0		-				intergenic_variant						rs67366963	1																																			MODIFIER	1	deletion														.	TTTGT	.	.																					138486604
AC062021.1	0	.	GRCh37	2	140132262	140132263	+	Intron	INS	-	-	G	rs142769721		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.320-4218_320-4217insG			ENST00000429008		4	.	4	0	.	0	AC062021.1,intron_variant,,ENST00000429008,;	G	ENSG00000226939	ENST00000429008	Transcript	intron_variant,non_coding_transcript_variant						rs142769721	1		1	AC062021.1	Clone_based_vega_gene		lincRNA	YES										3/3		0.0214	0.003	0.0274			0.0636	0.0204										MODIFIER	1	insertion														.	CTC	.	.																					140132262
LRP1B	53353	.	GRCh37	2	142081564	142081565	+	Intron	INS	-	-	CACA	rs57960872		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.344-69358_344-69355dup			ENST00000389484		3	.	3	0	.	0	LRP1B,intron_variant,,ENST00000389484,NM_018557.2;LRP1B,intron_variant,,ENST00000434794,;	CACA	ENSG00000168702	ENST00000389484	Transcript	intron_variant						rs57960872	1		-1	LRP1B	HGNC	6693	protein_coding	YES	CCDS2182.1	ENSP00000374135	Q9NZR2	Q8WY27,Q8WY26,Q580W7,Q53TB8,Q53S76,Q53S73,Q53S26,Q53RL0,Q53RG4,Q53RA0,Q53QP5,Q53QM8,Q4ZG53,Q4ZFV5	UPI00001B045B	NM_018557.2				3/90																		MODIFIER	1	insertion													1	.	ATC	.	.																					142081564
ENSR00001627937	0	.	GRCh37	2	143826169	143826170	+	IGR	DEL	AC	AC	-	rs71404462		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																			ENSR00001627937		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001627937,;	-		ENSR00001627937	RegulatoryFeature	regulatory_region_variant						rs71404462	1																																			MODIFIER	1	deletion														.	ATACA	.	.																					143826168
Unknown	0	.	GRCh37	2	148138164	148138164	+	IGR	DEL	C	C	-	rs1440487068		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					3	.	3	0	.	0		-				intergenic_variant						rs1440487068	1																																			MODIFIER	1	deletion														.	TTCA	.	.																					148138163
Unknown	0	.	GRCh37	2	150767147	150767148	+	IGR	INS	-	-	A	rs5835237		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		A				intergenic_variant						rs5835237	1																				0.6006	0.7075		0.7054	0.7018	0.6268										MODIFIER	1	insertion														.	CTA	.	.																					150767147
Unknown	0	.	GRCh37	2	151810737	151810739	+	IGR	DEL	CCC	CCC	-	rs58330685		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCC	CCC																					3	.	3	0	.	0		-				intergenic_variant						rs58330685	1																																			MODIFIER	1	deletion														.	TACCCC	.	.																					151810736
Unknown	0	.	GRCh37	2	152071198	152071199	+	IGR	INS	-	-	G	rs58977967		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		G				intergenic_variant						rs58977967	1																				0.9735	0.9971		0.9395	1	0.9796										MODIFIER	1	insertion														.	GTG	.	.																					152071198
Unknown	0	.	GRCh37	2	161675376	161675377	+	IGR	INS	-	-	CT	rs34053948		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	6	2	.	0		CT				intergenic_variant						rs34053948	1																				0.9024	0.6326		0.8452	0.7893	0.8037										MODIFIER	1	insertion														.	TGC	.	.																					161675376
Unknown	0	.	GRCh37	2	161692041	161692041	+	IGR	DEL	G	G	-	rs10707100		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					3	.	3	0	.	0		-				intergenic_variant						rs10707100	1																				0.4002	0.3012		0.5248	0.4771	0.5419										MODIFIER	1	deletion														.	ATGG	.	.																					161692040
ENSR00001630138	0	.	GRCh37	2	167659770	167659770	+	IGR	DEL	T	T	-	rs35762912		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENSR00001630138		4	.	4	0	.	0	,regulatory_region_variant,,ENSR00001630138,;	-		ENSR00001630138	RegulatoryFeature	regulatory_region_variant						rs35762912	1																				0.1483	0.1196		0.1518	0.1372	0.1912										MODIFIER	1	deletion														.	ACTT	.	.																					167659769
Unknown	0	.	GRCh37	2	169190562	169190562	+	IGR	DEL	T	T	-	rs71397651		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs71397651	1																				0.6286	0.6599		0.7589	0.7594	0.7393										MODIFIER	1	deletion														.	CCTT	.	.																					169190561
ABCB11	8647	.	GRCh37	2	169884775	169884776	+	Intron	INS	-	-	A	rs141762876		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-28+2959dup			ENST00000263817		6	.	4	2	.	0	ABCB11,intron_variant,,ENST00000263817,NM_003742.2;	A	ENSG00000073734	ENST00000263817	Transcript	intron_variant						rs141762876	1		-1	ABCB11	HGNC	42	protein_coding	YES	CCDS46444.1	ENSP00000263817	O95342	Q9UIL3,Q53S60,B4DYQ0	UPI0000163BFA	NM_003742.2				1/27				0.0432			0.0974	0.0215										MODIFIER	1	insertion													1	.	TTA	.	.																					169884775
MYO3B	140469	.	GRCh37	2	171040400	171040401	+	Intron	INS	-	-	AAAAC	rs3066881		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2+5602_2+5603insAAACA			ENST00000408978		3	.	3	0	.	0	MYO3B,intron_variant,,ENST00000334231,;MYO3B,intron_variant,,ENST00000408978,NM_138995.4;MYO3B,intron_variant,,ENST00000409044,NM_001083615.3;MYO3B,intron_variant,,ENST00000484338,;MYO3B,intron_variant,,ENST00000438642,;MYO3B,intron_variant,,ENST00000317935,;MYO3B,intron_variant,,ENST00000409940,;	AAAAC	ENSG00000071909	ENST00000408978	Transcript	intron_variant						rs3066881	1		1	MYO3B	HGNC	15576	protein_coding	YES	CCDS42773.1	ENSP00000386213	Q8WXR4		UPI000020907B	NM_138995.4				1/34			0.1573	0.5432		0.5635	0.506	0.5511										MODIFIER	1	insertion														.	TTA	.	.																					171040400
METTL8	79828	.	GRCh37	2	172269237	172269237	+	Intron	DEL	A	A	-	rs536551109		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.-12-20530del			ENST00000375258		3	.	3	0	.	0	METTL8,intron_variant,,ENST00000375258,NM_024770.3;METTL8,intron_variant,,ENST00000392599,;METTL8,intron_variant,,ENST00000442541,;METTL8,intron_variant,,ENST00000442778,;METTL8,intron_variant,,ENST00000453846,;METTL8,intron_variant,,ENST00000460188,;METTL8,intron_variant,,ENST00000460539,;METTL8,intron_variant,,ENST00000462821,;METTL8,intron_variant,,ENST00000392604,;METTL8,intron_variant,,ENST00000447486,;	-	ENSG00000123600	ENST00000375258	Transcript	intron_variant						rs536551109	1		-1	METTL8	HGNC	25856	protein_coding	YES		ENSP00000364407		E7ETE0,C9JE69,C9J6U8,C9J3F1,B3KW44	UPI0000D4CA51	NM_024770.3				1/9																		MODIFIER	1	deletion														.	AGAA	.	.																					172269236
RPL21P38	0	.	GRCh37	2	172439500	172439500	+	5'Flank	DEL	C	C	-	rs59090785		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENST00000418090		6	.	6	0	.	0	RPL21P38,upstream_gene_variant,,ENST00000418090,;	-	ENSG00000233934	ENST00000418090	Transcript	upstream_gene_variant						rs59090785	1	4103	1	RPL21P38	HGNC	36349	processed_pseudogene	YES													0.4168	0.4251		0.5833	0.3012	0.4448										MODIFIER	1	deletion														.	GGCC	.	.																					172439499
PLEKHA3	65977	.	GRCh37	2	179346570	179346570	+	Intron	DEL	G	G	-	rs5836653		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.40+945del			ENST00000234453		49	.	9	49	.	0	PLEKHA3,intron_variant,,ENST00000234453,NM_019091.3;FKBP7,upstream_gene_variant,,ENST00000424785,NM_001135212.1,NM_181342.2;FKBP7,upstream_gene_variant,,ENST00000434643,;PLEKHA3,upstream_gene_variant,,ENST00000461474,;FKBP7,upstream_gene_variant,,ENST00000464248,;FKBP7,upstream_gene_variant,,ENST00000470945,;PLEKHA3,intron_variant,,ENST00000453653,;FKBP7,upstream_gene_variant,,ENST00000233092,;FKBP7,upstream_gene_variant,,ENST00000412612,;FKBP7,upstream_gene_variant,,ENST00000419184,;FKBP7,upstream_gene_variant,,ENST00000435079,;,regulatory_region_variant,,ENSR00000126975,;	-	ENSG00000116095	ENST00000234453	Transcript	intron_variant						rs5836653,COSV51845801	1		1	PLEKHA3	HGNC	14338	protein_coding	YES	CCDS33336.1	ENSP00000234453	Q9HB20		UPI000000DA8A	NM_019091.3				1/7			0.4002	0.2752		0.5685	0.2078	0.4192				0,1						MODIFIER	1	deletion			0,1											.	TTGG	.	.																					179346569
TTN	7273	.	GRCh37	2	179425272	179425272	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.85587del	p.Asn28529LysfsTer9	p.N28529Kfs*9	ENST00000589042	326/363	44	.	27	50	.	50	TTN,frameshift_variant,p.Asn28529LysfsTer9,ENST00000589042,NM_001267550.1;TTN,frameshift_variant,p.Asn26888LysfsTer9,ENST00000591111,;TTN,frameshift_variant,p.Asn25961LysfsTer9,ENST00000342992,NM_133378.4,NM_001256850.1;TTN,frameshift_variant,p.Asn19656LysfsTer9,ENST00000342175,NM_133437.3;TTN,frameshift_variant,p.Asn19589LysfsTer9,ENST00000359218,NM_133432.3;TTN,frameshift_variant,p.Asn19464LysfsTer9,ENST00000460472,NM_003319.4;TTN-AS1,intron_variant,,ENST00000419746,;TTN-AS1,intron_variant,,ENST00000438095,;TTN-AS1,intron_variant,,ENST00000456053,;TTN-AS1,intron_variant,,ENST00000585451,;TTN-AS1,intron_variant,,ENST00000586452,;TTN-AS1,intron_variant,,ENST00000586707,;TTN-AS1,intron_variant,,ENST00000586831,;TTN-AS1,intron_variant,,ENST00000590807,;TTN-AS1,intron_variant,,ENST00000590932,;TTN-AS1,intron_variant,,ENST00000591332,;TTN-AS1,intron_variant,,ENST00000592600,;TTN-AS1,intron_variant,,ENST00000592630,;TTN-AS1,intron_variant,,ENST00000592689,;TTN-AS1,intron_variant,,ENST00000592750,;	-	ENSG00000155657	ENST00000589042	Transcript	frameshift_variant	85812/109224	85587/107976	28529/35991	N/X	aaT/aa	COSV60002004	1		-1	TTN	HGNC	12403	protein_coding	YES	CCDS59435.1	ENSP00000467141	Q8WZ42	C9JQJ2,A2TKE6	UPI000264F4A1	NM_001267550.1			326/363		Gene3D:,Pfam:PF00041,PROSITE_profiles:PS50853,PANTHER:PTHR13817,PANTHER:PTHR13817:SF6,SMART:SM00060,Superfamily:SSF49265											1						HIGH	1	deletion			1										1	.	TTAT	.	.																					179425271
AC080125.1	0	.	GRCh37	2	186415459	186415459	+	5'Flank	DEL	A	A	-	rs35355854		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000414888		4	.	4	0	.	0	AC080125.1,upstream_gene_variant,,ENST00000414888,;	-	ENSG00000225406	ENST00000414888	Transcript	upstream_gene_variant						rs35355854	1	2914	-1	AC080125.1	Clone_based_vega_gene		processed_pseudogene	YES													0.4395	0.6095		0.494	0.5835	0.4826										MODIFIER	1	deletion														.	AGAA	.	.																					186415458
Unknown	0	.	GRCh37	2	186450039	186450039	+	IGR	DEL	A	A	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					6	4	2	4	4	0		-				intergenic_variant							1																																			MODIFIER	1	deletion														.	CTAG	.	.																					186450038
NAB1	4664	.	GRCh37	2	191519380	191519381	+	Intron	INS	-	-	TA	rs57840299		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-196-1322_-196-1321insAT			ENST00000337386		3	.	3	0	.	0	NAB1,intron_variant,,ENST00000337386,NM_005966.3;NAB1,intron_variant,,ENST00000357215,;NAB1,intron_variant,,ENST00000409581,;NAB1,intron_variant,,ENST00000416973,;NAB1,intron_variant,,ENST00000423076,;NAB1,intron_variant,,ENST00000423376,;NAB1,intron_variant,,ENST00000426601,;NAB1,intron_variant,,ENST00000448811,;NAB1,upstream_gene_variant,,ENST00000409641,;	TA	ENSG00000138386	ENST00000337386	Transcript	intron_variant						rs57840299	1		1	NAB1	HGNC	7626	protein_coding	YES	CCDS2307.1	ENSP00000336894	Q13506	C9JL92,C9JJ42,C9JID4,C9JFF6,C9J3V0	UPI0000001C43	NM_005966.3				2/9			0.6687	0.9179		0.998	0.9513	0.9243										MODIFIER	1	insertion														.	TCT	.	.																					191519380
Unknown	0	.	GRCh37	2	193208651	193208652	+	IGR	INS	-	-	TT	rs33954683		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TT				intergenic_variant						rs33954683	1																				0.4319	0.9323		0.995	0.9712	0.9744										MODIFIER	1	insertion														.	AAT	.	.																					193208651
Unknown	0	.	GRCh37	2	195006035	195006036	+	IGR	DEL	TG	TG	-	rs3071078		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																					3	.	3	0	.	0		-				intergenic_variant						rs3071078	1																				0.6248	0.7248		0.9087	0.7068	0.7168										MODIFIER	1	deletion														.	TTTGT	.	.																					195006034
Unknown	0	.	GRCh37	2	196288946	196288946	+	IGR	DEL	T	T	-	rs11313909		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	4	0	.	0		-				intergenic_variant						rs11313909	1																				0.8419	0.889		0.8879	0.9871	0.9571										MODIFIER	1	deletion														.	CATT	.	.																					196288945
ANKRD44	91526	.	GRCh37	2	197973566	197973571	+	Intron	DEL	AACAAC	AACAAC	-	rs138617040		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AACAAC	AACAAC																c.985+1919_985+1924del			ENST00000409919		4	.	4	0	.	0	ANKRD44,intron_variant,,ENST00000282272,NM_001195144.1;ANKRD44,intron_variant,,ENST00000328737,;ANKRD44,intron_variant,,ENST00000337207,;ANKRD44,intron_variant,,ENST00000409153,;ANKRD44,intron_variant,,ENST00000409919,NM_153697.2;ANKRD44,intron_variant,,ENST00000422886,;ANKRD44,intron_variant,,ENST00000424317,;ANKRD44,intron_variant,,ENST00000450567,;ANKRD44,intron_variant,,ENST00000539527,;ANKRD44,intron_variant,,ENST00000473081,;,regulatory_region_variant,,ENSR00001204136,;	-	ENSG00000065413	ENST00000409919	Transcript	intron_variant						rs138617040	1		-1	ANKRD44	HGNC	25259	protein_coding	YES	CCDS33355.2	ENSP00000387233	Q8N8A2	C9JY51	UPI000004FDEC	NM_153697.2				9/9			0.73	0.951		0.9871	0.9622	0.9622										MODIFIER	1	deletion														.	AAAACAACA	.	.																					197973565
Unknown	0	.	GRCh37	2	200413298	200413299	+	IGR	INS	-	-	C	rs201700718		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		C				intergenic_variant						rs201700718	1																				0.0083	0.0245			0.0239	0.0031										MODIFIER	1	insertion														.	CAC	.	.																					200413298
AC079354.1	100652824	.	GRCh37	2	202969851	202969851	+	Intron	DEL	G	G	-	rs35737687		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.1325-630del			ENST00000541917		6	.	6	3	.	0	AC079354.1,intron_variant,,ENST00000295844,;AC079354.1,intron_variant,,ENST00000498697,;AC079354.1,intron_variant,,ENST00000541917,;AC079354.1,intron_variant,,ENST00000409515,;AC079354.1,intron_variant,,ENST00000459709,;	-	ENSG00000182329	ENST00000541917	Transcript	intron_variant						rs35737687	1		1	AC079354.1	Clone_based_vega_gene		protein_coding	YES		ENSP00000437957		F5H626	UPI00020659C3					8/14			0.031	0.3242		0.1181	0.3638	0.316										MODIFIER	1	deletion														.	AAGG	.	.																					202969850
Unknown	0	.	GRCh37	2	205028973	205028974	+	IGR	INS	-	-	GAAAT	rs58321186		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		GAAAT				intergenic_variant						rs58321186	1																				0.8457	0.8386		0.7718	0.9135	0.6442										MODIFIER	1	insertion														.	AGG	.	.																					205028973
ENSR00001634091	0	.	GRCh37	2	206826212	206826212	+	IGR	DEL	C	C	-	rs146425845		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENSR00001634091		4	.	4	0	.	0	,regulatory_region_variant,,ENSR00001634091,;	-		ENSR00001634091	RegulatoryFeature	regulatory_region_variant						rs146425845	1																				0.0862	0.1542		0.3948	0.1511	0.3906										MODIFIER	1	deletion														.	TGCC	.	.																					206826211
snoU13	0	.	GRCh37	2	208934791	208934791	+	3'Flank	DEL	T	T	-	rs11322544		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000459385		3	.	3	0	.	0	snoU13,downstream_gene_variant,,ENST00000459385,;	-	ENSG00000238582	ENST00000459385	Transcript	downstream_gene_variant						rs11322544	1	3994	-1	snoU13	RFAM		snoRNA	YES													0.2943	0.696		0.7212	0.5934	0.6861										MODIFIER	1	deletion														.	ACTT	.	.																					208934790
PTH2R	5746	.	GRCh37	2	209696259	209696259	+	Intron	DEL	A	A	-	rs61284288		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.*532+7198del			ENST00000419079		3	.	3	0	.	0	PTH2R,intron_variant,,ENST00000419079,;	-	ENSG00000144407	ENST00000419079	Transcript	intron_variant,NMD_transcript_variant						rs61284288	1		1	PTH2R	HGNC	9609	nonsense_mediated_decay			ENSP00000393930			UPI000198C666					6/6			0.9107	0.7406		0.4881	0.7416	0.772										MODIFIER	1	deletion														.	TTAA	.	.																					209696258
AC010887.1	0	.	GRCh37	2	218036819	218036819	+	5'Flank	DEL	G	G	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																			ENST00000516040		6	4	2	4	4	0	AC010887.1,upstream_gene_variant,,ENST00000516040,;	-	ENSG00000251849	ENST00000516040	Transcript	upstream_gene_variant							1	4402	1	AC010887.1	Clone_based_ensembl_gene		miRNA	YES																												MODIFIER	1	deletion														.	CTGC	.	.																					218036818
Unknown	0	.	GRCh37	2	220664192	220664193	+	IGR	INS	-	-	C	rs60053437		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		C				intergenic_variant						rs60053437	1																				0.9992	1		1	1	0.999										MODIFIER	1	insertion														.	CTC	.	.																					220664192
EPHA4	2043	.	GRCh37	2	222343539	222343539	+	Intron	DEL	A	A	-	rs3835965		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1318+3533del			ENST00000281821		6	4	2	4	4	0	EPHA4,intron_variant,,ENST00000281821,NM_004438.3;EPHA4,intron_variant,,ENST00000392071,;EPHA4,intron_variant,,ENST00000409854,;EPHA4,intron_variant,,ENST00000409938,;EPHA4,intron_variant,,ENST00000441679,;EPHA4,intron_variant,,ENST00000443796,;EPHA4,downstream_gene_variant,,ENST00000463446,;,regulatory_region_variant,,ENSR00001209087,;,regulatory_region_variant,,ENSR00001635676,;	-	ENSG00000116106	ENST00000281821	Transcript	intron_variant						rs3835965	1		-1	EPHA4	HGNC	3388	protein_coding	YES	CCDS2447.1	ENSP00000281821	P54764	Q584H6,Q53TA0,F5GZZ5,E9PG71,C9JIX8,C9JEM6	UPI000012A077	NM_004438.3				5/17		0.4167	0.3956	0.3732		0.5357	0.3996	0.3712										MODIFIER	1	deletion													1	.	CCAG	.	.																					222343538
PID1	55022	.	GRCh37	2	229958485	229958485	+	Intron	DEL	G	G	-	rs34755349		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.270+62049del			ENST00000392054		3	.	3	0	.	0	PID1,intron_variant,,ENST00000354069,;PID1,intron_variant,,ENST00000392054,NM_017933.4;PID1,intron_variant,,ENST00000392055,NM_001100818.1;PID1,intron_variant,,ENST00000409462,;PID1,intron_variant,,ENST00000482518,;PID1,intron_variant,,ENST00000534952,;	-	ENSG00000153823	ENST00000392054	Transcript	intron_variant						rs34755349,COSV62473135	1		-1	PID1	HGNC	26084	protein_coding	YES	CCDS2471.1	ENSP00000375907	Q7Z2X4	Q4ZG81	UPI00001C0AF7	NM_017933.4				3/3		0.5921	0.2602	0.611		0.6796	0.7694	0.7546				0,1						MODIFIER	1	deletion			0,1											.	AAGA	.	.																					229958484
SP140L	93349	.	GRCh37	2	231239031	231239031	+	Intron	DEL	A	A	-	rs35573735		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.637+2679del			ENST00000415673		3	.	3	0	.	0	SP140L,intron_variant,,ENST00000243810,;SP140L,intron_variant,,ENST00000396563,;SP140L,intron_variant,,ENST00000415673,NM_138402.4;SP140L,intron_variant,,ENST00000444636,;SP140L,downstream_gene_variant,,ENST00000458341,;SP140L,intron_variant,,ENST00000483728,;	-	ENSG00000185404	ENST00000415673	Transcript	intron_variant						rs35573735	1		1	SP140L	HGNC	25105	protein_coding	YES	CCDS46538.1	ENSP00000397911	Q9H930		UPI000020974D	NM_138402.4				7/18																		MODIFIER	1	deletion														.	TCAA	.	.																					231239030
COX20P2	0	.	GRCh37	2	231824383	231824383	+	3'Flank	DEL	T	T	-	rs35915113		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000452636		3	.	3	0	.	0	GPR55,intron_variant,,ENST00000392039,;COX20P2,downstream_gene_variant,,ENST00000452636,;	-	ENSG00000235013	ENST00000452636	Transcript	downstream_gene_variant						rs35915113	1	1718	1	COX20P2	HGNC	43772	processed_pseudogene	YES																												MODIFIER	1	deletion														.	TATT	.	.																					231824382
Unknown	0	.	GRCh37	2	233363352	233363353	+	IGR	INS	-	-	CATCATCATCATCATCAT	rs61676235		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		CATCATCATCATCATCAT				intergenic_variant						rs61676235	1																																			MODIFIER	1	insertion														.	TCC	.	.																					233363352
Unknown	0	.	GRCh37	2	236175109	236175110	+	IGR	INS	-	-	TGAAAGGGAATGATGAATAGCGAGTGTCAGACATGCACATTGGCCACC	rs1553598589		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TGAAAGGGAATGATGAATAGCGAGTGTCAGACATGCACATTGGCCACC				intergenic_variant						rs1553598589	1																																			MODIFIER	1	insertion														.	GGT	.	.																					236175109
NDUFA10	4705	.	GRCh37	2	240852484	240852485	+	Intron	INS	-	-	A	rs34313648		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.295-17754_295-17753insT			ENST00000419408		5	.	3	4	.	0	NDUFA10,intron_variant,,ENST00000419408,;,regulatory_region_variant,,ENSR00001637886,;	A	ENSG00000130414	ENST00000419408	Transcript	intron_variant						rs34313648	1		-1	NDUFA10	HGNC	7684	protein_coding			ENSP00000408055		H7C2W5	UPI000173A5FD					4/5		0.1815	0.329	0.134		0.0734	0.1491	0.1605										MODIFIER	1	insertion													1	.	GGC	.	.																					240852484
KIF1A	547	.	GRCh37	2	241726174	241726174	+	Intron	DEL	A	A	-	rs138509440		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.430-244del			ENST00000498729		6	2	4	4	4	0	KIF1A,intron_variant,,ENST00000320389,NM_004321.6;KIF1A,intron_variant,,ENST00000404283,;KIF1A,intron_variant,,ENST00000498729,NM_001244008.1;KIF1A,upstream_gene_variant,,ENST00000428768,;KIF1A,downstream_gene_variant,,ENST00000448728,;	-	ENSG00000130294	ENST00000498729	Transcript	intron_variant						rs138509440,COSV57487541	1		-1	KIF1A	HGNC	888	protein_coding	YES	CCDS58757.1	ENSP00000438388	Q12756	G1UI30,C9JBH1	UPI0002065B81	NM_001244008.1				5/49												0,1						MODIFIER	1	deletion			0,1										1	.	AGAG	.	.																					241726173
AC093642.5	728323	.	GRCh37	2	243056967	243056967	+	Intron	DEL	T	T	-	rs879228101		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																n.413+76del			ENST00000456398		18	.	3	14	.	0	AC093642.5,intron_variant,,ENST00000403324,;AC093642.5,intron_variant,,ENST00000431796,;AC093642.5,intron_variant,,ENST00000442213,;AC093642.5,intron_variant,,ENST00000456398,;AC093642.5,intron_variant,,ENST00000444990,;AC093642.5,intron_variant,,ENST00000416103,;AC093642.5,intron_variant,,ENST00000453598,;	-	ENSG00000220804	ENST00000456398	Transcript	intron_variant,non_coding_transcript_variant						rs879228101	1		1	AC093642.5	Clone_based_vega_gene		processed_transcript	YES										3/7																		MODIFIER	1	deletion														.	TCTT	.	.																					243056966
AC090044.1	101927215	.	GRCh37	3	891600	891600	+	3'Flank	DEL	G	G	-	rs34025936		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																			ENST00000420823		3	.	3	0	.	0	AC090044.1,downstream_gene_variant,,ENST00000420823,;	-	ENSG00000224957	ENST00000420823	Transcript	downstream_gene_variant						rs34025936	1	3902	1	AC090044.1	Clone_based_vega_gene		lincRNA	YES													0.1248	0.2968		0.3234	0.1859	0.089										MODIFIER	1	deletion														.	TTGG	.	.																					891599
Unknown	0	.	GRCh37	3	1603496	1603500	+	IGR	DEL	TTTTT	TTTTT	-	rs59704285		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTTT	TTTTT																					3	.	3	0	.	0		-				intergenic_variant						rs59704285	1																				0.9569	0.9697		0.9841	0.9602	0.955										MODIFIER	1	deletion														.	ACTTTTTT	.	.																					1603495
CNTN4	152330	.	GRCh37	3	2563497	2563498	+	Intron	INS	-	-	GAT	rs146802640		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-88-49600_-88-49598dup			ENST00000397461		4	.	4	0	.	0	CNTN4,intron_variant,,ENST00000397461,NM_001206955.1;CNTN4,intron_variant,,ENST00000418658,NM_175607.2;CNTN4,intron_variant,,ENST00000422330,;CNTN4,intron_variant,,ENST00000434053,;CNTN4,intron_variant,,ENST00000455083,;CNTN4,intron_variant,,ENST00000427741,;CNTN4,intron_variant,,ENST00000430505,;CNTN4,intron_variant,,ENST00000438282,;	GAT	ENSG00000144619	ENST00000397461	Transcript	intron_variant						rs146802640	1		1	CNTN4	HGNC	2174	protein_coding	YES	CCDS43041.1	ENSP00000380602	Q8IWV2	G3XAD4,C9JMQ2,C9JGK9	UPI000007446C	NM_001206955.1				2/23				0.0072			0.0229	0.0031										MODIFIER	1	insertion														.	TAG	.	.																					2563497
Unknown	0	.	GRCh37	3	5657817	5657820	+	IGR	DEL	TCAT	TCAT	-	rs60971344		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCAT	TCAT																					3	.	3	0	.	0		-				intergenic_variant						rs60971344	1																				0.5091	0.7176		0.7748	0.6282	0.6196										MODIFIER	1	deletion														.	AATCATT	.	.																					5657816
AC027119.1	0	.	GRCh37	3	6137452	6137464	+	Intron	DEL	TAGAGTTCTCTCT	TAGAGTTCTCTCT	-	rs58964339		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAGAGTTCTCTCT	TAGAGTTCTCTCT																n.323-28207_323-28195del			ENST00000425894		3	.	3	0	.	0	AC027119.1,intron_variant,,ENST00000425894,;	-	ENSG00000229642	ENST00000425894	Transcript	intron_variant,non_coding_transcript_variant						rs58964339	1		1	AC027119.1	Clone_based_vega_gene		lincRNA	YES										2/2																		MODIFIER	1	deletion														.	TCTAGAGTTCTCTCTT	.	.																					6137451
GRM7	2917	.	GRCh37	3	6962243	6962244	+	Intron	DEL	AA	AA	-	rs35421703		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																c.519+58662_519+58663del			ENST00000357716		3	.	3	0	.	0	GRM7,intron_variant,,ENST00000357716,NM_000844.3;GRM7,intron_variant,,ENST00000389336,;GRM7,intron_variant,,ENST00000402647,;GRM7,intron_variant,,ENST00000403881,;GRM7,intron_variant,,ENST00000448328,;GRM7,intron_variant,,ENST00000486284,NM_181874.2;GRM7,intron_variant,,ENST00000389335,;GRM7,intron_variant,,ENST00000435689,;GRM7,intron_variant,,ENST00000440923,;GRM7,intron_variant,,ENST00000443259,;GRM7,intron_variant,,ENST00000467425,;	-	ENSG00000196277	ENST00000357716	Transcript	intron_variant						rs35421703	1		1	GRM7	HGNC	4599	protein_coding	YES	CCDS43042.1	ENSP00000350348	Q14831	C9JU97	UPI000004A7E3	NM_000844.3				1/9																		MODIFIER	1	deletion														.	TCAAA	.	.																					6962242
VGLL4	9686	.	GRCh37	3	11742837	11742837	+	Intron	DEL	A	A	-	rs34493914		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.64+1608del			ENST00000273038		5	.	5	0	.	0	VGLL4,intron_variant,,ENST00000273038,NM_014667.2;VGLL4,intron_variant,,ENST00000404339,NM_001284390.1;VGLL4,intron_variant,,ENST00000417206,;VGLL4,intron_variant,,ENST00000418000,;VGLL4,intron_variant,,ENST00000419541,;VGLL4,intron_variant,,ENST00000445411,;VGLL4,intron_variant,,ENST00000463387,;VGLL4,intron_variant,,ENST00000417466,;VGLL4,intron_variant,,ENST00000426568,;	-	ENSG00000144560	ENST00000273038	Transcript	intron_variant						rs34493914	1		-1	VGLL4	HGNC	28966	protein_coding		CCDS2606.1	ENSP00000273038	Q14135	Q0H0I7,G5E9M9,E7EWF5,E7EUJ2,E7EQU6,C9JX59,C9JBN2	UPI000013FB7A	NM_014667.2				2/5		0.3688	0.2791	0.3905		0.3046	0.5219	0.3834										MODIFIER		deletion														.	AGAC	.	.																					11742836
TAMM41	132001	.	GRCh37	3	11872180	11872181	+	Intron	INS	-	-	A	rs1331894879		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.412-843dup			ENST00000273037		4	.	4	0	.	0	TAMM41,intron_variant,,ENST00000273037,NM_138807.2;TAMM41,intron_variant,,ENST00000444133,;TAMM41,intron_variant,,ENST00000455809,NM_001284401.1;TAMM41,intron_variant,,ENST00000411947,;TAMM41,intron_variant,,ENST00000457498,;TAMM41,downstream_gene_variant,,ENST00000417723,;TAMM41,upstream_gene_variant,,ENST00000460246,;	A	ENSG00000144559	ENST00000273037	Transcript	intron_variant						rs1331894879	1		-1	TAMM41	HGNC	25187	protein_coding	YES	CCDS2607.1	ENSP00000273037	Q96BW9		UPI0000070263	NM_138807.2				3/6																		MODIFIER	1	insertion														.	ACA	.	.																					11872180
CCDC174	51244	.	GRCh37	3	14703402	14703410	+	Intron	DEL	ATAATTACA	ATAATTACA	-	rs55915506		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATAATTACA	ATAATTACA																c.485+206_485+214del			ENST00000383794		3	.	3	0	.	0	CCDC174,intron_variant,,ENST00000303688,;CCDC174,intron_variant,,ENST00000383794,NM_016474.4;CCDC174,non_coding_transcript_exon_variant,,ENST00000463438,;CCDC174,intron_variant,,ENST00000465759,;	-	ENSG00000154781	ENST00000383794	Transcript	intron_variant						rs55915506	1		1	CCDC174	HGNC	28033	protein_coding	YES	CCDS2620.2	ENSP00000373304	Q6PII3		UPI00004120DD	NM_016474.4				5/10			0.1029	0.3746		0.4593	0.5547	0.6605										MODIFIER	1	deletion													1	.	ACATAATTACAA	.	.																					14703401
Unknown	0	.	GRCh37	3	16088099	16088101	+	IGR	DEL	TGC	TGC	-	rs66961708		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGC	TGC																					3	.	3	0	.	0		-				intergenic_variant						rs66961708	1																																			MODIFIER	1	deletion														.	GGTGCT	.	.																					16088098
DAZL	1618	.	GRCh37	3	16640700	16640702	+	Intron	DEL	AAC	AAC	-	rs151248271		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAC	AAC																c.64-597_64-595del			ENST00000250863		5	.	5	0	.	0	DAZL,intron_variant,,ENST00000250863,NM_001190811.1;DAZL,intron_variant,,ENST00000399444,NM_001351.3;DAZL,intron_variant,,ENST00000454457,;	-	ENSG00000092345	ENST00000250863	Transcript	intron_variant						rs151248271	1		-1	DAZL	HGNC	2685	protein_coding	YES	CCDS54556.1	ENSP00000250863	Q92904		UPI0000412129	NM_001190811.1				1/10			0.0514	0.2392		0.4742	0.1014	0.184										MODIFIER	1	deletion														.	AAAACA	.	.																					16640699
AC023798.1	0	.	GRCh37	3	21876261	21876262	+	3'Flank	INS	-	-	TGGATCT	rs3073148		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000408457		3	.	3	0	.	0	AC023798.1,downstream_gene_variant,,ENST00000408457,;ZNF385D,intron_variant,,ENST00000494108,;ZNF385D,intron_variant,,ENST00000494118,;,regulatory_region_variant,,ENSR00001655591,;	TGGATCT	ENSG00000221384	ENST00000408457	Transcript	downstream_gene_variant						rs3073148	1	4932	1	AC023798.1	Clone_based_ensembl_gene		miRNA	YES													0.8464	0.7392		0.7907	0.826	0.8037										MODIFIER	1	insertion														.	AAT	.	.																					21876261
Unknown	0	.	GRCh37	3	22491376	22491377	+	IGR	INS	-	-	A	rs35818672		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	3	.	0		A				intergenic_variant						rs35818672	1																				0.8578	0.3343		0.5625	0.4056	0.3303										MODIFIER	1	insertion														.	ATA	.	.																					22491376
Unknown	0	.	GRCh37	3	23049233	23049234	+	IGR	INS	-	-	ATTT	rs5847213		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		ATTT				intergenic_variant						rs5847213	1																				0.2738	0.2507		0.4097	0.3628	0.2055										MODIFIER	1	insertion														.	ACA	.	.																					23049233
AC133680.1	0	.	GRCh37	3	25004909	25004911	+	Intron	DEL	TTG	TTG	-	rs34215998		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTG	TTG																n.346-96703_346-96701del			ENST00000455576		3	.	3	0	.	0	AC133680.1,intron_variant,,ENST00000455576,;	-	ENSG00000237838	ENST00000455576	Transcript	intron_variant,non_coding_transcript_variant						rs34215998	1		1	AC133680.1	Clone_based_vega_gene		lincRNA	YES										4/5																		MODIFIER	1	deletion														.	CCTTGT	.	.																					25004908
ZCWPW2	152098	.	GRCh37	3	28397829	28397830	+	Intron	DEL	AT	AT	-	rs144403273		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																c.-134+7136_-134+7137del			ENST00000383768		3	.	3	0	.	0	ZCWPW2,intron_variant,,ENST00000383768,;ZCWPW2,intron_variant,,ENST00000420223,;	-	ENSG00000206559	ENST00000383768	Transcript	intron_variant						rs144403273	1		1	ZCWPW2	HGNC	23574	protein_coding	YES	CCDS33723.1	ENSP00000373278	Q504Y3	C9JFK0	UPI0000161ABF					1/9			0.4115	0.5288		0.1796	0.5169	0.2975										MODIFIER	1	deletion														.	AAATA	.	.																					28397828
GADL1	339896	.	GRCh37	3	30842299	30842308	+	Intron	DEL	ACACACACAC	ACACACACAC	-	rs35529398		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACACACAC	ACACACACAC																c.1250+73_1250+82del			ENST00000282538		3	.	3	0	.	0	GADL1,3_prime_UTR_variant,,ENST00000454381,;GADL1,intron_variant,,ENST00000282538,NM_207359.2;	-	ENSG00000144644	ENST00000282538	Transcript	intron_variant						rs35529398	1		-1	GADL1	HGNC	27949	protein_coding	YES	CCDS2649.2	ENSP00000282538	Q6ZQY3		UPI000022BF90	NM_207359.2				12/14																		MODIFIER	1	deletion														.	AGACACACACACA	.	.																					30842298
AC104308.2	0	.	GRCh37	3	35912146	35912147	+	5'Flank	INS	-	-	T	rs34091172		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000454621		3	.	3	0	.	0	AC104308.2,upstream_gene_variant,,ENST00000454621,;	T	ENSG00000226489	ENST00000454621	Transcript	upstream_gene_variant						rs34091172	1	1211	1	AC104308.2	Clone_based_vega_gene		processed_pseudogene	YES													0.5325	0.1787		0.0248	0.2545	0.135										MODIFIER	1	insertion														.	GAT	.	.																					35912146
Unknown	0	.	GRCh37	3	40784545	40784545	+	IGR	DEL	C	C	-	rs34681741		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					6	.	6	3	.	0		-				intergenic_variant						rs34681741	1																				0.0257	0.3746		0.4931	0.326	0.5174										MODIFIER	1	deletion														.	CTCC	.	.																					40784544
Unknown	0	.	GRCh37	3	45401697	45401697	+	IGR	DEL	T	T	-	rs60641963		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs60641963	1																																			MODIFIER	1	deletion														.	CATT	.	.																					45401696
KIF9	64147	.	GRCh37	3	47272536	47272537	+	Intron	INS	-	-	T	rs143983005		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2323-2345_2323-2344insA			ENST00000335044		3	.	3	0	.	0	KIF9,intron_variant,,ENST00000265529,;KIF9,intron_variant,,ENST00000335044,NM_001134878.1,NM_182902.3;KIF9,intron_variant,,ENST00000444589,NM_022342.4;KIF9,intron_variant,,ENST00000452770,;KIF9,downstream_gene_variant,,ENST00000352910,;KIF9-AS1,intron_variant,,ENST00000429315,;	T	ENSG00000088727	ENST00000335044	Transcript	intron_variant						rs143983005	1		-1	KIF9	HGNC	16666	protein_coding	YES	CCDS2752.1	ENSP00000333942	Q9HAQ2		UPI000012DE55	NM_001134878.1,NM_182902.3				20/20		0.1695	0.0166	0.1599		0.3175	0.1501	0.2505										MODIFIER	1	insertion														.	AAA	.	.																					47272536
KLHL18	23276	.	GRCh37	3	47358134	47358135	+	Intron	DEL	TG	TG	-	rs71098474		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																c.130-3002_130-3001del			ENST00000232766		8	4	4	6	6	0	KLHL18,intron_variant,,ENST00000232766,NM_025010.4;KLHL18,intron_variant,,ENST00000437353,;KLHL18,intron_variant,,ENST00000455924,;KLHL18,intron_variant,,ENST00000433449,;KLHL18,intron_variant,,ENST00000442272,;KLHL18,intron_variant,,ENST00000461084,;,regulatory_region_variant,,ENSR00001658401,;	-	ENSG00000114648	ENST00000232766	Transcript	intron_variant						rs71098474	1		1	KLHL18	HGNC	29120	protein_coding	YES	CCDS33749.1	ENSP00000232766	O94889	Q6PJF0,C9J4G4,B4DHW4	UPI00004703A5	NM_025010.4				1/9																		MODIFIER	1	deletion														.	TATGT	.	.																					47358133
DHX30	22907	.	GRCh37	3	47878589	47878590	+	Intron	INS	-	-	GAGGCTTATGCTT	rs11270376		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.367-3769_367-3768insGCTTGAGGCTTAT			ENST00000445061		3	.	3	0	.	0	DHX30,intron_variant,,ENST00000348968,;DHX30,intron_variant,,ENST00000445061,NM_138615.2;DHX30,intron_variant,,ENST00000446256,NM_014966.3;DHX30,intron_variant,,ENST00000457607,;DHX30,intron_variant,,ENST00000395745,;DHX30,intron_variant,,ENST00000441384,;	GAGGCTTATGCTT	ENSG00000132153	ENST00000445061	Transcript	intron_variant						rs11270376	1		1	DHX30	HGNC	16716	protein_coding	YES	CCDS2759.1	ENSP00000405620	Q7L2E3	H7BXY3	UPI000007112B	NM_138615.2				6/21			0.3676	0.5865		0.7063	0.6839	0.5613										MODIFIER	1	insertion													1	.	AAG	.	.																					47878589
PRKAR2A	5576	.	GRCh37	3	48794052	48794052	+	Intron	DEL	A	A	-	rs562679450		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.874-175del			ENST00000265563		11	.	3	10	.	0	PRKAR2A,intron_variant,,ENST00000265563,NM_004157.2;PRKAR2A,intron_variant,,ENST00000296446,;PRKAR2A,intron_variant,,ENST00000437821,;PRKAR2A,intron_variant,,ENST00000438535,;PRKAR2A,intron_variant,,ENST00000454963,;PRKAR2A,upstream_gene_variant,,ENST00000457914,;	-	ENSG00000114302	ENST00000265563	Transcript	intron_variant						rs562679450	1		-1	PRKAR2A	HGNC	9391	protein_coding	YES	CCDS2778.1	ENSP00000265563	P13861		UPI0000161B64	NM_004157.2				8/10																		MODIFIER	1	deletion														.	GGAA	.	.																					48794051
PRKAR2A	5576	.	GRCh37	3	48811940	48811940	+	Intron	DEL	A	A	-	rs113619599		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.543-1399del			ENST00000265563		3	.	3	0	.	0	PRKAR2A,intron_variant,,ENST00000265563,NM_004157.2;PRKAR2A,intron_variant,,ENST00000296446,;PRKAR2A,intron_variant,,ENST00000437821,;PRKAR2A,intron_variant,,ENST00000454963,;	-	ENSG00000114302	ENST00000265563	Transcript	intron_variant						rs113619599	1		-1	PRKAR2A	HGNC	9391	protein_coding	YES	CCDS2778.1	ENSP00000265563	P13861		UPI0000161B64	NM_004157.2				5/10																		MODIFIER	1	deletion														.	GGAA	.	.																					48811939
RBM6	10180	.	GRCh37	3	50108948	50108949	+	Intron	INS	-	-	AGTC	rs55914752		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.3116+964_3116+967dup			ENST00000266022		6	.	3	3	.	0	RBM6,intron_variant,,ENST00000266022,NM_005777.2;RBM6,intron_variant,,ENST00000421682,;RBM6,intron_variant,,ENST00000422955,;RBM6,intron_variant,,ENST00000442092,NM_001167582.1;RBM6,intron_variant,,ENST00000443081,;RBM6,intron_variant,,ENST00000539992,;RBM6,intron_variant,,ENST00000419610,;RBM6,intron_variant,,ENST00000434592,;RBM6,intron_variant,,ENST00000454079,;	AGTC	ENSG00000004534	ENST00000266022	Transcript	intron_variant						rs55914752	1		1	RBM6	HGNC	9903	protein_coding	YES	CCDS2809.1	ENSP00000266022	P78332	E9PGM9,C9JSL1,C9JMC8,C9JII0,B4DNY1	UPI000013D6C0	NM_005777.2				19/20			0.236	0.2017		0.0149	0.2565	0.0501										MODIFIER	1	insertion														.	TGA	.	.																					50108948
ITIH4	3700	.	GRCh37	3	52866086	52866086	+	5'Flank	DEL	T	T	-	rs34438387		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000266041		3	.	3	0	.	0	ITIH4,upstream_gene_variant,,ENST00000266041,NM_002218.4;ITIH4,upstream_gene_variant,,ENST00000346281,NM_001166449.1;TMEM110,downstream_gene_variant,,ENST00000355083,NM_198563.2;ITIH4,upstream_gene_variant,,ENST00000406595,;ITIH4,upstream_gene_variant,,ENST00000434759,;MUSTN1,downstream_gene_variant,,ENST00000446157,NM_205853.3;TMEM110,downstream_gene_variant,,ENST00000482155,;ITIH4,upstream_gene_variant,,ENST00000485816,;MUSTN1,downstream_gene_variant,,ENST00000486659,;TMEM110-MUSTN1,downstream_gene_variant,,ENST00000504329,NM_001198974.2;TMEM110-MUSTN1,downstream_gene_variant,,ENST00000514466,;RP5-966M1.6,intron_variant,,ENST00000513520,;RP5-966M1.6,intron_variant,,ENST00000468472,;ITIH4,upstream_gene_variant,,ENST00000473904,;ITIH4,upstream_gene_variant,,ENST00000491663,;TMEM110-MUSTN1,downstream_gene_variant,,ENST00000495552,;ITIH4,upstream_gene_variant,,ENST00000537897,;,regulatory_region_variant,,ENSR00000396030,;	-	ENSG00000055955	ENST00000266041	Transcript	upstream_gene_variant						rs34438387	1	1331	-1	ITIH4	HGNC	6169	protein_coding	YES	CCDS2865.1	ENSP00000266041	Q14624		UPI000013D6C3	NM_002218.4																						MODIFIER	1	deletion														.	CCTT	.	.																					52866085
FAM208A	23272	.	GRCh37	3	56694518	56694519	+	Intron	DEL	AA	AA	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																c.1368+240_1368+241del			ENST00000493960		8	.	3	8	.	0	FAM208A,intron_variant,,ENST00000355628,;FAM208A,intron_variant,,ENST00000431842,NM_015224.3;FAM208A,intron_variant,,ENST00000493960,NM_001112736.1;FAM208A,downstream_gene_variant,,ENST00000478052,;	-	ENSG00000163946	ENST00000493960	Transcript	intron_variant							1		-1	FAM208A	HGNC	30314	protein_coding	YES	CCDS46853.1	ENSP00000417509	Q9UK61		UPI0000422561	NM_001112736.1				11/23																		MODIFIER	1	deletion														.	TCAAA	.	.																					56694517
PDHB	5162	.	GRCh37	3	58416770	58416771	+	Intron	INS	-	TTA	TTA	rs34834843		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.304-102_304-101insTAA			ENST00000302746		3	.	0	4	.	4	PDHB,intron_variant,,ENST00000302746,NM_000925.3,NM_001173468.1;PDHB,intron_variant,,ENST00000383714,;PDHB,intron_variant,,ENST00000474765,;PDHB,intron_variant,,ENST00000485460,;RP11-802O23.3,downstream_gene_variant,,ENST00000607214,;PDHB,non_coding_transcript_exon_variant,,ENST00000479945,;PDHB,intron_variant,,ENST00000461692,;PDHB,intron_variant,,ENST00000469364,;PDHB,intron_variant,,ENST00000480626,;PDHB,downstream_gene_variant,,ENST00000469827,;PDHB,downstream_gene_variant,,ENST00000482894,;	TTA	ENSG00000168291	ENST00000302746	Transcript	intron_variant						rs34834843	1		-1	PDHB	HGNC	8808	protein_coding	YES	CCDS2890.1	ENSP00000307241	P11177		UPI000013E81D	NM_000925.3,NM_001173468.1				5/9			0.1989	0.2839		0.001	0.3757	0.1708										MODIFIER	1	insertion													1	.	ATT	.	.																					58416770
Unknown	0	.	GRCh37	3	59237401	59237402	+	IGR	INS	-	-	GT	rs113763541		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		GT				intergenic_variant						rs113763541	1																				0.4811	0.6873		0.4663	0.668	0.5787										MODIFIER	1	insertion														.	ACG	.	.																					59237401
C3orf14	57415	.	GRCh37	3	62318806	62318807	+	Intron	DEL	TG	TG	-	rs113412493		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																c.253-105_253-104del			ENST00000494481		18	.	3	23	.	0	C3orf14,intron_variant,,ENST00000232519,;C3orf14,intron_variant,,ENST00000462069,;C3orf14,intron_variant,,ENST00000494481,;C3orf14,intron_variant,,ENST00000542214,NM_020685.3;C3orf14,downstream_gene_variant,,ENST00000465142,;PTPRG-AS1,intron_variant,,ENST00000490916,;PTPRG-AS1,intron_variant,,ENST00000495542,;,regulatory_region_variant,,ENSR00001660131,;	-	ENSG00000114405	ENST00000494481	Transcript	intron_variant						rs113412493	1		1	C3orf14	HGNC	25024	protein_coding	YES	CCDS2896.1	ENSP00000418086	Q9HBI5	C9JY17	UPI00000729BA					5/5																		MODIFIER	1	deletion														.	TATGT	.	.																					62318805
SYNPR	132204	.	GRCh37	3	63228977	63228978	+	Intron	INS	-	-	A	rs34619289		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.67-9192dup			ENST00000478456		6	.	6	0	.	0	SYNPR,intron_variant,,ENST00000478456,;	A	ENSG00000163630	ENST00000478456	Transcript	intron_variant,non_coding_transcript_variant						rs34619289	1		1	SYNPR	HGNC	16507	processed_transcript											1/4			0.4705	0.5346		0.0526	0.5944	0.3415										MODIFIER	1	insertion														.	GTA	.	.																					63228977
FAM19A4	151647	.	GRCh37	3	68838847	68838848	+	Intron	INS	-	-	T	rs11425987		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.131-36679dup			ENST00000295569		3	.	3	0	.	0	FAM19A4,intron_variant,,ENST00000295569,NM_182522.4,NM_001005527.2;FAM19A4,intron_variant,,ENST00000495737,;	T	ENSG00000163377	ENST00000295569	Transcript	intron_variant						rs11425987	1		-1	FAM19A4	HGNC	21591	protein_coding	YES	CCDS2907.1	ENSP00000295569	Q96LR4	C9JUW7	UPI0000071129	NM_182522.4,NM_001005527.2				3/5			0.0635	0.2651		0.0685	0.3797	0.3078										MODIFIER	1	insertion														.	AAT	.	.																					68838847
Unknown	0	.	GRCh37	3	69685406	69685407	+	IGR	INS	-	-	T	rs140221257		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	3	3	.	0		T				intergenic_variant						rs140221257	1																				0.0711	0.134		0.3016	0.171	0.2822										MODIFIER	1	insertion														.	GGT	.	.																					69685406
RP11-803B1.8	0	.	GRCh37	3	75510803	75510804	+	3'Flank	DEL	AG	AG	-	rs568194685		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																			ENST00000608169		3	.	3	0	.	0	RP11-803B1.8,downstream_gene_variant,,ENST00000608169,;ENPP7P2,intron_variant,,ENST00000462675,;	-	ENSG00000272690	ENST00000608169	Transcript	downstream_gene_variant						rs568194685	1	4166	1	RP11-803B1.8	Clone_based_vega_gene		lincRNA	YES																												MODIFIER		deletion														.	GCAGA	.	.																					75510802
Unknown	0	.	GRCh37	3	84000102	84000102	+	IGR	DEL	A	A	-	rs200313086		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	4	0	.	0		-				intergenic_variant						rs200313086	1																																			MODIFIER	1	deletion														.	TGAA	.	.																					84000101
CADM2	253559	.	GRCh37	3	85160797	85160801	+	Intron	DEL	TGATG	TGATG	-	rs143497305		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGATG	TGATG																c.61+151978_61+151982del			ENST00000383699		3	.	3	0	.	0	CADM2,intron_variant,,ENST00000383699,NM_001167675.1,NM_001256504.1,NM_001256505.1;CADM2,intron_variant,,ENST00000407528,NM_001167674.1;	-	ENSG00000175161	ENST00000383699	Transcript	intron_variant						rs143497305	1		1	CADM2	HGNC	29849	protein_coding		CCDS54613.1	ENSP00000373200	Q8N3J6	G3XHN7,G3XHN4	UPI0000035DF5	NM_001167675.1,NM_001256504.1,NM_001256505.1				1/9		0.1118	0.295	0.0548		0.0427	0.0398	0.0501										MODIFIER		deletion														.	GTTGATGG	.	.																					85160796
Unknown	0	.	GRCh37	3	87428524	87428525	+	IGR	INS	-	-	CTAA	rs58731669		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		CTAA				intergenic_variant						rs58731669	1																				0.2065	0.8631		0.6915	0.9145	0.8119										MODIFIER	1	insertion														.	ACC	.	.																					87428524
Unknown	0	.	GRCh37	3	99000880	99000882	+	IGR	DEL	CAG	CAG	-	rs34008791		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAG	CAG																					3	.	3	0	.	0		-				intergenic_variant						rs34008791	1																				0.7519	0.7695		0.751	0.66	0.547										MODIFIER	1	deletion														.	ACCAGC	.	.																					99000879
Unknown	0	.	GRCh37	3	102587763	102587764	+	IGR	INS	-	-	TTTAT	rs60749388		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TTTAT				intergenic_variant						rs60749388	1																				0.8714	0.8761		0.875	0.8082	0.9008										MODIFIER	1	insertion														.	ACT	.	.																					102587763
Unknown	0	.	GRCh37	3	102913805	102913806	+	IGR	INS	-	-	AAAAC	rs10685749		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		AAAAC				intergenic_variant						rs10685749	1																																			MODIFIER	1	insertion														.	AAA	.	.																					102913805
CBLB	868	.	GRCh37	3	105466662	105466663	+	Intron	INS	-	-	A	rs3836271		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.724-1781dup			ENST00000264122		3	.	3	0	.	0	CBLB,intron_variant,,ENST00000264122,NM_170662.3;CBLB,intron_variant,,ENST00000394027,;CBLB,intron_variant,,ENST00000403724,;CBLB,intron_variant,,ENST00000405772,;CBLB,intron_variant,,ENST00000545639,;,regulatory_region_variant,,ENSR00001663132,;	A	ENSG00000114423	ENST00000264122	Transcript	intron_variant						rs3836271	1		-1	CBLB	HGNC	1542	protein_coding	YES	CCDS2948.1	ENSP00000264122	Q13191	C9JU85,B5MC15	UPI00001AE89F	NM_170662.3				5/18			0.0257	0.072		0.2946	0.0835	0.1145										MODIFIER	1	insertion													1	.	TGA	.	.																					105466662
CD96	10225	.	GRCh37	3	111227323	111227324	+	Intron	INS	-	-	G	rs79216832		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-98-33451dup			ENST00000460744		3	.	3	0	.	0	CD96,intron_variant,,ENST00000460744,;	G	ENSG00000153283	ENST00000460744	Transcript	intron_variant						rs79216832	1		1	CD96	HGNC	16892	protein_coding			ENSP00000475194		U3KPT0	UPI00038BAF4B					3/4			0.1233	0.134		0.0635	0.167	0.1053										MODIFIER	1	insertion													1	.	TTG	.	.																					111227323
CD200R1L	344807	.	GRCh37	3	112540499	112540499	+	Intron	DEL	T	T	-	rs10715617		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.680-1757del			ENST00000398214		3	.	3	0	.	0	CD200R1L,intron_variant,,ENST00000398214,NM_001008784.2;CD200R1L,intron_variant,,ENST00000448932,NM_001199215.1;CD200R1L,intron_variant,,ENST00000488794,;CD200R1L,intron_variant,,ENST00000486723,;	-	ENSG00000206531	ENST00000398214	Transcript	intron_variant						rs10715617	1		-1	CD200R1L	HGNC	24665	protein_coding	YES	CCDS43131.1	ENSP00000381272	Q6Q8B3		UPI000042263C	NM_001008784.2				4/5			0.8268	0.9539		0.8155	0.9364	0.8354										MODIFIER	1	deletion														.	TGTT	.	.																					112540498
LSAMP	4045	.	GRCh37	3	115799680	115799681	+	Intron	INS	-	-	AG	rs10661529		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.388+5490_388+5491insCT			ENST00000490035		6	.	6	0	.	0	LSAMP,intron_variant,,ENST00000333617,;LSAMP,intron_variant,,ENST00000474851,;LSAMP,intron_variant,,ENST00000490035,NM_002338.3;LSAMP,intron_variant,,ENST00000539563,;	AG	ENSG00000185565	ENST00000490035	Transcript	intron_variant						rs10661529	1		-1	LSAMP	HGNC	6705	protein_coding	YES	CCDS2982.1	ENSP00000419000	Q13449		UPI00000746A0	NM_002338.3				2/6			0.9705	0.9986		1	1	1										MODIFIER	1	insertion														.	TAA	.	.																					115799680
LSAMP	4045	.	GRCh37	3	115851290	115851290	+	Intron	DEL	T	T	-	rs35299311		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.156-45887del			ENST00000490035		4	.	4	0	.	0	LSAMP,intron_variant,,ENST00000333617,;LSAMP,intron_variant,,ENST00000474851,;LSAMP,intron_variant,,ENST00000490035,NM_002338.3;LSAMP,intron_variant,,ENST00000539563,;	-	ENSG00000185565	ENST00000490035	Transcript	intron_variant						rs35299311	1		-1	LSAMP	HGNC	6705	protein_coding	YES	CCDS2982.1	ENSP00000419000	Q13449		UPI00000746A0	NM_002338.3				1/6		0.5519	0.3041	0.5331		0.7401	0.6183	0.638										MODIFIER	1	deletion														.	CCTG	.	.																					115851289
PDIA5	10954	.	GRCh37	3	122879295	122879296	+	Intron	INS	-	-	G	rs5852324		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1345-869dup			ENST00000316218		5	.	3	4	.	0	PDIA5,intron_variant,,ENST00000316218,NM_006810.3;PDIA5,intron_variant,,ENST00000467157,;PDIA5,intron_variant,,ENST00000469649,;PDIA5,intron_variant,,ENST00000489923,;	G	ENSG00000065485	ENST00000316218	Transcript	intron_variant						rs5852324	1		1	PDIA5	HGNC	24811	protein_coding	YES	CCDS3020.1	ENSP00000323313	Q14554	C9JY10	UPI000013148A	NM_006810.3				15/16			0.2927	0.3055		0.3472	0.2932	0.4407										MODIFIER	1	insertion														.	GCG	.	.																					122879295
KALRN	8997	.	GRCh37	3	124160680	124160680	+	Intron	DEL	A	A	-	rs11303558		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.3193-100del			ENST00000240874		5	.	5	0	.	0	KALRN,intron_variant,,ENST00000240874,NM_003947.4;KALRN,intron_variant,,ENST00000354186,;KALRN,intron_variant,,ENST00000360013,NM_001024660.3;KALRN,intron_variant,,ENST00000460856,;KALRN,intron_variant,,ENST00000393501,;	-	ENSG00000160145	ENST00000240874	Transcript	intron_variant						rs11303558	1		1	KALRN	HGNC	4814	protein_coding	YES	CCDS3027.1	ENSP00000240874	O60229		UPI000012C095	NM_003947.4				18/33			0.5295	0.4063		0.4206	0.4573	0.4673										MODIFIER	1	deletion													1	.	AGAA	.	.																					124160679
Unknown	0	.	GRCh37	3	126821413	126821414	+	IGR	INS	-	-	G	rs113174537		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	6	0	.	0		G				intergenic_variant						rs113174537	1																				0.2504	0.2075		0.4087	0.2455	0.32										MODIFIER	1	insertion														.	GTG	.	.																					126821413
ENSR00000397326	0	.	GRCh37	3	127017206	127017206	+	IGR	DEL	A	A	-	rs66736235		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENSR00000397326		5	.	5	0	.	0	,regulatory_region_variant,,ENSR00000397326,;,regulatory_region_variant,,ENSR00001665375,;	-		ENSR00000397326	RegulatoryFeature	regulatory_region_variant						rs66736235	1																				0.7526	0.6427		0.7698	0.5547	0.6155										MODIFIER	1	deletion														.	TTAA	.	.																					127017205
NEK11	79858	.	GRCh37	3	130769722	130769723	+	Intron	INS	-	-	AAAT	rs3072325		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.170+21000_170+21001insAAAT			ENST00000383366		5	.	5	0	.	0	NEK11,intron_variant,,ENST00000356918,;NEK11,intron_variant,,ENST00000383366,NM_024800.4;NEK11,intron_variant,,ENST00000412440,;NEK11,intron_variant,,ENST00000429253,;NEK11,intron_variant,,ENST00000507910,;NEK11,intron_variant,,ENST00000508196,;NEK11,intron_variant,,ENST00000510688,NM_001146003.1;NEK11,intron_variant,,ENST00000510769,;NEK11,intron_variant,,ENST00000511262,NM_145910.3;RP11-265F19.1,downstream_gene_variant,,ENST00000506476,;RP11-265F19.1,downstream_gene_variant,,ENST00000511339,;RP11-265F19.1,downstream_gene_variant,,ENST00000513940,;NEK11,intron_variant,,ENST00000506695,;NEK11,intron_variant,,ENST00000510474,;NEK11,intron_variant,,ENST00000514915,;	AAAT	ENSG00000114670	ENST00000383366	Transcript	intron_variant						rs3072325	1		1	NEK11	HGNC	18593	protein_coding	YES	CCDS3069.1	ENSP00000372857	Q8NG66		UPI000013F25D	NM_024800.4				3/17			0.8941	0.7983		0.5823	0.9404	0.909										MODIFIER	1	insertion														.	AAT	.	.																					130769722
NEK11	79858	.	GRCh37	3	130773173	130773174	+	Intron	INS	-	-	A	rs944570151		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.170+24462dup			ENST00000383366		4	.	4	0	.	0	NEK11,intron_variant,,ENST00000356918,;NEK11,intron_variant,,ENST00000383366,NM_024800.4;NEK11,intron_variant,,ENST00000412440,;NEK11,intron_variant,,ENST00000429253,;NEK11,intron_variant,,ENST00000507910,;NEK11,intron_variant,,ENST00000508196,;NEK11,intron_variant,,ENST00000510688,NM_001146003.1;NEK11,intron_variant,,ENST00000510769,;NEK11,intron_variant,,ENST00000511262,NM_145910.3;RP11-265F19.1,intron_variant,,ENST00000506476,;RP11-265F19.1,intron_variant,,ENST00000511339,;RP11-265F19.1,intron_variant,,ENST00000513940,;NEK11,intron_variant,,ENST00000506695,;NEK11,intron_variant,,ENST00000510474,;NEK11,intron_variant,,ENST00000514915,;	A	ENSG00000114670	ENST00000383366	Transcript	intron_variant						rs944570151	1		1	NEK11	HGNC	18593	protein_coding	YES	CCDS3069.1	ENSP00000372857	Q8NG66		UPI000013F25D	NM_024800.4				3/17																		MODIFIER	1	insertion														.	AGA	.	.																					130773173
CPNE4	131034	.	GRCh37	3	131644397	131644398	+	Intron	INS	-	-	AAGGA	rs10634142		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-1-20110_-1-20109insTCCTT			ENST00000512055		6	.	6	0	.	0	CPNE4,5_prime_UTR_variant,,ENST00000505881,;CPNE4,intron_variant,,ENST00000429747,NM_130808.1;CPNE4,intron_variant,,ENST00000502818,;CPNE4,intron_variant,,ENST00000505957,;CPNE4,intron_variant,,ENST00000511604,;CPNE4,intron_variant,,ENST00000512055,;CPNE4,intron_variant,,ENST00000512332,;CPNE4,intron_variant,,ENST00000514999,;	AAGGA	ENSG00000196353	ENST00000512055	Transcript	intron_variant						rs10634142	1		-1	CPNE4	HGNC	2317	protein_coding	YES	CCDS3072.1	ENSP00000421705	Q96A23	Q4G168,D6RI99,D6RFY4,D6RCT2	UPI0000127C14					5/19																		MODIFIER	1	insertion														.	TGG	.	.																					131644397
ACAD11	84129	.	GRCh37	3	132375693	132375694	+	Intron	INS	-	-	T	rs200968218		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.149+2753dup			ENST00000264990		4	.	4	0	.	0	ACAD11,intron_variant,,ENST00000264990,NM_032169.4;UBA5,intron_variant,,ENST00000264991,NM_198329.2;ACAD11,intron_variant,,ENST00000355458,;ACAD11,intron_variant,,ENST00000481970,;ACAD11,intron_variant,,ENST00000545291,;UBA5,upstream_gene_variant,,ENST00000356232,NM_024818.3;UBA5,upstream_gene_variant,,ENST00000464068,;UBA5,upstream_gene_variant,,ENST00000468022,;UBA5,upstream_gene_variant,,ENST00000473651,;UBA5,upstream_gene_variant,,ENST00000493720,;UBA5,upstream_gene_variant,,ENST00000494238,;ACAD11,intron_variant,,ENST00000489991,;UBA5,upstream_gene_variant,,ENST00000480955,;ACAD11,intron_variant,,ENST00000469042,;NPHP3,intron_variant,,ENST00000471702,;ACAD11,intron_variant,,ENST00000485198,;ACAD11,intron_variant,,ENST00000496418,;UBA5,upstream_gene_variant,,ENST00000464101,;UBA5,upstream_gene_variant,,ENST00000505777,;	T	ENSG00000240303	ENST00000264990	Transcript	intron_variant						rs200968218	1		-1	ACAD11	HGNC	30211	protein_coding	YES	CCDS3074.1	ENSP00000264990	Q709F0	Q08AE9,B4DQ41	UPI00003671B7	NM_032169.4				1/19																		MODIFIER	1	insertion														.	TGT	.	.																					132375693
CLSTN2	64084	.	GRCh37	3	139994119	139994120	+	Intron	INS	-	-	T	rs5852974		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.232+99215dup			ENST00000458420		5	.	5	0	.	0	CLSTN2,intron_variant,,ENST00000458420,NM_022131.2;CLSTN2,intron_variant,,ENST00000511524,;	T	ENSG00000158258	ENST00000458420	Transcript	intron_variant						rs5852974	1		1	CLSTN2	HGNC	17448	protein_coding	YES	CCDS3112.1	ENSP00000402460	Q9H4D0	B3KUA5,B3KU27	UPI00001B0051	NM_022131.2				2/16			0.6694	0.9395		0.9206	0.9076	0.8712										MODIFIER	1	insertion														.	AGT	.	.																					139994119
SLC25A36	55186	.	GRCh37	3	140678385	140678385	+	Splice_Region	DEL	A	A	-	rs76812029		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.284+17del			ENST00000324194		3	.	3	0	.	0	SLC25A36,splice_region_variant,,ENST00000324194,;SLC25A36,splice_region_variant,,ENST00000446041,NM_018155.2,NM_001104647.1;SLC25A36,splice_region_variant,,ENST00000507429,;SLC25A36,intron_variant,,ENST00000453248,;SLC25A36,intron_variant,,ENST00000513887,;SLC25A36,splice_region_variant,,ENST00000393015,;SLC25A36,splice_region_variant,,ENST00000502594,;SLC25A36,splice_region_variant,,ENST00000512023,;SLC25A36,splice_region_variant,,ENST00000512506,;SLC25A36,intron_variant,,ENST00000515813,;SLC25A36,downstream_gene_variant,,ENST00000502756,;	-	ENSG00000114120	ENST00000324194	Transcript	splice_region_variant,intron_variant						rs76812029	1		1	SLC25A36	HGNC	25554	protein_coding	YES	CCDS46927.1	ENSP00000320688	Q96CQ1		UPI000006D558					3/6									0.2647	0.279								LOW	1	deletion														.	GTAA	.	.												0.4193	0.3411	0.3975	0.4193	0.3957	0.4525	0.4108	0.4234	0.4332	140678384
Unknown	0	.	GRCh37	3	141952055	141952056	+	IGR	INS	-	-	AAC	rs66999446		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AAC				intergenic_variant						rs66999446	1																				0.4395	0.2133		0.0635	0.2137	0.1063										MODIFIER	1	insertion														.	CAA	.	.																					141952055
RP11-680B3.2	0	.	GRCh37	3	148651630	148651653	+	Intron	DEL	CACCTTATTTTGATTTAGAACTCC	CACCTTATTTTGATTTAGAACTCC	-	rs67625441		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CACCTTATTTTGATTTAGAACTCC	CACCTTATTTTGATTTAGAACTCC																n.67-22514_67-22491del			ENST00000488190		3	.	3	0	.	0	RP11-680B3.2,intron_variant,,ENST00000488190,;	-	ENSG00000240521	ENST00000488190	Transcript	intron_variant,non_coding_transcript_variant						rs67625441	1		-1	RP11-680B3.2	Clone_based_vega_gene		antisense	YES										1/4			0.7383	0.6571		0.5804	0.6541	0.5235										MODIFIER	1	deletion														.	TTCACCTTATTTTGATTTAGAACTCCC	.	.																					148651629
ANKUB1	389161	.	GRCh37	3	149494764	149494764	+	Intron	DEL	A	A	-	rs11322234		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.451+3262del			ENST00000446160		4	.	4	0	.	0	ANKUB1,intron_variant,,ENST00000383050,;ANKUB1,intron_variant,,ENST00000446160,NM_001144960.1;ANKUB1,intron_variant,,ENST00000462519,;RNU6-507P,downstream_gene_variant,,ENST00000516045,;ANKUB1,downstream_gene_variant,,ENST00000462561,;ANKUB1,downstream_gene_variant,,ENST00000474224,;ANKUB1,downstream_gene_variant,,ENST00000481585,;ANKUB1,intron_variant,,ENST00000484019,;ANKUB1,downstream_gene_variant,,ENST00000474404,;	-	ENSG00000206199	ENST00000446160	Transcript	intron_variant						rs11322234	1		-1	ANKUB1	HGNC	29642	protein_coding	YES		ENSP00000387907		E9PHT4	UPI0000DD7B6F	NM_001144960.1				3/5			0.8147	0.5043		0.3105	0.4254	0.4192										MODIFIER	1	deletion														.	TCAA	.	.																					149494763
IFT80	57560	.	GRCh37	3	159970364	159970365	+	3'Flank	DEL	AC	AC	-	rs141772637		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																			ENST00000326448		4	.	4	0	.	0	IFT80,downstream_gene_variant,,ENST00000326448,NM_020800.2;IFT80,downstream_gene_variant,,ENST00000483465,NM_001190242.1;RP11-432B6.3,intron_variant,,ENST00000483754,;	-	ENSG00000068885	ENST00000326448	Transcript	downstream_gene_variant						rs141772637	1	4409	-1	IFT80	HGNC	29262	protein_coding	YES	CCDS3188.1	ENSP00000312778	Q9P2H3	C9JUJ1,C9JUI1,C9JSB1,C9J6I5,C9J6G8,C9J627,C9IZR2	UPI0000160F16	NM_020800.2							0.0023	0.0317		0.0308	0.0636	0.0368										MODIFIER	1	deletion													1	.	ATACA	.	.																					159970363
Unknown	0	.	GRCh37	3	163172512	163172512	+	IGR	DEL	T	T	-	rs11339888		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	3	3	.	0		-				intergenic_variant						rs11339888	1																				0.0129	0.1715		0.0208	0.2584	0.1483										MODIFIER	1	deletion														.	GGTT	.	.																					163172511
Unknown	0	.	GRCh37	3	166498431	166498432	+	IGR	INS	-	-	T	rs201375924		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					7	.	4	3	.	0		T				intergenic_variant						rs201375924	1																																			MODIFIER	1	insertion														.	AGT	.	.																					166498431
Unknown	0	.	GRCh37	3	169420146	169420146	+	IGR	DEL	C	C	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					4	.	4	3	.	0		-				intergenic_variant							1																																			MODIFIER	1	deletion														.	CTCC	.	.																					169420145
Unknown	0	.	GRCh37	3	171679983	171679983	+	IGR	DEL	A	A	-	rs527947934		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs527947934	1																																			MODIFIER	1	deletion														.	TCAA	.	.																					171679982
TBL1XR1	79718	.	GRCh37	3	176891246	176891247	+	Intron	DEL	CT	CT	-	rs532066507		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CT	CT																c.-122+22881_-122+22882del			ENST00000430069		3	.	3	0	.	0	TBL1XR1,intron_variant,,ENST00000352800,;TBL1XR1,intron_variant,,ENST00000413084,;TBL1XR1,intron_variant,,ENST00000422066,;TBL1XR1,intron_variant,,ENST00000422442,;TBL1XR1,intron_variant,,ENST00000424913,;TBL1XR1,intron_variant,,ENST00000427349,;TBL1XR1,intron_variant,,ENST00000428970,;TBL1XR1,intron_variant,,ENST00000430069,;TBL1XR1,intron_variant,,ENST00000431421,;TBL1XR1,intron_variant,,ENST00000431674,;TBL1XR1,intron_variant,,ENST00000437738,;TBL1XR1,intron_variant,,ENST00000443315,;TBL1XR1,intron_variant,,ENST00000450267,;TBL1XR1,intron_variant,,ENST00000457928,NM_024665.4;	-	ENSG00000177565	ENST00000430069	Transcript	intron_variant						rs532066507	1		-1	TBL1XR1	HGNC	29529	protein_coding	YES	CCDS46961.1	ENSP00000405574	Q9BZK7	C9JY82,C9JTW8,C9JLJ1,C9JEC9,C9JCW4,C9JCK0,C9JBN1,C9J903,C9J7E1,C9J3H2,C9IYU9	UPI0000136A71					1/15																		MODIFIER	1	deletion													1	.	CCCTG	.	.																					176891245
ENSR00000307701	0	.	GRCh37	3	179033779	179033792	+	IGR	DEL	GTGTGTGTGTGTGA	GTGTGTGTGTGTGA	-	rs141895903		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GTGTGTGTGTGTGA	GTGTGTGTGTGTGA																			ENSR00000307701		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00000307701,;,regulatory_region_variant,,ENSR00001670402,;,TF_binding_site_variant,,ENSM00885286330,;,TF_binding_site_variant,,ENSM00835401617,;,TF_binding_site_variant,,ENSM00908028710,;,TF_binding_site_variant,,ENSM00525547454,;,TF_binding_site_variant,,ENSM00826607244,;,TF_binding_site_variant,,ENSM00908979066,;,TF_binding_site_variant,,ENSM00909008431,;,TF_binding_site_variant,,ENSM00687464333,;	-		ENSR00000307701	RegulatoryFeature	regulatory_region_variant						rs141895903	1																																			MODIFIER		deletion														.	GTGTGTGTGTGTGTGAT	.	.																					179033778
ENSR00001281119	0	.	GRCh37	3	181951919	181951920	+	IGR	INS	-	-	C	rs11381023		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001281119		4	.	4	0	.	0	,regulatory_region_variant,,ENSR00001281119,;	C		ENSR00001281119	RegulatoryFeature	regulatory_region_variant						rs11381023	1																				0.8729	0.33		0.6429	0.3121	0.407										MODIFIER	1	insertion														.	CAC	.	.																					181951919
EPHB3	2049	.	GRCh37	3	184276159	184276159	+	5'Flank	DEL	C	C	-	rs11330305		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENST00000330394		7	.	4	4	.	0	EIF2B5,intron_variant,,ENST00000444495,;EPHB3,upstream_gene_variant,,ENST00000330394,NM_004443.3;EIF2B5-AS1,upstream_gene_variant,,ENST00000421870,;,regulatory_region_variant,,ENSR00001670911,;	-	ENSG00000182580	ENST00000330394	Transcript	upstream_gene_variant						rs11330305	1	3413	1	EPHB3	HGNC	3394	protein_coding	YES	CCDS3268.1	ENSP00000332118	P54753	D3DNT9	UPI0000161C94	NM_004443.3							0.5318	0.2378		0.0933	0.4016	0.3661										MODIFIER	1	deletion														.	GTCC	.	.																					184276158
IGF2BP2	10644	.	GRCh37	3	185505521	185505521	+	Intron	DEL	A	A	-	rs5855073		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.239+35420del			ENST00000382199		3	.	3	0	.	0	IGF2BP2,intron_variant,,ENST00000346192,NM_001007225.1;IGF2BP2,intron_variant,,ENST00000382199,NM_006548.4;IGF2BP2,intron_variant,,ENST00000421047,;IGF2BP2,intron_variant,,ENST00000457616,;IGF2BP2,intron_variant,,ENST00000461957,;IGF2BP2,intron_variant,,ENST00000466476,;IGF2BP2,intron_variant,,ENST00000493302,;,regulatory_region_variant,,ENSR00001281993,;	-	ENSG00000073792	ENST00000382199	Transcript	intron_variant						rs5855073	1		-1	IGF2BP2	HGNC	28867	protein_coding	YES	CCDS3273.2	ENSP00000371634	Q9Y6M1		UPI000013C5B6	NM_006548.4				2/15			0.674	0.3055		0.2718	0.3141	0.4591										MODIFIER	1	deletion													1	.	TCAA	.	.																					185505520
LPP	4026	.	GRCh37	3	188242730	188242735	+	Intron	DEL	TCCTTC	TCCTTC	-	rs759936614		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCCTTC	TCCTTC																c.429+155_429+160del			ENST00000312675		8	5	3	6	6	0	LPP,intron_variant,,ENST00000312675,NM_005578.3,NM_001167672.1;LPP,intron_variant,,ENST00000416784,;LPP,intron_variant,,ENST00000448637,;LPP,intron_variant,,ENST00000543006,NM_001167671.1,NM_001167672.1;LPP,downstream_gene_variant,,ENST00000420410,;LPP,intron_variant,,ENST00000484468,;LPP,intron_variant,,ENST00000494233,;LPP,downstream_gene_variant,,ENST00000474472,;	-	ENSG00000145012	ENST00000312675	Transcript	intron_variant						rs759936614	1		1	LPP	HGNC	6679	protein_coding	YES	CCDS3291.1	ENSP00000318089	Q93052	C9JT42,C9JIY7,C9JE51,C9J5C8,C9J4E3,C9J3U9,C9J2R5,C9J1K7,B7Z871	UPI000002E034	NM_005578.3,NM_001167672.1				5/10																		MODIFIER	1	deletion													1	.	CTTCCTTCC	.	.																					188242729
LPP	4026	.	GRCh37	3	188609143	188609143	+	3'Flank	DEL	T	T	-	rs10713217		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000312675		4	.	4	0	.	0	LPP,downstream_gene_variant,,ENST00000312675,NM_005578.3,NM_001167672.1;LPP,downstream_gene_variant,,ENST00000543006,NM_001167671.1,NM_001167672.1;	-	ENSG00000145012	ENST00000312675	Transcript	downstream_gene_variant						rs10713217	1	683	1	LPP	HGNC	6679	protein_coding	YES	CCDS3291.1	ENSP00000318089	Q93052	C9JT42,C9JIY7,C9JE51,C9J5C8,C9J4E3,C9J3U9,C9J2R5,C9J1K7,B7Z871	UPI000002E034	NM_005578.3,NM_001167672.1							0.9561	0.8732		0.9593	0.7863	0.8814										MODIFIER	1	deletion													1	.	CCTT	.	.																					188609142
AC067718.1	0	.	GRCh37	3	189858863	189858885	+	5'Flank	DEL	TGGTCTGGGAAGGAGTATAAATT	TGGTCTGGGAAGGAGTATAAATT	-	rs146774400		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGGTCTGGGAAGGAGTATAAATT	TGGTCTGGGAAGGAGTATAAATT																			ENST00000516924		3	.	3	0	.	0	AC067718.1,upstream_gene_variant,,ENST00000516924,;LEPREL1-AS1,intron_variant,,ENST00000412203,;	-	ENSG00000252733	ENST00000516924	Transcript	upstream_gene_variant						rs146774400	1	2560	1	AC067718.1	Clone_based_ensembl_gene		miRNA	YES												0.4613	0.4463	0.5389		0.251	0.6461	0.453										MODIFIER		deletion														.	TCTGGTCTGGGAAGGAGTATAAATTG	.	.																					189858862
ATP13A4	84239	.	GRCh37	3	193130296	193130311	+	Intron	DEL	ACACACACACACACAC	ACACACACACACACAC	-	rs58979821		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACACACACACACAC	ACACACACACACACAC																c.3015-151_3015-136del			ENST00000342695		3	.	3	9	.	1	ATP13A4,intron_variant,,ENST00000342695,NM_032279.2;ATP13A4,intron_variant,,ENST00000392443,;ATP13A4,intron_variant,,ENST00000400270,;ATP13A4,upstream_gene_variant,,ENST00000482964,;ATP13A4,intron_variant,,ENST00000428352,;ATP13A4,intron_variant,,ENST00000450950,;	-	ENSG00000127249	ENST00000342695	Transcript	intron_variant						rs58979821	1		-1	ATP13A4	HGNC	25422	protein_coding	YES	CCDS3304.2	ENSP00000339182	Q4VNC1		UPI0000520D50	NM_032279.2				26/29																		MODIFIER	1	deletion														.	AAACACACACACACACACA	.	.																					193130295
DLG1	1739	.	GRCh37	3	196786504	196786505	+	Intron	INS	-	-	CACTAGTCACTATTTACACTAGTCA	rs71623333		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2582+255_2582+256insTGACTAGTGTAAATAGTGACTAGTG			ENST00000346964		3	.	3	0	.	0	DLG1,intron_variant,,ENST00000314062,;DLG1,intron_variant,,ENST00000346964,NM_004087.2;DLG1,intron_variant,,ENST00000357674,NM_001204386.1;DLG1,intron_variant,,ENST00000392382,;DLG1,intron_variant,,ENST00000419354,;DLG1,intron_variant,,ENST00000422288,;DLG1,intron_variant,,ENST00000443183,NM_001204387.1;DLG1,intron_variant,,ENST00000448528,NM_001098424.1;DLG1,intron_variant,,ENST00000450955,;DLG1,intron_variant,,ENST00000452595,NM_001204388.1;DLG1,intron_variant,,ENST00000469371,;DLG1,intron_variant,,ENST00000475394,;	CACTAGTCACTATTTACACTAGTCA	ENSG00000075711	ENST00000346964	Transcript	intron_variant						rs71623333	1		-1	DLG1	HGNC	2900	protein_coding	YES	CCDS3327.1	ENSP00000345731	Q12959	F2Z2L0,C9JUA9,C9JN61,C9J110,A8MUT6	UPI000013CD24	NM_004087.2				24/25			0.7731	0.7161		0.8254	0.7505	0.7751										MODIFIER	1	insertion													1	.	GCC	.	.																					196786504
WHSC1	7468	.	GRCh37	4	1935820	1935821	+	Intron	INS	-	-	T	rs1169656491		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1556-1041dup			ENST00000382895		4	.	4	0	.	0	WHSC1,intron_variant,,ENST00000382891,NM_133335.3;WHSC1,intron_variant,,ENST00000382892,NM_133331.2;WHSC1,intron_variant,,ENST00000382895,NM_133330.2;WHSC1,intron_variant,,ENST00000398261,NM_133334.2;WHSC1,intron_variant,,ENST00000420906,NM_007331.1;WHSC1,intron_variant,,ENST00000503128,;WHSC1,intron_variant,,ENST00000508803,NM_001042424.2;WHSC1,intron_variant,,ENST00000514045,;WHSC1,intron_variant,,ENST00000513726,;WHSC1,intron_variant,,ENST00000312087,;WHSC1,intron_variant,,ENST00000353275,;WHSC1,intron_variant,,ENST00000511904,;	T	ENSG00000109685	ENST00000382895	Transcript	intron_variant						rs1169656491	1		1	WHSC1	HGNC	12766	protein_coding	YES	CCDS33940.1	ENSP00000372351	O96028	D6RIS1,D6RFE7,D6R9V2	UPI0000073F57	NM_133330.2				8/23																		MODIFIER	1	insertion													1	.	CGT	.	.																					1935820
RGS12	6002	.	GRCh37	4	3370157	3370162	+	Intron	DEL	GTGTGG	GTGTGG	-	rs72235502		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GTGTGG	GTGTGG																c.1999-17983_1999-17978del			ENST00000344733		6	4	2	5	5	0	RGS12,intron_variant,,ENST00000306648,;RGS12,intron_variant,,ENST00000336727,NM_002926.3;RGS12,intron_variant,,ENST00000344733,NM_198229.2;RGS12,intron_variant,,ENST00000382788,;RGS12,intron_variant,,ENST00000543385,;RGS12,upstream_gene_variant,,ENST00000338806,NM_198227.1;RGS12,intron_variant,,ENST00000511805,;RGS12,intron_variant,,ENST00000513784,;RGS12,intron_variant,,ENST00000506631,;RGS12,intron_variant,,ENST00000514268,;RGS12,upstream_gene_variant,,ENST00000506998,;	-	ENSG00000159788	ENST00000344733	Transcript	intron_variant						rs72235502	1		1	RGS12	HGNC	9994	protein_coding	YES	CCDS3366.1	ENSP00000339381	O14924	Q69YN1,Q56A82,E9PBG5	UPI0000133830	NM_198229.2				3/17																		MODIFIER	1	deletion														.	GTGTGTGGG	.	.																					3370156
LINC00955	0	.	GRCh37	4	3585546	3585547	+	Intron	DEL	AT	AT	-	rs5855805		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																c.-31-4055_-31-4054del			ENST00000514422		4	.	4	0	.	0	LINC00955,intron_variant,,ENST00000514422,;LINC00955,intron_variant,,ENST00000502775,;	-	ENSG00000216560	ENST00000514422	Transcript	intron_variant						rs5855805	1		1	LINC00955	HGNC	26644	protein_coding	YES		ENSP00000427553		E7ETJ0	UPI0000160C3E					1/2																		MODIFIER	1	deletion														.	CGATA	.	.																					3585545
Unknown	0	.	GRCh37	4	3601952	3601952	+	IGR	DEL	T	T	-	rs67516442		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					7	.	3	10	.	0		-				intergenic_variant						rs67516442	1																																			MODIFIER	1	deletion														.	ACTT	.	.																					3601951
Unknown	0	.	GRCh37	4	3610868	3610868	+	IGR	DEL	A	A	-	rs11321586		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs11321586	1																																			MODIFIER	1	deletion														.	CCAA	.	.																					3610867
Unknown	0	.	GRCh37	4	3622445	3622446	+	IGR	INS	-	-	G	rs113544798		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	4	4	.	0		G				intergenic_variant						rs113544798	1																																			MODIFIER	1	insertion														.	GAG	.	.																					3622445
ZBTB49	166793	.	GRCh37	4	4306671	4306672	+	Intron	INS	-	-	AGT	rs10623694		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1256-1194_1256-1193insAGT			ENST00000337872		6	4	2	4	4	0	ZBTB49,intron_variant,,ENST00000337872,NM_145291.3;ZBTB49,intron_variant,,ENST00000355834,;ZBTB49,intron_variant,,ENST00000504302,;ZBTB49,intron_variant,,ENST00000538529,;ZBTB49,downstream_gene_variant,,ENST00000502918,;ZBTB49,intron_variant,,ENST00000503703,;ZBTB49,intron_variant,,ENST00000511458,;ZBTB49,intron_variant,,ENST00000515012,;	AGT	ENSG00000168826	ENST00000337872	Transcript	intron_variant						rs10623694	1		1	ZBTB49	HGNC	19883	protein_coding	YES	CCDS3375.1	ENSP00000338807	Q6ZSB9	Q32MK9,D6RJ00	UPI000022C559	NM_145291.3				3/7			0.8434	0.8775		0.7589	0.834	0.771										MODIFIER	1	insertion														.	AGG	.	.																					4306671
MSX1	4487	.	GRCh37	4	4864405	4864405	+	Intron	DEL	T	T	-	rs33929633		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.470-15del			ENST00000382723		3	.	3	0	.	0	MSX1,intron_variant,,ENST00000382723,NM_002448.3;MSX1,intron_variant,,ENST00000468421,;,regulatory_region_variant,,ENSR00001673369,;	-	ENSG00000163132	ENST00000382723	Transcript	intron_variant						rs33929633	1		1	MSX1	HGNC	7391	protein_coding	YES	CCDS3378.2	ENSP00000372170	P28360	E9KY19,E9KY18,E9KY17,E9KY16,E9KY15,E9KY14,E9KY13,E9KY12,E9KY11,E9KY10,E9KY09,E9KY08,E9KY07,E9KY06,E9KY05,E9KY04,E9KY03,E9KY02,E9KY01,E9KY00,E9KXZ9,E9KXZ8,E9KXZ7,E9KXZ6,E9KXZ5,E9KXZ4,E9KXZ3,E9KXZ2,E9KXZ1,E9KXZ0,E9KXY9,E9KXY8,E9KXY7,E9KXY6,E9KXY5,E9KXY4,E9KXY3,E9KXY2,E9KXY1,E9KXY0,E9KXX9,E9KXX8,E9KXX7,E9KXX6,E9KXX5,E9KXX4,E9KXX3,E9KXX2,E9KXX1,E9KXX0,E9KXW9,E9KXW8,E9KXW7,E9KXW6,E9KXW5,E9KXW4,E9KXW3,E9KXW2,E9KXW1,E9KXW0,E9KXV9,E9KXV8,E9KXV7,E9KXV6,E9KXV5,E9KXV4,E9KXV3,E9KXV2,E9KXV1,E9KXV0,E9KXU9,E9KXU8,E9KXU7,E9KXU6,E9KXU5,E9KXU4,E9KXU3,E9KXU2,E9KXU1,E9KXU0,E9KXT9,E9KXT8,E9KXT7,E9KXT6,E9KXT5,E9KXT4,E9KXT3,E9KXT2,E9KXT1,E9KXT0,E9KXS9,E9KXS8,E9KXS7,E9KXS6,A0SZU5	UPI0000D474F4	NM_002448.3				1/1			0.2579	0.1614		0.0615	0.2326	0.2055	0.2537	0.2419								MODIFIER	1	deletion													1	.	GCTT	.	.												0.2167	0.2539	0.1284	0.4022	0.04753	0.2663	0.2359	0.243	0.2371	4864404
AFAP1	60312	.	GRCh37	4	7849826	7849827	+	Intron	INS	-	-	GAAGGGAG	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.335-4750_335-4749insCTCCCTTC			ENST00000420658		3	.	3	0	.	0	AFAP1,intron_variant,,ENST00000358461,NM_198595.2;AFAP1,intron_variant,,ENST00000360265,;AFAP1,intron_variant,,ENST00000382543,;AFAP1,intron_variant,,ENST00000420658,NM_001134647.1;AFAP1,intron_variant,,ENST00000513856,;	GAAGGGAG	ENSG00000196526	ENST00000420658	Transcript	intron_variant							1		-1	AFAP1	HGNC	24017	protein_coding	YES	CCDS47010.1	ENSP00000410689	Q8N556		UPI000048041E	NM_001134647.1				4/17																		MODIFIER	1	insertion														.	AAG	.	.																					7849826
DRD5	1816	.	GRCh37	4	9779175	9779176	+	5'Flank	INS	-	-	GT	rs35243947		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000304374		4	.	4	0	.	0	DRD5,upstream_gene_variant,,ENST00000304374,NM_000798.4;SLC2A9,intron_variant,,ENST00000508585,;SLC2A9,downstream_gene_variant,,ENST00000503803,;	GT	ENSG00000169676	ENST00000304374	Transcript	upstream_gene_variant						rs35243947	1	4082	1	DRD5	HGNC	3026	protein_coding	YES	CCDS3405.1	ENSP00000306129	P21918		UPI000004E905	NM_000798.4							0.8941	0.8545		0.8185	0.9573	0.8262										MODIFIER	1	insertion													1	.	CAG	.	.																					9779175
SLC2A9	56606	.	GRCh37	4	10013292	10013295	+	Intron	DEL	AGAC	AGAC	-	rs3834235		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGAC	AGAC																c.249+7304_249+7307del			ENST00000264784		7	.	7	0	.	0	SLC2A9,intron_variant,,ENST00000264784,NM_020041.2;SLC2A9,intron_variant,,ENST00000309065,NM_001001290.1;SLC2A9,intron_variant,,ENST00000506583,;SLC2A9,intron_variant,,ENST00000513129,;RP11-448G15.1,downstream_gene_variant,,ENST00000503493,;SLC2A9,intron_variant,,ENST00000505104,;SLC2A9,intron_variant,,ENST00000505506,;SLC2A9,intron_variant,,ENST00000506839,;,regulatory_region_variant,,ENSR00001674062,;	-	ENSG00000109667	ENST00000264784	Transcript	intron_variant						rs3834235	1		-1	SLC2A9	HGNC	13446	protein_coding	YES	CCDS3407.1	ENSP00000264784	Q9NRM0		UPI000013D56E	NM_020041.2				2/11			0.149	0.4409		0.4177	0.5278	0.6033										MODIFIER	1	deletion													1	.	TTAGACA	.	.																					10013291
AC006499.7	0	.	GRCh37	4	10171748	10171752	+	5'Flank	DEL	GGGGG	GGGGG	-	rs10533635		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GGGGG	GGGGG																			ENST00000511169		3	.	3	0	.	0	AC006499.7,upstream_gene_variant,,ENST00000511169,;,regulatory_region_variant,,ENSR00001674084,;	-	ENSG00000251296	ENST00000511169	Transcript	upstream_gene_variant						rs10533635	1	2359	-1	AC006499.7	Clone_based_vega_gene		processed_pseudogene	YES																												MODIFIER	1	deletion														.	CTGGGGGG	.	.																					10171747
Unknown	0	.	GRCh37	4	12098942	12098943	+	IGR	INS	-	-	A	rs35619061		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		A				intergenic_variant						rs35619061	1																				0.093	0.3991		0.624	0.4066	0.3405										MODIFIER	1	insertion														.	ATA	.	.																					12098942
RP11-341G5.1	101929071	.	GRCh37	4	13861795	13861796	+	Intron	INS	-	-	A	rs201390920		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.349+30337dup			ENST00000510907		3	.	3	0	.	0	RP11-341G5.1,intron_variant,,ENST00000503532,;RP11-341G5.1,intron_variant,,ENST00000510907,;,regulatory_region_variant,,ENSR00001288287,;,regulatory_region_variant,,ENSR00001288288,;	A	ENSG00000250634	ENST00000510907	Transcript	intron_variant,non_coding_transcript_variant						rs201390920	1		1	RP11-341G5.1	Clone_based_vega_gene		lincRNA	YES										3/3																		MODIFIER	1	insertion														.	TTA	.	.																					13861795
LINC00504	0	.	GRCh37	4	14538046	14538052	+	Intron	DEL	CAGGAGG	CAGGAGG	-	rs144927943		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAGGAGG	CAGGAGG																n.461+35719_461+35725del			ENST00000505089		3	.	3	0	.	0	LINC00504,intron_variant,,ENST00000505089,;LINC00504,intron_variant,,ENST00000509654,;LINC00504,intron_variant,,ENST00000515031,;,regulatory_region_variant,,ENSR00001288433,;	-	ENSG00000248360	ENST00000505089	Transcript	intron_variant,non_coding_transcript_variant						rs144927943	1		-1	LINC00504	HGNC	43555	lincRNA	YES										5/6			0.2905	0.634		0.7351	0.6581	0.4632										MODIFIER	1	deletion														.	CTCAGGAGGC	.	.																					14538045
PROM1	8842	.	GRCh37	4	16001915	16001915	+	Intron	DEL	T	T	-	rs569735780		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1578+204del			ENST00000510224		4	.	3	6	.	0	PROM1,intron_variant,,ENST00000447510,NM_006017.2;PROM1,intron_variant,,ENST00000505450,NM_001145848.1;PROM1,intron_variant,,ENST00000508167,NM_001145847.1;PROM1,intron_variant,,ENST00000510224,;PROM1,intron_variant,,ENST00000539194,NM_001145850.1,NM_001145852.1;PROM1,intron_variant,,ENST00000540805,NM_001145849.1,NM_001145851.1;PROM1,intron_variant,,ENST00000543373,;PROM1,downstream_gene_variant,,ENST00000511153,;	-	ENSG00000007062	ENST00000510224	Transcript	intron_variant						rs569735780	1		-1	PROM1	HGNC	9454	protein_coding	YES	CCDS47029.1	ENSP00000426809	O43490	D6RIF3,D6RBI0	UPI000004ECD6					14/27																		MODIFIER	1	deletion													1	.	TATT	.	.																					16001914
LCORL	254251	.	GRCh37	4	17943476	17943476	+	Intron	DEL	T	T	-	rs10716443		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.430+20050del			ENST00000382226		3	.	3	0	.	0	LCORL,intron_variant,,ENST00000326877,NM_153686.7;LCORL,intron_variant,,ENST00000382224,;LCORL,intron_variant,,ENST00000382226,NM_001166139.1;LCORL,intron_variant,,ENST00000539056,;LCORL,intron_variant,,ENST00000510121,;LCORL,intron_variant,,ENST00000510451,;	-	ENSG00000178177	ENST00000382226	Transcript	intron_variant						rs10716443	1		-1	LCORL	HGNC	30776	protein_coding	YES	CCDS54749.1	ENSP00000371661	Q8N3X6	C9JI46	UPI00015E0F98	NM_001166139.1				4/6			0.6649	0.5677		0.4524	0.6292	0.5951										MODIFIER	1	deletion														.	AATT	.	.																					17943475
RP11-3J1.1	0	.	GRCh37	4	19226696	19226697	+	Intron	INS	-	-	A	rs34431881		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.450-52548dup			ENST00000505347		3	.	3	0	.	0	RP11-3J1.1,intron_variant,,ENST00000505347,;,regulatory_region_variant,,ENSR00001674861,;	A	ENSG00000248238	ENST00000505347	Transcript	intron_variant,non_coding_transcript_variant						rs34431881	1		-1	RP11-3J1.1	Clone_based_vega_gene		lincRNA	YES										2/2			0.4191	0.3372		0.4236	0.5189	0.5297										MODIFIER	1	insertion														.	TTA	.	.																					19226696
RP11-3J1.1	0	.	GRCh37	4	19424519	19424521	+	Intron	DEL	AAG	AAG	-	rs56006506		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAG	AAG																n.349+33748_349+33750del			ENST00000505347		3	.	3	0	.	0	RP11-3J1.1,intron_variant,,ENST00000505347,;	-	ENSG00000248238	ENST00000505347	Transcript	intron_variant,non_coding_transcript_variant						rs56006506	1		-1	RP11-3J1.1	Clone_based_vega_gene		lincRNA	YES										1/2																		MODIFIER	1	deletion														.	AAAAGA	.	.																					19424518
KCNIP4	80333	.	GRCh37	4	21097243	21097244	+	Intron	DEL	TA	TA	-	rs60360345		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TA	TA																c.62-212912_62-212911del			ENST00000382152		3	.	3	0	.	0	KCNIP4,intron_variant,,ENST00000382148,NM_001035003.1;KCNIP4,intron_variant,,ENST00000382150,NM_147183.3;KCNIP4,intron_variant,,ENST00000382152,NM_025221.5;KCNIP4,intron_variant,,ENST00000447367,NM_147182.3,NM_147181.3;KCNIP4,intron_variant,,ENST00000509207,NM_001035004.1;KCNIP4,intron_variant,,ENST00000515786,;	-	ENSG00000185774	ENST00000382152	Transcript	intron_variant						rs60360345	1		-1	KCNIP4	HGNC	30083	protein_coding	YES	CCDS43216.1	ENSP00000371587	Q6PIL6		UPI000004A274	NM_025221.5				1/8			0.1437	0.1527		0.2262	0.2018	0.136										MODIFIER	1	deletion														.	GCTAT	.	.																					21097242
KCNIP4	80333	.	GRCh37	4	21699660	21699660	+	Intron	DEL	T	T	-	rs34358099		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.61+250534del			ENST00000382152		7	.	5	4	.	0	KCNIP4,intron_variant,,ENST00000382152,NM_025221.5;KCNIP4,intron_variant,,ENST00000447367,NM_147182.3,NM_147181.3;KCNIP4,upstream_gene_variant,,ENST00000382148,NM_001035003.1;RP11-556G22.2,intron_variant,,ENST00000511835,;KCNIP4,intron_variant,,ENST00000515786,;,regulatory_region_variant,,ENSR00000166624,;	-	ENSG00000185774	ENST00000382152	Transcript	intron_variant						rs34358099	1		-1	KCNIP4	HGNC	30083	protein_coding	YES	CCDS43216.1	ENSP00000371587	Q6PIL6		UPI000004A274	NM_025221.5				1/8			0.9039	0.5562		0.3026	0.6103	0.4417										MODIFIER	1	deletion														.	CCTT	.	.																					21699659
PPARGC1A	10891	.	GRCh37	4	23900707	23900709	+	Intron	DEL	CCC	CCC	-	rs35314800		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCC	CCC																n.52+181_52+183del			ENST00000507342		4	.	4	0	.	0	PPARGC1A,intron_variant,,ENST00000507342,;PPARGC1A,intron_variant,,ENST00000514494,;	-	ENSG00000109819	ENST00000507342	Transcript	intron_variant,non_coding_transcript_variant						rs35314800	1		-1	PPARGC1A	HGNC	9237	processed_transcript											1/3			0.9864	0.6138		0.6478	0.827	0.7454										MODIFIER		deletion													1	.	CACCCC	.	.																					23900706
AC092846.1	0	.	GRCh37	4	24420976	24420979	+	3'Flank	DEL	GTGT	GTGT	-	rs35447720		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GTGT	GTGT																			ENST00000410330		3	.	3	0	.	0	AC092846.1,downstream_gene_variant,,ENST00000410330,;,regulatory_region_variant,,ENSR00000309241,;,regulatory_region_variant,,ENSR00001675175,;	-	ENSG00000222262	ENST00000410330	Transcript	downstream_gene_variant						rs35447720	1	1820	-1	AC092846.1	Clone_based_ensembl_gene		miRNA	YES													0.2511	0.2666		0.2867	0.3857	0.2464										MODIFIER	1	deletion														.	AAGTGTG	.	.																					24420975
Unknown	0	.	GRCh37	4	36755885	36755885	+	IGR	DEL	A	A	-	rs56236281		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs56236281	1																				0.1634	0.4524		0.4038	0.6332	0.6125										MODIFIER	1	deletion														.	ATAA	.	.																					36755884
KLHL5	51088	.	GRCh37	4	39126784	39126785	+	3'Flank	INS	-	-	A	rs36042316		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000504108		3	.	3	0	.	0	KLHL5,intron_variant,,ENST00000359687,;KLHL5,intron_variant,,ENST00000515612,;KLHL5,downstream_gene_variant,,ENST00000261425,NM_001007075.2;KLHL5,downstream_gene_variant,,ENST00000261426,NM_199039.3;KLHL5,downstream_gene_variant,,ENST00000504108,NM_015990.4;KLHL5,downstream_gene_variant,,ENST00000508137,NM_001171654.1;RP11-360F5.1,intron_variant,,ENST00000509449,;	A	ENSG00000109790	ENST00000504108	Transcript	downstream_gene_variant						rs36042316	1	3959	1	KLHL5	HGNC	6356	protein_coding	YES	CCDS33974.1	ENSP00000423897	Q96PQ7	Q642I3	UPI000013D185	NM_015990.4							0.3328	0.5922		0.494	0.5746	0.5348										MODIFIER	1	insertion														.	GGA	.	.																					39126784
Unknown	0	.	GRCh37	4	41867714	41867714	+	IGR	DEL	T	T	-	rs543626264		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	4	0	.	0		-				intergenic_variant						rs543626264	1																																			MODIFIER	1	deletion														.	GATT	.	.																					41867713
GNPDA2	132789	.	GRCh37	4	44727783	44727784	+	Intron	INS	-	-	ACG	rs3046153		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-36+707_-36+708insCGT			ENST00000295448		3	.	3	0	.	0	GNPDA2,intron_variant,,ENST00000295448,NM_138335.2;GNPDA2,intron_variant,,ENST00000507534,NM_001270881.1;GNPDA2,intron_variant,,ENST00000507917,NM_001270880.1;GNPDA2,intron_variant,,ENST00000509756,;GNPDA2,intron_variant,,ENST00000511187,;,regulatory_region_variant,,ENSR00000167984,;	ACG	ENSG00000163281	ENST00000295448	Transcript	intron_variant						rs3046153	1		-1	GNPDA2	HGNC	21526	protein_coding	YES	CCDS3469.1	ENSP00000295448	Q8TDQ7		UPI000004D013	NM_138335.2				1/6			0.4864	0.6499		0.627	0.8419	0.8098										MODIFIER	1	insertion														.	TCA	.	.																					44727783
Unknown	0	.	GRCh37	4	44812172	44812172	+	IGR	DEL	T	T	-	rs34692237		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs34692237	1																				0.2368	0.1585		0.2292	0.2634	0.3405										MODIFIER	1	deletion														.	CCTT	.	.																					44812171
NFXL1	152518	.	GRCh37	4	47901156	47901159	+	Intron	DEL	AAAA	AAAA	-	rs3057881		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAA	AAAA																c.827-22_827-19del			ENST00000507489		3	.	3	0	.	0	NFXL1,intron_variant,,ENST00000329043,;NFXL1,intron_variant,,ENST00000381538,NM_152995.5,NM_001278623.1;NFXL1,intron_variant,,ENST00000507489,NM_001278624.1;NFXL1,intron_variant,,ENST00000464756,;NFXL1,intron_variant,,ENST00000507131,;	-	ENSG00000170448	ENST00000507489	Transcript	intron_variant						rs3057881	1		-1	NFXL1	HGNC	18726	protein_coding	YES	CCDS3478.2	ENSP00000422037	Q6ZNB6		UPI000020BC5D	NM_001278624.1				6/22																		MODIFIER	1	deletion														.	GCAAAAA	.	.												0.1746	0.1514	0.1913	0.1718	0.1127	0.1448	0.1892	0.1901	0.1834	47901155
FRYL	285527	.	GRCh37	4	48555678	48555679	+	Intron	INS	-	-	C	rs202224827		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.4267-279_4267-278insG			ENST00000358350		3	.	3	0	.	0	FRYL,intron_variant,,ENST00000264319,;FRYL,intron_variant,,ENST00000358350,NM_015030.1;FRYL,intron_variant,,ENST00000503238,;FRYL,intron_variant,,ENST00000507711,;FRYL,intron_variant,,ENST00000507873,;FRYL,intron_variant,,ENST00000514617,;FRYL,intron_variant,,ENST00000537810,;FRYL,upstream_gene_variant,,ENST00000502925,;	C	ENSG00000075539	ENST00000358350	Transcript	intron_variant						rs202224827	1		-1	FRYL	HGNC	29127	protein_coding	YES	CCDS43227.1	ENSP00000351113	O94915		UPI0000EBC149	NM_015030.1				35/63																		MODIFIER	1	insertion														.	AAA	.	.																					48555678
FRYL	285527	.	GRCh37	4	48778170	48778170	+	Intron	DEL	T	T	-	rs1257854116		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.-384+3925del			ENST00000358350		3	.	3	0	.	0	FRYL,intron_variant,,ENST00000264319,;FRYL,intron_variant,,ENST00000358350,NM_015030.1;FRYL,intron_variant,,ENST00000507711,;FRYL,intron_variant,,ENST00000537810,;FRYL,intron_variant,,ENST00000502520,;FRYL,intron_variant,,ENST00000505437,;FRYL,intron_variant,,ENST00000509886,;FRYL,intron_variant,,ENST00000514783,;FRYL,intron_variant,,ENST00000515684,;,regulatory_region_variant,,ENSR00001676941,;	-	ENSG00000075539	ENST00000358350	Transcript	intron_variant						rs1257854116	1		-1	FRYL	HGNC	29127	protein_coding	YES	CCDS43227.1	ENSP00000351113	O94915		UPI0000EBC149	NM_015030.1				1/63																		MODIFIER	1	deletion														.	TCTT	.	.																					48778169
Unknown	0	.	GRCh37	4	49106196	49106197	+	IGR	INS	-	-	G	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					17	11	6	8	0	0		G				intergenic_variant							1																																			MODIFIER	1	insertion														.	TTC	.	.																					49106196
Unknown	0	.	GRCh37	4	49156943	49156947	+	IGR	DEL	CATTC	CATTC	-	rs61727951		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CATTC	CATTC																					6	4	2	15	15	0		-				intergenic_variant						rs61727951	1																				0.2148	0.7147		0.2986	0.7157	0.4785										MODIFIER	1	deletion														.	TGCATTCC	.	.																					49156942
Unknown	0	.	GRCh37	4	49318646	49318647	+	IGR	INS	-	-	CCG	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	4	2	4	4	0		CCG				intergenic_variant							1																																			MODIFIER	1	insertion														.	CAC	.	.																					49318646
DCUN1D4	23142	.	GRCh37	4	52752611	52752611	+	Intron	DEL	T	T	-	rs1032194159		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.344-115del			ENST00000334635		4	.	4	0	.	0	DCUN1D4,intron_variant,,ENST00000334635,NM_001040402.1,NM_001287757.1,NM_001287755.1;DCUN1D4,intron_variant,,ENST00000381437,;DCUN1D4,intron_variant,,ENST00000381441,NM_015115.2;DCUN1D4,intron_variant,,ENST00000451288,;DCUN1D4,intron_variant,,ENST00000505403,;DCUN1D4,intron_variant,,ENST00000504113,;DCUN1D4,intron_variant,,ENST00000507659,;DCUN1D4,intron_variant,,ENST00000510587,;DCUN1D4,intron_variant,,ENST00000477560,;DCUN1D4,intron_variant,,ENST00000502930,;DCUN1D4,intron_variant,,ENST00000504923,;DCUN1D4,intron_variant,,ENST00000507741,;DCUN1D4,intron_variant,,ENST00000509068,;DCUN1D4,intron_variant,,ENST00000509376,;DCUN1D4,upstream_gene_variant,,ENST00000505634,;	-	ENSG00000109184	ENST00000334635	Transcript	intron_variant						rs1032194159	1		1	DCUN1D4	HGNC	28998	protein_coding	YES	CCDS33982.1	ENSP00000334625	Q92564	B4DH26	UPI00001C1E10	NM_001040402.1,NM_001287757.1,NM_001287755.1				5/10																		MODIFIER	1	deletion														.	GATT	.	.																					52752610
CHIC2	26511	.	GRCh37	4	54876121	54876122	+	3'UTR	INS	-	-	A	rs34881525		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.*140dup			ENST00000263921	6/6	15	.	3	15	.	0	CHIC2,3_prime_UTR_variant,,ENST00000263921,NM_012110.3;CHIC2,3_prime_UTR_variant,,ENST00000512964,;FIP1L1,intron_variant,,ENST00000507166,;CHIC2,downstream_gene_variant,,ENST00000510894,;	A	ENSG00000109220	ENST00000263921	Transcript	3_prime_UTR_variant	1028-1029/1194					rs34881525	1		-1	CHIC2	HGNC	1935	protein_coding	YES	CCDS3493.1	ENSP00000263921	Q9UKJ5		UPI0000072E65	NM_012110.3			6/6																			MODIFIER	1	insertion													1	.	TTA	.	.																					54876121
RP11-622J8.1	0	.	GRCh37	4	60044633	60044634	+	3'Flank	DEL	GT	GT	-	rs34665779		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																			ENST00000512546		3	.	3	0	.	0	RP11-622J8.1,downstream_gene_variant,,ENST00000512546,;	-	ENSG00000249111	ENST00000512546	Transcript	downstream_gene_variant						rs34665779	1	2769	1	RP11-622J8.1	Clone_based_vega_gene		lincRNA	YES													0.379	0.1037		0.1577	0.0746	0.136										MODIFIER	1	deletion														.	TGGTG	.	.																					60044632
Unknown	0	.	GRCh37	4	63633395	63633395	+	IGR	DEL	G	G	-	rs35223929		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					5	.	5	0	.	0		-				intergenic_variant						rs35223929	1																				0.6717	0.2104		0.7212	0.1769	0.3957										MODIFIER	1	deletion														.	ATGG	.	.																					63633394
Unknown	0	.	GRCh37	4	66638867	66638869	+	IGR	DEL	GCA	GCA	-	rs139904534		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GCA	GCA																					6	4	2	6	6	0		-				intergenic_variant						rs139904534	1																																			MODIFIER	1	deletion														.	ATGCAG	.	.																					66638866
UBA6-AS1	550112	.	GRCh37	4	68661342	68661343	+	Intron	INS	-	-	GATAGATAGATA	rs61358309		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.1905+40390_1905+40401dup			ENST00000500538		3	.	3	0	.	0	UBA6-AS1,intron_variant,,ENST00000500538,;	GATAGATAGATA	ENSG00000248049	ENST00000500538	Transcript	intron_variant,non_coding_transcript_variant						rs61358309	1		1	UBA6-AS1	HGNC	49083	antisense	YES										6/7																		MODIFIER	1	insertion														.	TGG	.	.																					68661342
UGT2B17	7367	.	GRCh37	4	69433999	69433999	+	Frame_Shift_Del	DEL	T	T	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.204del	p.Lys68AsnfsTer7	p.K68Nfs*7	ENST00000317746	1/6	28	.	21	40	.	40	UGT2B17,frameshift_variant,p.Lys68AsnfsTer7,ENST00000317746,NM_001077.3;	-	ENSG00000197888	ENST00000317746	Transcript	frameshift_variant	247/2077	204/1593	68/530	K/X	aaA/aa		1		-1	UGT2B17	HGNC	12547	protein_coding	YES	CCDS3523.1	ENSP00000320401	O75795		UPI0000137A9C	NM_001077.3			1/6		Superfamily:SSF53756,Pfam:PF00201,PANTHER:PTHR11926,PANTHER:PTHR11926:SF178																	HIGH	1	deletion													1	.	GATT	.	.																					69433998
RP11-813N20.1	0	.	GRCh37	4	69867747	69867747	+	3'Flank	DEL	T	T	-	rs35106257		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000505092		5	.	4	3	.	0	RP11-813N20.1,downstream_gene_variant,,ENST00000425704,;RP11-813N20.1,downstream_gene_variant,,ENST00000505092,;RP11-468N14.11,upstream_gene_variant,,ENST00000509604,;	-	ENSG00000251685	ENST00000505092	Transcript	downstream_gene_variant						rs35106257	1	2833	-1	RP11-813N20.1	Clone_based_vega_gene		unprocessed_pseudogene	YES													0.1452	0.3545		0.1458	0.6292	0.5654										MODIFIER		deletion														.	TATT	.	.																					69867746
C4orf40	401137	.	GRCh37	4	71035083	71035084	+	3'Flank	DEL	TT	TT	-	rs35990538		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																			ENST00000344526		3	.	3	0	.	0	C4orf40,downstream_gene_variant,,ENST00000344526,NM_214711.3;C4orf40,downstream_gene_variant,,ENST00000502294,;C4orf40,intron_variant,,ENST00000512173,;C4orf40,downstream_gene_variant,,ENST00000509633,;	-	ENSG00000187533	ENST00000344526	Transcript	downstream_gene_variant						rs35990538	1	4427	1	C4orf40	HGNC	33193	protein_coding	YES	CCDS3535.1	ENSP00000343172	Q6MZM9		UPI0000036170	NM_214711.3						0.7472	0.4077	0.8674		0.995	0.8817	0.727										MODIFIER	1	deletion														.	ACTTA	.	.																					71035082
RNU6-891P	0	.	GRCh37	4	71719871	71719872	+	3'Flank	INS	-	-	G	rs11370678		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000384280		3	.	3	0	.	0	RNU6-891P,downstream_gene_variant,,ENST00000384280,;	G	ENSG00000207007	ENST00000384280	Transcript	downstream_gene_variant						rs11370678	1	1914	1	RNU6-891P	HGNC	47854	snRNA	YES													0.8654	0.9914		1	1	1										MODIFIER	1	insertion														.	AAT	.	.																					71719871
GC	2638	.	GRCh37	4	72634193	72634193	+	Intron	DEL	T	T	-	rs375061055		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.186-43del			ENST00000504199		20	.	3	14	.	0	GC,intron_variant,,ENST00000273951,NM_001204306.1,NM_000583.3;GC,intron_variant,,ENST00000504199,NM_001204307.1;GC,intron_variant,,ENST00000506245,;GC,intron_variant,,ENST00000513476,;GC,intron_variant,,ENST00000503472,;GC,intron_variant,,ENST00000505234,;GC,intron_variant,,ENST00000509740,;	-	ENSG00000145321	ENST00000504199	Transcript	intron_variant						rs375061055	1		-1	GC	HGNC	4187	protein_coding	YES	CCDS56332.1	ENSP00000421725	P02774	D6RF20	UPI0001D3B4EE	NM_001204307.1				3/13									0.1011	0.09542								MODIFIER	1	deletion													1	.	GGTT	.	.												0.04799	0.04054	0.05262	0.0623	0.0488	0.02249	0.05001	0.05665	0.05554	72634192
RCHY1	25898	.	GRCh37	4	76438206	76438207	+	Intron	INS	-	-	G	rs111447343		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.90+1200dup			ENST00000324439		6	.	6	0	.	0	RCHY1,intron_variant,,ENST00000324439,;RCHY1,intron_variant,,ENST00000380840,;RCHY1,intron_variant,,ENST00000451788,NM_001278538.1,NM_001278536.1,NM_001009922.2,NM_015436.3,NM_001278539.1;RCHY1,intron_variant,,ENST00000507014,NM_001278537.1;RCHY1,intron_variant,,ENST00000512706,;RCHY1,intron_variant,,ENST00000513257,;THAP6,upstream_gene_variant,,ENST00000311638,NM_144721.4;THAP6,upstream_gene_variant,,ENST00000380837,;THAP6,upstream_gene_variant,,ENST00000502620,;THAP6,upstream_gene_variant,,ENST00000504190,;THAP6,upstream_gene_variant,,ENST00000504218,;THAP6,upstream_gene_variant,,ENST00000506261,;THAP6,upstream_gene_variant,,ENST00000507556,;THAP6,upstream_gene_variant,,ENST00000507557,;THAP6,upstream_gene_variant,,ENST00000507885,;THAP6,upstream_gene_variant,,ENST00000508105,;THAP6,upstream_gene_variant,,ENST00000514480,;RCHY1,intron_variant,,ENST00000514021,;RCHY1,intron_variant,,ENST00000504085,;RCHY1,intron_variant,,ENST00000505105,;RCHY1,intron_variant,,ENST00000513083,;RCHY1,intron_variant,,ENST00000513909,;RCHY1,intron_variant,,ENST00000514589,;THAP6,upstream_gene_variant,,ENST00000503831,;THAP6,upstream_gene_variant,,ENST00000504384,;RCHY1,upstream_gene_variant,,ENST00000505514,;,regulatory_region_variant,,ENSR00000169398,;,TF_binding_site_variant,,ENSM00650856806,;	G	ENSG00000163743	ENST00000324439	Transcript	intron_variant						rs111447343	1		-1	RCHY1	HGNC	17479	protein_coding	YES	CCDS3567.1	ENSP00000321239	Q96PM5	G3FDP5,G3FDP4,D6RAF6	UPI000013C366					1/8			0.3775	0.2406		0.2212	0.2187	0.2464										MODIFIER	1	insertion														.	ATG	.	.																					76438206
FAM47E	100129583	.	GRCh37	4	77147265	77147266	+	Intron	INS	-	-	A	rs55720841		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.81+8427dup			ENST00000339906		7	.	7	0	.	0	FAM47E,intron_variant,,ENST00000339906,;FAM47E,intron_variant,,ENST00000510197,NM_001242936.1;FAM47E,intron_variant,,ENST00000512895,;	A	ENSG00000189157	ENST00000339906	Transcript	intron_variant						rs55720841	1		1	FAM47E	HGNC	34343	protein_coding		CCDS58907.1	ENSP00000340401	Q6ZV65		UPI0000D6157B					1/6			0.4251	0.5749		0.2331	0.7893	0.5276										MODIFIER	1	insertion														.	TCA	.	.																					77147265
SEC31A	22872	.	GRCh37	4	83775866	83775866	+	Intron	DEL	A	A	-	rs79298254		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.2008+190del			ENST00000395310		6	.	4	5	.	0	SEC31A,intron_variant,,ENST00000264405,;SEC31A,intron_variant,,ENST00000311785,NM_001077206.2;SEC31A,intron_variant,,ENST00000326950,NM_016211.3;SEC31A,intron_variant,,ENST00000348405,;SEC31A,intron_variant,,ENST00000355196,;SEC31A,intron_variant,,ENST00000395310,NM_001077207.2,NM_014933.3,NM_001077208.2;SEC31A,intron_variant,,ENST00000432794,;SEC31A,intron_variant,,ENST00000443462,NM_001191049.1;SEC31A,intron_variant,,ENST00000448323,;SEC31A,intron_variant,,ENST00000500777,;SEC31A,intron_variant,,ENST00000505472,;SEC31A,intron_variant,,ENST00000505984,;SEC31A,intron_variant,,ENST00000507828,;SEC31A,intron_variant,,ENST00000508479,;SEC31A,intron_variant,,ENST00000508502,;SEC31A,intron_variant,,ENST00000509142,;SEC31A,intron_variant,,ENST00000510167,;SEC31A,intron_variant,,ENST00000512664,;SEC31A,intron_variant,,ENST00000513858,;SEC31A,downstream_gene_variant,,ENST00000503226,;SEC31A,downstream_gene_variant,,ENST00000512732,;	-	ENSG00000138674	ENST00000395310	Transcript	intron_variant						rs79298254	1		-1	SEC31A	HGNC	17052	protein_coding	YES	CCDS3596.1	ENSP00000378721	O94979	U3KQC9,D6REC0,D6REA9,D6RE64,D6RCQ9,D6RBT0	UPI000003E7E1	NM_001077207.2,NM_014933.3,NM_001077208.2				17/26			0.2254	0.6556		0.3482	0.5577	0.3763										MODIFIER	1	deletion														.	TTAA	.	.																					83775865
AGPAT9	84803	.	GRCh37	4	84506769	84506769	+	Intron	DEL	T	T	-	rs202185390		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.480-1627del			ENST00000395226		3	.	3	0	.	0	AGPAT9,intron_variant,,ENST00000264409,NM_032717.4,NM_001256422.1;AGPAT9,intron_variant,,ENST00000395226,NM_001256421.1;AGPAT9,upstream_gene_variant,,ENST00000513683,;	-	ENSG00000138678	ENST00000395226	Transcript	intron_variant						rs202185390	1		1	AGPAT9	HGNC	28157	protein_coding	YES	CCDS3606.1	ENSP00000378651	Q53EU6		UPI000004B62F	NM_001256421.1				4/12			0.1127	0.2853		0.3462	0.2734	0.3149										MODIFIER	1	deletion														.	TCTT	.	.																					84506768
RP11-42A4.1	0	.	GRCh37	4	85302293	85302294	+	5'Flank	INS	-	-	ATAGTAGTAAT	rs57528290		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000504840		4	.	4	0	.	0	RP11-42A4.1,upstream_gene_variant,,ENST00000504840,;	ATAGTAGTAAT	ENSG00000248749	ENST00000504840	Transcript	upstream_gene_variant						rs57528290	1	951	-1	RP11-42A4.1	Clone_based_vega_gene		lincRNA	YES																												MODIFIER	1	insertion														.	TAA	.	.																					85302293
ARHGAP24	83478	.	GRCh37	4	86652317	86652318	+	Intron	INS	-	-	ACCACATGCTACA	rs11267875		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.268+9195_268+9196insACATGCTACAACC			ENST00000395184		5	.	5	0	.	0	ARHGAP24,intron_variant,,ENST00000395184,NM_001025616.2,NM_001287805.1;ARHGAP24,intron_variant,,ENST00000503995,;ARHGAP24,intron_variant,,ENST00000512201,;	ACCACATGCTACA	ENSG00000138639	ENST00000395184	Transcript	intron_variant						rs11267875	1		1	ARHGAP24	HGNC	25361	protein_coding	YES	CCDS34025.1	ENSP00000378611	Q8N264	D6RHH1,B3KUX7	UPI00001AF1D9	NM_001025616.2,NM_001287805.1				3/9			0.8404	0.9914		0.998	0.999	0.999										MODIFIER	1	insertion													1	.	CCA	.	.																					86652317
HSD17B13	345275	.	GRCh37	4	88220253	88220254	+	3'Flank	INS	-	-	TT	rs35698223		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000328546		3	.	3	0	.	0	HSD17B13,downstream_gene_variant,,ENST00000302219,NM_001136230.1;HSD17B13,downstream_gene_variant,,ENST00000328546,NM_178135.3;MIR5705,downstream_gene_variant,,ENST00000579870,;	TT	ENSG00000170509	ENST00000328546	Transcript	downstream_gene_variant						rs35698223	1	4687	-1	HSD17B13	HGNC	18685	protein_coding	YES	CCDS3618.1	ENSP00000333300	Q7Z5P4		UPI00000350AE	NM_178135.3							0.2579	0.2997		0.3433	0.4085	0.1984										MODIFIER	1	insertion														.	TCT	.	.																					88220253
CCSER1	401145	.	GRCh37	4	91185840	91185840	+	Intron	DEL	T	T	-	rs33922965		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.-41-43546del			ENST00000509176		3	.	3	0	.	0	CCSER1,intron_variant,,ENST00000333691,;CCSER1,intron_variant,,ENST00000432775,NM_207491.2;CCSER1,intron_variant,,ENST00000509176,NM_001145065.1;CCSER1,intron_variant,,ENST00000505073,;	-	ENSG00000184305	ENST00000509176	Transcript	intron_variant						rs33922965	1		1	CCSER1	HGNC	29349	protein_coding	YES	CCDS47099.1	ENSP00000425040	Q9C0I3		UPI00005A6104	NM_001145065.1				1/10			0.8056	0.6945		0.9623	0.6332	0.8292										MODIFIER	1	deletion														.	ACTT	.	.																					91185839
CCSER1	401145	.	GRCh37	4	91346459	91346460	+	Intron	DEL	GA	GA	-	rs769432517		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GA	GA																c.1603+25196_1603+25197del			ENST00000509176		4	.	3	4	.	0	CCSER1,intron_variant,,ENST00000333691,;CCSER1,intron_variant,,ENST00000432775,NM_207491.2;CCSER1,intron_variant,,ENST00000509176,NM_001145065.1;CCSER1,intron_variant,,ENST00000505073,;CCSER1,intron_variant,,ENST00000508086,;CCSER1,intron_variant,,ENST00000514352,;	-	ENSG00000184305	ENST00000509176	Transcript	intron_variant						rs769432517	1		1	CCSER1	HGNC	29349	protein_coding	YES	CCDS47099.1	ENSP00000425040	Q9C0I3		UPI00005A6104	NM_001145065.1				4/10																		MODIFIER	1	deletion														.	AGGAG	.	.																					91346458
RP11-9B6.1	0	.	GRCh37	4	93218845	93218845	+	Intron	DEL	T	T	-	rs35863353		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.45-65del			ENST00000504213		3	.	3	0	.	0	RP11-9B6.1,intron_variant,,ENST00000504213,;	-	ENSG00000248511	ENST00000504213	Transcript	intron_variant						rs35863353	1		-1	RP11-9B6.1	Clone_based_vega_gene		protein_coding	YES		ENSP00000425801		D6RIX9	UPI0000EE2C70					2/2			0.0257	0.0749		0.0109	0.0865	0.0665										MODIFIER	1	deletion														.	TATT	.	.																					93218844
GRID2	2895	.	GRCh37	4	94544464	94544464	+	Intron	DEL	T	T	-	rs147269640		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.2194-2956del			ENST00000282020		3	.	3	0	.	0	GRID2,intron_variant,,ENST00000282020,NM_001510.2;GRID2,intron_variant,,ENST00000510992,NM_001286838.1;	-	ENSG00000152208	ENST00000282020	Transcript	intron_variant						rs147269640	1		1	GRID2	HGNC	4576	protein_coding	YES	CCDS3637.1	ENSP00000282020	O43424	Q4W5S4,Q4W5L9,Q4W5F4,Q4W5B7,D6R976	UPI00001AEA78	NM_001510.2				13/15		0.2194	0.1354	0.2262		0.3978	0.0994	0.2679										MODIFIER	1	deletion													1	.	CCTG	.	.																					94544463
RP11-398J16.1	0	.	GRCh37	4	95291353	95291354	+	3'Flank	INS	-	-	AAGGAAGG	rs57030367		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000478069		6	.	3	4	.	0	RP11-398J16.1,downstream_gene_variant,,ENST00000478069,;	AAGGAAGG	ENSG00000241103	ENST00000478069	Transcript	downstream_gene_variant						rs57030367	1	39	1	RP11-398J16.1	Clone_based_vega_gene		processed_pseudogene	YES													0.4803	0.4366		0.2698	0.6213	0.4335										MODIFIER	1	insertion														.	AAA	.	.																					95291353
UNC5C	8633	.	GRCh37	4	96266180	96266181	+	Intron	INS	-	-	TCTT	rs61074276		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.125-9399_125-9398insAAGA			ENST00000453304		3	.	3	0	.	0	UNC5C,intron_variant,,ENST00000453304,NM_003728.3;UNC5C,intron_variant,,ENST00000504962,;UNC5C,intron_variant,,ENST00000506749,;UNC5C,intron_variant,,ENST00000513796,;	TCTT	ENSG00000182168	ENST00000453304	Transcript	intron_variant						rs61074276	1		-1	UNC5C	HGNC	12569	protein_coding	YES	CCDS3643.1	ENSP00000406022	O95185	Q4W5H4	UPI000004E6A5	NM_003728.3				1/15																		MODIFIER	1	insertion														.	ACC	.	.																					96266180
PPP3CA	5530	.	GRCh37	4	102194296	102194297	+	Intron	INS	-	-	ATTA	rs10644136		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.58+73599_58+73600insTAAT			ENST00000394854		3	.	3	0	.	0	PPP3CA,intron_variant,,ENST00000323055,NM_001130692.1;PPP3CA,intron_variant,,ENST00000394853,NM_001130691.1;PPP3CA,intron_variant,,ENST00000394854,NM_000944.4;PPP3CA,intron_variant,,ENST00000507176,;PPP3CA,intron_variant,,ENST00000512215,;PPP3CA,intron_variant,,ENST00000523694,;PPP3CA,intron_variant,,ENST00000525819,;PPP3CA,intron_variant,,ENST00000529324,;	ATTA	ENSG00000138814	ENST00000394854	Transcript	intron_variant						rs10644136	1		-1	PPP3CA	HGNC	9314	protein_coding	YES	CCDS34037.1	ENSP00000378323	Q08209	Q9UMM5,Q9UMB2,E9PPC8,E9PK68,E7ETC2	UPI0000110660	NM_000944.4				1/13			0.9924	0.9352		0.8274	0.8986	0.8528										MODIFIER	1	insertion													1	.	ATA	.	.																					102194296
BANK1	55024	.	GRCh37	4	102716219	102716219	+	Intron	DEL	T	T	-	rs5860693		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.70+4121del			ENST00000322953		4	.	4	0	.	0	BANK1,intron_variant,,ENST00000322953,NM_017935.4;BANK1,intron_variant,,ENST00000428908,NM_001127507.2;BANK1,intron_variant,,ENST00000504592,;BANK1,intron_variant,,ENST00000508653,;	-	ENSG00000153064	ENST00000322953	Transcript	intron_variant						rs5860693	1		1	BANK1	HGNC	18233	protein_coding	YES	CCDS34038.1	ENSP00000320509	Q8NDB2		UPI0000D6159D	NM_017935.4				1/16			0.7617	0.5029		0.5585	0.5567	0.728										MODIFIER	1	deletion													1	.	CATT	.	.																					102716218
SLC39A8	64116	.	GRCh37	4	103218404	103218405	+	Intron	INS	-	-	AC	rs10655738		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.840+7069_840+7070insGT			ENST00000394833		4	.	4	0	.	0	SLC39A8,intron_variant,,ENST00000356736,NM_001135146.1,NM_001135148.1;SLC39A8,intron_variant,,ENST00000394833,NM_022154.5,NM_001135148.1;SLC39A8,intron_variant,,ENST00000424970,NM_001135147.1;SLC39A8,intron_variant,,ENST00000512337,;	AC	ENSG00000138821	ENST00000394833	Transcript	intron_variant						rs10655738	1		-1	SLC39A8	HGNC	20862	protein_coding	YES	CCDS3656.1	ENSP00000378310	Q9C0K1		UPI0000046C4E	NM_022154.5,NM_001135148.1				5/7			0.3873	0.4236		0.4276	0.4453	0.407										MODIFIER	1	insertion													1	.	TAA	.	.																					103218404
Unknown	0	.	GRCh37	4	108254951	108254961	+	IGR	DEL	CTTCTGTTTCA	CTTCTGTTTCA	-	rs138686132		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTTCTGTTTCA	CTTCTGTTTCA																					3	.	3	0	.	0		-				intergenic_variant						rs138686132	1																				0.2012	0.5476		0.5228	0.4245	0.3517										MODIFIER	1	deletion														.	TGCTTCTGTTTCAC	.	.																					108254950
ENSR00001303624	0	.	GRCh37	4	110468509	110468509	+	IGR	DEL	A	A	-	rs138375702		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENSR00001303624		4	.	4	0	.	0	,regulatory_region_variant,,ENSR00001303624,;	-		ENSR00001303624	RegulatoryFeature	regulatory_region_variant						rs138375702	1																																			MODIFIER	1	deletion														.	ACAA	.	.																					110468508
RP11-119H12.4	0	.	GRCh37	4	113744727	113744728	+	5'Flank	INS	-	-	A	rs34386421		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000504528		3	.	3	0	.	0	ANK2,intron_variant,,ENST00000503271,;ANK2,intron_variant,,ENST00000503423,;ANK2,intron_variant,,ENST00000506722,NM_001127493.1;RP11-119H12.4,upstream_gene_variant,,ENST00000413930,;RP11-119H12.4,upstream_gene_variant,,ENST00000504528,;	A	ENSG00000234841	ENST00000504528	Transcript	upstream_gene_variant						rs34386421	1	2735	1	RP11-119H12.4	Clone_based_vega_gene		processed_pseudogene	YES													0.41	0.3977		0.3661	0.3996	0.4233										MODIFIER	1	insertion														.	GCA	.	.																					113744727
Unknown	0	.	GRCh37	4	117504409	117504410	+	IGR	DEL	AA	AA	-	rs367910762		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																					3	.	3	0	.	0		-				intergenic_variant						rs367910762	1																			0.0012	0.0015				0.001	0.0031										MODIFIER	1	deletion														.	ATAAG	.	.																					117504408
AC107399.2	0	.	GRCh37	4	118233381	118233381	+	3'Flank	DEL	T	T	-	rs139761976		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000416680		3	.	3	0	.	0	AC107399.2,downstream_gene_variant,,ENST00000416680,;	-	ENSG00000224932	ENST00000416680	Transcript	downstream_gene_variant						rs139761976	1	2372	-1	AC107399.2	Clone_based_vega_gene		lincRNA	YES												0.1577	0.3048	0.1196		0.0099	0.1899	0.1053										MODIFIER	1	deletion														.	GCTG	.	.																					118233380
ANKRD50	57182	.	GRCh37	4	125606791	125606792	+	Intron	DEL	AT	AT	-	rs146631319		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																c.513-6732_513-6731del			ENST00000504087		3	.	3	0	.	0	ANKRD50,intron_variant,,ENST00000504087,NM_020337.2;ANKRD50,intron_variant,,ENST00000515641,NM_001167882.1;	-	ENSG00000151458	ENST00000504087	Transcript	intron_variant						rs146631319	1		-1	ANKRD50	HGNC	29223	protein_coding	YES	CCDS34060.1	ENSP00000425658	Q9ULJ7	Q8TB46	UPI00002377E8	NM_020337.2				2/4			0.003	0.0375		0.0208	0.0497	0.0521										MODIFIER	1	deletion														.	AGATA	.	.																					125606790
ENSR00001683165	0	.	GRCh37	4	131695869	131695870	+	IGR	INS	-	-	A	rs56757391		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001683165		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001683165,;	A		ENSR00001683165	RegulatoryFeature	regulatory_region_variant						rs56757391	1																				0.615	0.6729		0.6508	0.7207	0.6339										MODIFIER	1	insertion														.	GCA	.	.																					131695869
Unknown	0	.	GRCh37	4	132081135	132081136	+	IGR	INS	-	-	AATC	rs35848035		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	6	0	.	0		AATC				intergenic_variant						rs35848035	1																				0.205	0.6787		0.7956	0.4642	0.4571										MODIFIER	1	insertion														.	TTA	.	.																					132081135
Unknown	0	.	GRCh37	4	132262061	132262064	+	IGR	DEL	CAAT	CAAT	-	rs144799530		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAAT	CAAT																					3	.	3	0	.	0		-				intergenic_variant						rs144799530	1																				0.059	0.0504		0.2659	0.0308	0.0501										MODIFIER	1	deletion														.	ACCAATC	.	.																					132262060
Unknown	0	.	GRCh37	4	135300760	135300761	+	IGR	INS	-	-	A	rs35179144		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		A				intergenic_variant						rs35179144	1																				0.5083	0.5274		0.8879	0.3976	0.547										MODIFIER	1	insertion														.	CTA	.	.																					135300760
RP13-884E18.2	0	.	GRCh37	4	138564454	138564454	+	3'Flank	DEL	A	A	-	rs35304917		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000505454		3	.	3	0	.	0	RP13-884E18.2,downstream_gene_variant,,ENST00000505454,;	-	ENSG00000250126	ENST00000505454	Transcript	downstream_gene_variant						rs35304917	1	1965	-1	RP13-884E18.2	Clone_based_vega_gene		lincRNA	YES													0.4039	0.1455		0.1151	0.165	0.1769										MODIFIER	1	deletion														.	AGAA	.	.																					138564453
ENSR00001308670	0	.	GRCh37	4	141741072	141741073	+	IGR	INS	-	-	A	rs139507114		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001308670		5	.	4	3	.	0	,regulatory_region_variant,,ENSR00001308670,;	A		ENSR00001308670	RegulatoryFeature	regulatory_region_variant						rs139507114	1																				0.0083	0.2075		0.2123	0.1879	0.2117										MODIFIER	1	insertion														.	GTA	.	.																					141741072
SLC10A7	84068	.	GRCh37	4	147333307	147333308	+	Intron	INS	-	-	A	rs11393091		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.435+30627dup			ENST00000335472		3	.	3	0	.	0	SLC10A7,intron_variant,,ENST00000264986,;SLC10A7,intron_variant,,ENST00000335472,NM_001029998.3;SLC10A7,intron_variant,,ENST00000394062,;SLC10A7,intron_variant,,ENST00000432059,;SLC10A7,intron_variant,,ENST00000507030,;SLC10A7,intron_variant,,ENST00000507560,;	A	ENSG00000120519	ENST00000335472	Transcript	intron_variant						rs11393091	1		-1	SLC10A7	HGNC	23088	protein_coding	YES	CCDS34073.1	ENSP00000334594	Q0GE19	B3KWW2	UPI000020B547	NM_001029998.3				5/11			0.4682	0.6686		0.7837	0.4831	0.6902										MODIFIER	1	insertion													1	.	CCA	.	.																					147333307
FAM160A1	729830	.	GRCh37	4	152373930	152373930	+	Intron	DEL	A	A	-	rs112360226		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.-355-1911del			ENST00000435205		3	.	3	0	.	0	FAM160A1,intron_variant,,ENST00000435205,NM_001109977.1;FAM160A1,intron_variant,,ENST00000503146,;FAM160A1,intron_variant,,ENST00000513086,;FAM160A1,intron_variant,,ENST00000513962,;FAM160A1,intron_variant,,ENST00000508198,;FAM160A1,intron_variant,,ENST00000511501,;	-	ENSG00000164142	ENST00000435205	Transcript	intron_variant						rs112360226	1		1	FAM160A1	HGNC	34237	protein_coding	YES	CCDS47146.1	ENSP00000413196	Q05DH4	D6RF38,D6RBF5,D6RAG2	UPI00015DE720	NM_001109977.1				1/13			0.5197	0.4337		0.378	0.5308	0.3855										MODIFIER	1	deletion														.	TCAA	.	.																					152373929
ENSR00001311166	0	.	GRCh37	4	154050665	154050666	+	IGR	INS	-	-	CCC	rs200259042		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001311166		21	16	5	16	0	0	,regulatory_region_variant,,ENSR00001311166,;,regulatory_region_variant,,ENSR00001685057,;	CCC		ENSR00001311166	RegulatoryFeature	regulatory_region_variant						rs200259042	1																																			MODIFIER	1	insertion														.	CAC	.	.																					154050665
Unknown	0	.	GRCh37	4	157498834	157498835	+	IGR	INS	-	-	T	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	4	2	4	4	0		T				intergenic_variant							1																																			MODIFIER	1	insertion														.	GAG	.	.																					157498834
C4orf45	152940	.	GRCh37	4	159875511	159875513	+	Intron	DEL	CTC	CTC	-	rs72050234		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTC	CTC																c.356+5925_356+5927del			ENST00000434826		4	.	4	0	.	0	C4orf45,intron_variant,,ENST00000434826,NM_152543.2;C4orf45,intron_variant,,ENST00000505647,;C4orf45,intron_variant,,ENST00000508011,;	-	ENSG00000164123	ENST00000434826	Transcript	intron_variant						rs72050234	1		-1	C4orf45	HGNC	26342	protein_coding	YES	CCDS47156.1	ENSP00000412215	Q96LM5		UPI000022C48A	NM_152543.2				3/4			1	1		1	1	1										MODIFIER	1	deletion														.	TTCTCC	.	.																					159875510
Unknown	0	.	GRCh37	4	161373034	161373035	+	IGR	INS	-	-	T	rs35941273		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs35941273	1																				0.3222	0.3458		0.1915	0.5487	0.4601										MODIFIER	1	insertion														.	GAT	.	.																					161373034
Unknown	0	.	GRCh37	4	161418165	161418166	+	IGR	INS	-	-	AAAAT	rs58677653		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AAAAT				intergenic_variant						rs58677653	1																				0.9039	0.9914		1	0.999	1										MODIFIER	1	insertion														.	ACA	.	.																					161418165
RP11-502M1.2	0	.	GRCh37	4	161475333	161475334	+	Intron	INS	-	-	GAAAT	rs144334235		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.845+51_845+55dup			ENST00000512652		3	.	3	0	.	0	RP11-502M1.2,intron_variant,,ENST00000512652,;	GAAAT	ENSG00000249425	ENST00000512652	Transcript	intron_variant,non_coding_transcript_variant						rs144334235	1		1	RP11-502M1.2	Clone_based_vega_gene		lincRNA	YES										4/4			0.5068	0.2709		0.2222	0.3201	0.1861										MODIFIER	1	insertion														.	AAG	.	.																					161475333
Unknown	0	.	GRCh37	4	163716146	163716146	+	IGR	DEL	A	A	-	rs5863580		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs5863580	1																																			MODIFIER	1	deletion														.	TCAA	.	.																					163716145
Unknown	0	.	GRCh37	4	164180804	164180805	+	IGR	INS	-	-	A	rs147681020		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		A				intergenic_variant						rs147681020	1																				0.2602	0.7493		0.3571	0.8221	0.684										MODIFIER	1	insertion														.	AGA	.	.																					164180804
TRIM61	391712	.	GRCh37	4	165886599	165886602	+	Intron	DEL	TTTT	TTTT	-	rs70952674		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTT	TTTT																c.525+4028_525+4031del			ENST00000329314		3	.	3	0	.	0	TRIM61,intron_variant,,ENST00000329314,NM_001012414.2;RP11-366M4.8,intron_variant,,ENST00000596751,;RP11-366M4.11,downstream_gene_variant,,ENST00000508856,;	-	ENSG00000183439	ENST00000329314	Transcript	intron_variant						rs70952674	1		-1	TRIM61	HGNC	24339	protein_coding	YES	CCDS34093.1	ENSP00000332288	Q5EBN2		UPI00004CEC1B	NM_001012414.2				3/4			0.025	0.2651		0.0764	0.1531	0.1667										MODIFIER	1	deletion														.	GCTTTTT	.	.																					165886598
PALLD	23022	.	GRCh37	4	169604080	169604081	+	Intron	INS	-	-	A	rs148598962		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1155-57dup			ENST00000505667		25	.	9	20	.	0	PALLD,intron_variant,,ENST00000261509,NM_001166108.1,NM_016081.3;PALLD,intron_variant,,ENST00000333488,;PALLD,intron_variant,,ENST00000335742,;PALLD,intron_variant,,ENST00000503457,;PALLD,intron_variant,,ENST00000504519,;PALLD,intron_variant,,ENST00000505667,;PALLD,intron_variant,,ENST00000508898,;PALLD,intron_variant,,ENST00000512127,NM_001166109.1;PALLD,intron_variant,,ENST00000513245,;RNU6-1336P,downstream_gene_variant,,ENST00000383886,;	A	ENSG00000129116	ENST00000505667	Transcript	intron_variant						rs148598962	1		1	PALLD	HGNC	17068	protein_coding	YES	CCDS54818.1	ENSP00000425556	Q8WX93	Q4W5A6,D6RBH5,D6RBB1,D6R9Z5,D6R948	UPI000189A85C					4/21																		MODIFIER	1	insertion													1	.	CTA	.	.																					169604080
PALLD	23022	.	GRCh37	4	169698667	169698669	+	Intron	DEL	CAG	CAG	-	rs77308434		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAG	CAG																c.1964+65595_1964+65597del			ENST00000505667		3	.	3	0	.	0	PALLD,intron_variant,,ENST00000261509,NM_001166108.1,NM_016081.3;PALLD,intron_variant,,ENST00000335742,;PALLD,intron_variant,,ENST00000505667,;PALLD,intron_variant,,ENST00000510998,;PALLD,intron_variant,,ENST00000512127,NM_001166109.1;,regulatory_region_variant,,ENSR00001313564,;	-	ENSG00000129116	ENST00000505667	Transcript	intron_variant						rs77308434	1		1	PALLD	HGNC	17068	protein_coding	YES	CCDS54818.1	ENSP00000425556	Q8WX93	Q4W5A6,D6RBH5,D6RBB1,D6R9Z5,D6R948	UPI000189A85C					10/21			0.0431	0.1081		0.0347	0.1958	0.1237										MODIFIER	1	deletion													1	.	CCCAGC	.	.																					169698666
Unknown	0	.	GRCh37	4	171117532	171117540	+	IGR	DEL	ACCCAGAAG	ACCCAGAAG	-	rs59663744		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACCCAGAAG	ACCCAGAAG																					5	.	3	3	.	0		-				intergenic_variant						rs59663744	1																																			MODIFIER	1	deletion														.	CAACCCAGAAGG	.	.																					171117531
Unknown	0	.	GRCh37	4	172460969	172460969	+	IGR	DEL	G	G	-	rs35095431		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					7	.	4	3	.	0		-				intergenic_variant						rs35095431	1																				0.8215	0.7378		0.4633	0.836	0.7352										MODIFIER	1	deletion														.	TTGG	.	.																					172460968
GALNTL6	442117	.	GRCh37	4	172868064	172868064	+	Intron	DEL	C	C	-	rs5864099		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.138+132196del			ENST00000506823		4	.	4	0	.	0	GALNTL6,intron_variant,,ENST00000506823,NM_001034845.2;	-	ENSG00000174473	ENST00000506823	Transcript	intron_variant						rs5864099	1		1	GALNTL6	HGNC	33844	protein_coding	YES	CCDS34104.1	ENSP00000423313	Q49A17	E5D8G0	UPI000058EB5C	NM_001034845.2				2/12			0.5045	0.8559		0.6647	0.8181	0.6922										MODIFIER	1	deletion														.	TTCC	.	.																					172868063
GALNTL6	442117	.	GRCh37	4	173304053	173304053	+	Intron	DEL	T	T	-	rs74311265		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.553+34218del			ENST00000506823		4	.	3	3	.	0	GALNTL6,intron_variant,,ENST00000506823,NM_001034845.2;GALNTL6,intron_variant,,ENST00000508122,;GALNTL6,intron_variant,,ENST00000457021,;RP11-485C11.1,upstream_gene_variant,,ENST00000513791,;	-	ENSG00000174473	ENST00000506823	Transcript	intron_variant						rs74311265	1		1	GALNTL6	HGNC	33844	protein_coding	YES	CCDS34104.1	ENSP00000423313	Q49A17	E5D8G0	UPI000058EB5C	NM_001034845.2				5/12			0.0408	0.5591		0.4524	0.4831	0.6748										MODIFIER	1	deletion														.	TGTT	.	.																					173304052
GALNT7	51809	.	GRCh37	4	174235080	174235081	+	Intron	DEL	AT	AT	-	rs138768800		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																c.1390-15_1390-14del			ENST00000265000		5	.	5	0	.	0	GALNT7,intron_variant,,ENST00000265000,NM_017423.2;GALNT7,intron_variant,,ENST00000503213,;GALNT7,intron_variant,,ENST00000505308,;GALNT7,intron_variant,,ENST00000506317,;GALNT7,upstream_gene_variant,,ENST00000515862,;	-	ENSG00000109586	ENST00000265000	Transcript	intron_variant						rs138768800	1		1	GALNT7	HGNC	4129	protein_coding	YES	CCDS3815.1	ENSP00000265000	Q86SF2	Q4W5F7	UPI000000DB3C	NM_017423.2				8/11									0.2408	0.2236								MODIFIER	1	deletion														.	CGATA	.	.												0.06856	0.05503	0.07581	0.04766	0.03254	0.04967	0.08758	0.0498	0.05022	174235079
FBXO8	26269	.	GRCh37	4	175173827	175173828	+	Intron	INS	-	-	AT	rs35890245		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.456+7022_456+7023insAT			ENST00000393674		3	.	3	0	.	0	FBXO8,intron_variant,,ENST00000393674,NM_012180.2;FBXO8,intron_variant,,ENST00000503293,;FBXO8,intron_variant,,ENST00000513696,;FBXO8,intron_variant,,ENST00000515664,;	AT	ENSG00000164117	ENST00000393674	Transcript	intron_variant						rs35890245,COSV67031470	1		-1	FBXO8	HGNC	13587	protein_coding	YES	CCDS3820.1	ENSP00000377280	Q9NRD0	D6RIC0	UPI000012A588	NM_012180.2				3/5		0.2204	0.1301	0.245		0.0387	0.4583	0.2679				0,1						MODIFIER	1	insertion			0,1											.	ACG	.	.																					175173827
Unknown	0	.	GRCh37	4	175314763	175314763	+	IGR	DEL	T	T	-	rs35350725		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	4	0	.	0		-				intergenic_variant						rs35350725	1																				0.1929	0.1729		0.5159	0.1272	0.1063										MODIFIER	1	deletion														.	CATT	.	.																					175314762
Unknown	0	.	GRCh37	4	175522969	175522970	+	IGR	DEL	AG	AG	-	rs57888486		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																					3	.	3	0	.	0		-				intergenic_variant						rs57888486	1																				0.0998	0.3862		0.5466	0.326	0.362										MODIFIER	1	deletion														.	ATAGA	.	.																					175522968
ASB5	140458	.	GRCh37	4	177184524	177184525	+	Intron	DEL	TC	TC	-	rs67569639		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TC	TC																c.196+5539_196+5540del			ENST00000296525		3	.	3	0	.	0	ASB5,intron_variant,,ENST00000296525,NM_080874.3;	-	ENSG00000164122	ENST00000296525	Transcript	intron_variant						rs67569639	1		-1	ASB5	HGNC	17180	protein_coding	YES	CCDS3827.1	ENSP00000296525	Q8WWX0	Q5HYF3,D6R9Q2	UPI00000015CF	NM_080874.3				1/6			0.5537	0.7118		0.4692	0.668	0.4949										MODIFIER	1	deletion														.	AGTCT	.	.																					177184523
Unknown	0	.	GRCh37	4	179313609	179313609	+	IGR	DEL	A	A	-	rs33933163		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					8	.	8	0	.	0		-				intergenic_variant						rs33933163	1																				0.4576	0.2579		0.2173	0.3907	0.2546										MODIFIER	1	deletion														.	TTAA	.	.																					179313608
Unknown	0	.	GRCh37	4	180502988	180502989	+	IGR	INS	-	-	CGGAC	rs112032477		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	3	3	.	0		CGGAC				intergenic_variant						rs112032477	1																				0.3646	0.3804		0.3165	0.5646	0.4264										MODIFIER	1	insertion														.	AGC	.	.																					180502988
LINC00290	728081	.	GRCh37	4	182061031	182061032	+	Intron	INS	-	-	AA	rs56200248		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.201+15733_201+15734dup			ENST00000512487		3	.	3	0	.	0	LINC00290,intron_variant,,ENST00000512487,;	AA	ENSG00000248197	ENST00000512487	Transcript	intron_variant,non_coding_transcript_variant						rs56200248	1		-1	LINC00290	HGNC	38515	lincRNA	YES										2/2			0.5121	0.6225		0.744	0.6332	0.6155										MODIFIER	1	insertion														.	TTA	.	.																					182061031
Unknown	0	.	GRCh37	4	182513112	182513112	+	IGR	DEL	A	A	-	rs34862010		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs34862010	1																				0.3676	0.4755		0.506	0.5149	0.4141										MODIFIER	1	deletion														.	AGAA	.	.																					182513111
Unknown	0	.	GRCh37	4	183734492	183734493	+	IGR	DEL	CT	CT	-	rs1340749886		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CT	CT																					6	4	2	4	4	0		-				intergenic_variant						rs1340749886	1																																			MODIFIER	1	deletion														.	CACTC	.	.																					183734491
snoU13	0	.	GRCh37	4	184499207	184499208	+	3'Flank	INS	-	-	GT	rs140005671		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000459504		3	.	3	0	.	0	snoU13,downstream_gene_variant,,ENST00000459504,;	GT	ENSG00000239116	ENST00000459504	Transcript	downstream_gene_variant						rs140005671	1	4140	-1	snoU13	RFAM		snoRNA	YES													0.0446	0.0778		0.1994	0.0507	0.0706										MODIFIER	1	insertion														.	CAG	.	.																					184499207
Unknown	0	.	GRCh37	4	184733777	184733777	+	IGR	DEL	G	G	-	rs34670534		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					6	.	6	1	.	0		-				intergenic_variant						rs34670534	1																				0.6104	0.1974		0.0863	0.2286	0.3037										MODIFIER	1	deletion														.	GAGG	.	.																					184733776
STOX2	56977	.	GRCh37	4	184778573	184778574	+	Intron	INS	-	-	AGGACTGGTTATCCTGCAGGACTGGTTATCCCACAGGACTCGTTGCCTCGT	rs70959151		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.413+3586_413+3587insTATCCTGCAGGACTGGTTATCCCACAGGACTCGTTGCCTCGTAGGACTGGT			ENST00000511250		3	.	3	0	.	0	STOX2,intron_variant,,ENST00000511250,;,regulatory_region_variant,,ENSR00001316018,;,regulatory_region_variant,,ENSR00001687213,;	AGGACTGGTTATCCTGCAGGACTGGTTATCCCACAGGACTCGTTGCCTCGT	ENSG00000173320	ENST00000511250	Transcript	intron_variant,non_coding_transcript_variant						rs70959151	1		1	STOX2	HGNC	25450	processed_transcript											1/1																		MODIFIER	1	insertion														.	ACA	.	.																					184778573
SNX25	83891	.	GRCh37	4	186208975	186208976	+	Intron	INS	-	-	G	rs34265529		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.600-191_600-190insG			ENST00000504273		6	3	3	4	4	0	SNX25,intron_variant,,ENST00000264694,NM_031953.2;SNX25,intron_variant,,ENST00000504273,;	G	ENSG00000109762	ENST00000504273	Transcript	intron_variant						rs34265529	1		1	SNX25	HGNC	21883	protein_coding	YES	CCDS34116.1	ENSP00000426255	Q9H3E2	B3KTI8	UPI000020B7BB					5/18		0.4575	0.3979	0.4568		0.5218	0.4225	0.5082										MODIFIER	1	insertion														.	AAT	.	.																					186208975
RP11-215A19.2	0	.	GRCh37	4	187372083	187372100	+	Intron	DEL	GAGGTCAGGGTGGATCAA	GAGGTCAGGGTGGATCAA	-	rs149353829		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAGGTCAGGGTGGATCAA	GAGGTCAGGGTGGATCAA																c.130-23848_130-23831del			ENST00000509111		3	.	3	0	.	0	RP11-215A19.2,intron_variant,,ENST00000509111,;F11-AS1,intron_variant,,ENST00000505103,;F11-AS1,intron_variant,,ENST00000508110,;F11-AS1,intron_variant,,ENST00000508287,;	-	ENSG00000272297	ENST00000509111	Transcript	intron_variant						rs149353829	1		-1	RP11-215A19.2	Clone_based_vega_gene		protein_coding	YES		ENSP00000422449			UPI0001D3BA95					1/1			0.2095	0.5245		0.2688	0.5924	0.4264										MODIFIER	1	deletion														.	ACGAGGTCAGGGTGGATCAAG	.	.																					187372082
FAT1	2195	.	GRCh37	4	187525941	187525942	+	Intron	INS	-	-	GAT	rs70964972		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.10351-216_10351-214dup			ENST00000441802		5	.	5	0	.	0	FAT1,intron_variant,,ENST00000441802,NM_005245.3;FAT1,upstream_gene_variant,,ENST00000503253,;FAT1,downstream_gene_variant,,ENST00000508035,;	GAT	ENSG00000083857	ENST00000441802	Transcript	intron_variant						rs70964972	1		-1	FAT1	HGNC	3595	protein_coding	YES	CCDS47177.1	ENSP00000406229	Q14517	D6RCE4	UPI000051946B	NM_005245.3				17/26			0.2625	0.4092		0.3294	0.3668	0.4928										MODIFIER	1	insertion													1	.	AGG	.	.																					187525941
Unknown	0	.	GRCh37	4	190595397	190595397	+	IGR	DEL	G	G	-	rs11323146		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					6	.	3	6	.	0		-				intergenic_variant						rs11323146	1																			0.3381	0.4349	0.2968		0.2063	0.3936	0.3149										MODIFIER	1	deletion														.	AAGT	.	.																					190595396
Unknown	0	.	GRCh37	4	190678704	190678704	+	IGR	DEL	T	T	-	rs1350879135		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					8	.	3	8	.	7		-				intergenic_variant						rs1350879135	1																																			MODIFIER	1	deletion														.	AATT	.	.																					190678703
EXOC3	11336	.	GRCh37	5	451250	451251	+	Intron	INS	-	-	T	rs36111924		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.365-2227dup			ENST00000512944		3	.	3	0	.	0	EXOC3,intron_variant,,ENST00000315013,;EXOC3,intron_variant,,ENST00000512944,NM_007277.4;EXOC3,downstream_gene_variant,,ENST00000508022,;EXOC3,downstream_gene_variant,,ENST00000510441,;EXOC3,intron_variant,,ENST00000515601,;EXOC3,upstream_gene_variant,,ENST00000503889,;	T	ENSG00000180104	ENST00000512944	Transcript	intron_variant						rs36111924	1		1	EXOC3	HGNC	30378	protein_coding	YES	CCDS54830.1	ENSP00000425587	O60645	Q69YP2,D6RBR9,B2RE06	UPI000004A021	NM_007277.4				3/12																		MODIFIER	1	insertion														.	CAT	.	.																					451250
SLC12A7	10723	.	GRCh37	5	1076520	1076530	+	Intron	DEL	CAGGTTCCAGC	CAGGTTCCAGC	-	rs111668454		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAGGTTCCAGC	CAGGTTCCAGC																c.1749-179_1749-169del			ENST00000264930		3	.	3	0	.	0	SLC12A7,intron_variant,,ENST00000264930,NM_006598.2;SLC12A7,upstream_gene_variant,,ENST00000513223,;SLC12A7,intron_variant,,ENST00000504576,;SLC12A7,downstream_gene_variant,,ENST00000510943,;	-	ENSG00000113504	ENST00000264930	Transcript	intron_variant						rs111668454	1		-1	SLC12A7	HGNC	10915	protein_coding	YES	CCDS34129.1	ENSP00000264930	Q9Y666		UPI0000141815	NM_006598.2				13/23																		MODIFIER	1	deletion														.	CTCAGGTTCCAGCC	.	.																					1076519
SLC12A7	10723	.	GRCh37	5	1093630	1093631	+	Intron	INS	-	-	T	rs373251745		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.342+17_342+18insA			ENST00000264930		19	14	5	17	0	0	SLC12A7,intron_variant,,ENST00000264930,NM_006598.2;	T	ENSG00000113504	ENST00000264930	Transcript	intron_variant						rs373251745	1		-1	SLC12A7	HGNC	10915	protein_coding	YES	CCDS34129.1	ENSP00000264930	Q9Y666		UPI0000141815	NM_006598.2				3/23																		MODIFIER	1	insertion														.	ACG	.	.												4.827e-05	8.728e-05					0.0001014			1093630
SDHAP3	0	.	GRCh37	5	1572590	1572591	+	Intron	INS	-	-	G	rs367918923		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.549+1706dup			ENST00000413529		13	.	4	19	.	0	SDHAP3,intron_variant,,ENST00000413529,;SDHAP3,intron_variant,,ENST00000515467,;	G	ENSG00000185986	ENST00000413529	Transcript	intron_variant,non_coding_transcript_variant						rs367918923	1		-1	SDHAP3	HGNC	18781	transcribed_unprocessed_pseudogene	YES										3/3																		MODIFIER	1	insertion														.	CAG	.	.																					1572590
RP11-259O2.1	0	.	GRCh37	5	1929327	1929328	+	5'Flank	INS	-	-	TG	rs55808914		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000511693		4	.	4	0	.	0	RP11-259O2.1,upstream_gene_variant,,ENST00000511693,;	TG	ENSG00000248994	ENST00000511693	Transcript	upstream_gene_variant						rs55808914	1	4649	1	RP11-259O2.1	Clone_based_vega_gene		lincRNA	YES													0.8873	0.7075		0.5764	0.8121	0.6534										MODIFIER	1	insertion														.	GTT	.	.																					1929327
Unknown	0	.	GRCh37	5	4307893	4307893	+	IGR	DEL	T	T	-	rs5865547		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs5865547	1																				0.7027	0.4135		0.2798	0.4433	0.4714										MODIFIER	1	deletion														.	GATT	.	.																					4307892
Unknown	0	.	GRCh37	5	6542484	6542485	+	IGR	DEL	AT	AT	-	rs3996732		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																					3	.	3	0	.	0		-				intergenic_variant						rs3996732	1																				0.5393	0.3862		0.2431	0.3598	0.2955										MODIFIER	1	deletion														.	AAATA	.	.																					6542483
RP11-417J1.3	0	.	GRCh37	5	8615341	8615352	+	5'Flank	DEL	ACACACAGACAC	ACACACAGACAC	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACACAGACAC	ACACACAGACAC																			ENST00000510642		4	.	4	0	.	0	RP11-417J1.3,upstream_gene_variant,,ENST00000510642,;MTND6P2,downstream_gene_variant,,ENST00000512226,;	-	ENSG00000248765	ENST00000510642	Transcript	upstream_gene_variant							1	3938	1	RP11-417J1.3	Clone_based_vega_gene		processed_pseudogene	YES																												MODIFIER	1	deletion														.	ATACACACAGACACA	.	.																					8615340
Unknown	0	.	GRCh37	5	14892756	14892757	+	IGR	INS	-	-	C	rs5866124		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		C				intergenic_variant						rs5866124	1																				0.2383	0.3559		0.3552	0.4901	0.2945										MODIFIER	1	insertion														.	CAC	.	.																					14892756
AC016575.1	0	.	GRCh37	5	14910099	14910100	+	3'Flank	INS	-	-	AG	rs34952654		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000390747		5	.	5	0	.	0	AC016575.1,downstream_gene_variant,,ENST00000390747,;	AG	ENSG00000212036	ENST00000390747	Transcript	downstream_gene_variant						rs34952654	1	567	-1	AC016575.1	Clone_based_ensembl_gene		miRNA	YES													0.966	0.8213		0.7907	0.7346	0.8753										MODIFIER	1	insertion														.	AAA	.	.																					14910099
RP1-137K24.1	101929454	.	GRCh37	5	15213009	15213010	+	Intron	INS	-	-	AGG	rs34184953		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.248-20452_248-20451insCCT			ENST00000511443		5	.	3	4	.	0	RP1-137K24.1,intron_variant,,ENST00000511443,;	AGG	ENSG00000248486	ENST00000511443	Transcript	intron_variant,non_coding_transcript_variant						rs34184953	1		-1	RP1-137K24.1	Clone_based_vega_gene		lincRNA	YES										2/2			0.2973	0.2867		0.1756	0.4274	0.2117										MODIFIER	1	insertion														.	ATA	.	.																					15213009
FAM134B	54463	.	GRCh37	5	16550384	16550385	+	Intron	INS	-	-	A	rs5866190		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.458+15487dup			ENST00000306320		3	.	3	0	.	0	FAM134B,intron_variant,,ENST00000306320,NM_001034850.2;,regulatory_region_variant,,ENSR00000314092,;,regulatory_region_variant,,ENSR00001689247,;	A	ENSG00000154153	ENST00000306320	Transcript	intron_variant						rs5866190	1		-1	FAM134B	HGNC	25964	protein_coding	YES	CCDS43304.1	ENSP00000304642	Q9H6L5		UPI000006D7DB	NM_001034850.2				3/8			0.084	0.3674		0.3333	0.4205	0.2413										MODIFIER	1	insertion													1	.	TTA	.	.																					16550384
Unknown	0	.	GRCh37	5	18208677	18208678	+	IGR	INS	-	-	A	rs56863259		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		A				intergenic_variant						rs56863259	1																				0.6097	0.3473		0.244	0.2952	0.3845										MODIFIER	1	insertion														.	GGA	.	.																					18208677
Unknown	0	.	GRCh37	5	18607534	18607534	+	IGR	DEL	A	A	-	rs899551211		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	4	0	.	0		-				intergenic_variant						rs899551211	1																																			MODIFIER	1	deletion														.	ATAA	.	.																					18607533
CDH12	1010	.	GRCh37	5	22253313	22253315	+	Intron	DEL	ATT	ATT	-	rs143746831		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATT	ATT																c.-332-40563_-332-40561del			ENST00000382254		4	.	4	2	.	0	CDH12,intron_variant,,ENST00000382254,NM_004061.3;CDH12,intron_variant,,ENST00000504376,;	-	ENSG00000154162	ENST00000382254	Transcript	intron_variant						rs143746831	1		-1	CDH12	HGNC	1751	protein_coding	YES	CCDS3890.1	ENSP00000371689	P55289	B3KRT0	UPI00000622EB	NM_004061.3				3/14			0.0333	0.0389		0.0317	0.0924	0.1687										MODIFIER	1	deletion														.	TAATTA	.	.																					22253312
Unknown	0	.	GRCh37	5	23646718	23646719	+	IGR	DEL	AA	AA	-	rs57736899		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																					3	.	3	0	.	0		-				intergenic_variant						rs57736899	1																																			MODIFIER	1	deletion														.	AGAAA	.	.																					23646717
Unknown	0	.	GRCh37	5	23769008	23769009	+	IGR	INS	-	-	TCTTT	rs71605626		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TCTTT				intergenic_variant						rs71605626	1																				0.6256	0.6599		0.5784	0.7038	0.7147										MODIFIER	1	insertion														.	GCT	.	.																					23769008
CDH6	1004	.	GRCh37	5	31296893	31296893	+	Intron	DEL	C	C	-	rs35538920		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.524-502del			ENST00000265071		5	.	3	3	.	0	CDH6,intron_variant,,ENST00000265071,NM_004932.3;CDH6,intron_variant,,ENST00000514738,;CDH6,intron_variant,,ENST00000508132,;	-	ENSG00000113361	ENST00000265071	Transcript	intron_variant						rs35538920	1		1	CDH6	HGNC	1765	protein_coding	YES	CCDS3894.1	ENSP00000265071	P55285		UPI0000126D9B	NM_004932.3				3/11			0.1362	0.3674		0.3155	0.34	0.1534										MODIFIER	1	deletion														.	ATCC	.	.																					31296892
PDZD2	23037	.	GRCh37	5	31751689	31751690	+	Intron	INS	-	-	T	rs34613055		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-360-47306dup			ENST00000438447		4	.	4	0	.	0	PDZD2,intron_variant,,ENST00000438447,;PDZD2,intron_variant,,ENST00000513910,;RP11-5N11.6,upstream_gene_variant,,ENST00000509629,;RP11-5N11.7,upstream_gene_variant,,ENST00000515522,;PDZD2,intron_variant,,ENST00000502824,;	T	ENSG00000133401	ENST00000438447	Transcript	intron_variant						rs34613055	1		1	PDZD2	HGNC	18486	protein_coding	YES	CCDS34137.1	ENSP00000402033	O15018	B4DGS3	UPI000069648B					1/24			0.1029	0.1441		0.0099	0.1918	0.0552										MODIFIER	1	insertion														.	TGT	.	.																					31751689
MTMR12	54545	.	GRCh37	5	32313741	32313742	+	5'Flank	DEL	TG	TG	-	rs137997250		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																			ENST00000382142		3	.	3	0	.	0	MTMR12,upstream_gene_variant,,ENST00000264934,;MTMR12,upstream_gene_variant,,ENST00000280285,;MTMR12,upstream_gene_variant,,ENST00000382142,NM_001040446.1;RNU6-378P,downstream_gene_variant,,ENST00000384324,;MTMR12,upstream_gene_variant,,ENST00000505419,;MTMR12,upstream_gene_variant,,ENST00000513622,;,regulatory_region_variant,,ENSR00000179064,;	-	ENSG00000150712	ENST00000382142	Transcript	upstream_gene_variant						rs137997250	1	626	-1	MTMR12	HGNC	18191	protein_coding	YES	CCDS34138.1	ENSP00000371577	Q9C0I1		UPI00001678D2	NM_001040446.1																						MODIFIER	1	deletion														.	TTTGT	.	.																					32313740
OSMR	9180	.	GRCh37	5	38935412	38935414	+	3'UTR	DEL	CAA	CAA	-	rs16351		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAA	CAA																c.*1870_*1872del			ENST00000274276	18/18	4	.	4	0	.	0	OSMR,3_prime_UTR_variant,,ENST00000274276,NM_003999.2;RICTOR,downstream_gene_variant,,ENST00000296782,NM_001285439.1;RICTOR,downstream_gene_variant,,ENST00000357387,NM_152756.3;OSMR,intron_variant,,ENST00000508882,;OSMR,intron_variant,,ENST00000509237,;RICTOR,downstream_gene_variant,,ENST00000511516,NM_001285440.1;	-	ENSG00000145623	ENST00000274276	Transcript	3_prime_UTR_variant	5208-5210/5539					rs16351	1		1	OSMR	HGNC	8507	protein_coding	YES	CCDS3928.1	ENSP00000274276	Q99650		UPI000004CAC3	NM_003999.2			18/18				0.7663	0.5202		0.5962	0.6113	0.6452										MODIFIER	1	deletion													1	.	GTCAAC	.	.																					38935411
FST	10468	.	GRCh37	5	52781377	52781378	+	Intron	INS	-	-	T	rs5867881		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.952+320dup			ENST00000256759		22	.	3	25	.	0	FST,intron_variant,,ENST00000256759,NM_013409.2;FST,intron_variant,,ENST00000396947,NM_006350.3;FST,intron_variant,,ENST00000497789,;FST,intron_variant,,ENST00000504226,;FST,downstream_gene_variant,,ENST00000491717,;	TT	ENSG00000134363	ENST00000256759	Transcript	intron_variant						rs5867881	2		1	FST	HGNC	3971	protein_coding	YES	CCDS3959.1	ENSP00000256759	P19883		UPI000012AC56	NM_013409.2				5/5																		MODIFIER	1	sequence_alteration														.	AGTT	.	.																					52781376
Unknown	0	.	GRCh37	5	53058390	53058390	+	IGR	DEL	G	G	-	rs141579796		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					3	.	3	0	.	0		-				intergenic_variant						rs141579796	1																			0.3275	0.3268	0.4827		0.2242	0.4026	0.2474										MODIFIER	1	deletion														.	CAGT	.	.																					53058389
CTD-2031P19.3	441072	.	GRCh37	5	55301873	55301874	+	3'Flank	INS	-	-	A	rs71602930		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000500093		4	.	4	0	.	0	CTD-2031P19.3,downstream_gene_variant,,ENST00000500093,;,regulatory_region_variant,,ENSR00001691906,;	A	ENSG00000227908	ENST00000500093	Transcript	downstream_gene_variant						rs71602930	1	2396	1	CTD-2031P19.3	Clone_based_vega_gene		antisense	YES													0.1248	0.0836		0.0347	0.1103	0.0828										MODIFIER	1	insertion														.	TTA	.	.																					55301873
Unknown	0	.	GRCh37	5	57116881	57116882	+	IGR	INS	-	-	T	rs60987230		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs60987230	1																				0.2753	0.1643		0.2579	0.0895	0.1237										MODIFIER	1	insertion														.	GAT	.	.																					57116881
RAB3C	115827	.	GRCh37	5	57911812	57911813	+	Intron	INS	-	-	AC	rs58004467		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.25-1633_25-1632dup			ENST00000282878		3	.	3	0	.	0	RAB3C,intron_variant,,ENST00000282878,NM_138453.2;RAB3C,intron_variant,,ENST00000513316,;	AC	ENSG00000152932	ENST00000282878	Transcript	intron_variant						rs58004467	1		1	RAB3C	HGNC	30269	protein_coding	YES	CCDS3976.1	ENSP00000282878	Q96E17		UPI0000133178	NM_138453.2				1/4			0.3805	0.4827		0.6677	0.4891	0.5798										MODIFIER	1	insertion														.	AGA	.	.																					57911812
DEPDC1B	55789	.	GRCh37	5	59894839	59894839	+	Intron	DEL	A	A	-	rs58987696		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1428+63del			ENST00000265036		53	.	8	61	.	0	DEPDC1B,intron_variant,,ENST00000265036,NM_018369.2;DEPDC1B,intron_variant,,ENST00000453022,NM_001145208.1;DEPDC1B,intron_variant,,ENST00000545085,;DEPDC1B,intron_variant,,ENST00000512078,;,regulatory_region_variant,,ENSR00001692418,;	-	ENSG00000035499	ENST00000265036	Transcript	intron_variant						rs58987696	2		-1	DEPDC1B	HGNC	24902	protein_coding	YES	CCDS3977.1	ENSP00000265036	Q8WUY9		UPI000020C7D4	NM_018369.2				10/10			0.0265	0.0187		0.0069	0.0199	0.0297										MODIFIER	1	sequence_alteration														.	ATAA	.	.																					59894838
MAST4	375449	.	GRCh37	5	66162033	66162034	+	Intron	INS	-	-	TGCATTT	rs61400765		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.643-33745_643-33739dup			ENST00000403625		3	.	3	0	.	0	MAST4,intron_variant,,ENST00000403625,NM_001164664.1;MAST4,intron_variant,,ENST00000403666,NM_015183.2;MAST4,intron_variant,,ENST00000404260,;MAST4,intron_variant,,ENST00000406039,;MAST4,intron_variant,,ENST00000406374,NM_198828.2;MAST4,intron_variant,,ENST00000411628,;MAST4,intron_variant,,ENST00000432817,;MAST4,intron_variant,,ENST00000434115,;MAST4,intron_variant,,ENST00000450827,;MAST4,intron_variant,,ENST00000452953,;MAST4,intron_variant,,ENST00000490016,;MAST4,intron_variant,,ENST00000470421,;	TGCATTT	ENSG00000069020	ENST00000403625	Transcript	intron_variant						rs61400765	1		1	MAST4	HGNC	19037	protein_coding	YES	CCDS54861.1	ENSP00000385727		J3QT34	UPI000173A2B0	NM_001164664.1				3/28			0.2557	0.4813		0.2579	0.6431	0.4857										MODIFIER	1	insertion														.	TCT	.	.																					66162033
ENSR00001329423	0	.	GRCh37	5	71375472	71375472	+	IGR	DEL	T	T	-	rs11299534		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENSR00001329423		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001329423,;	-		ENSR00001329423	RegulatoryFeature	regulatory_region_variant						rs11299534	1																				0.7148	0.6254		0.8085	0.5278	0.6943										MODIFIER	1	deletion														.	CCTT	.	.																					71375471
MAP1B	4131	.	GRCh37	5	71421032	71421034	+	Intron	DEL	AGG	AGG	-	rs139815234		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGG	AGG																c.286+9408_286+9410del			ENST00000296755		4	.	3	2	.	0	MAP1B,intron_variant,,ENST00000296755,NM_005909.3;MAP1B,intron_variant,,ENST00000511641,;MAP1B,intron_variant,,ENST00000512974,;MAP1B,intron_variant,,ENST00000513526,;,regulatory_region_variant,,ENSR00001329439,;	-	ENSG00000131711	ENST00000296755	Transcript	intron_variant						rs139815234	1		1	MAP1B	HGNC	6836	protein_coding	YES	CCDS4012.1	ENSP00000296755	P46821	D6RGJ3,D6RA40	UPI000013E382	NM_005909.3				2/6				0.0951		0.0952	0.0547	0.1554										MODIFIER	1	deletion													1	.	CTAGGA	.	.																					71421031
ARHGEF28	64283	.	GRCh37	5	73151925	73151925	+	Intron	DEL	T	T	-	rs11288253		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1791-1551del			ENST00000545377		4	.	4	0	.	0	ARHGEF28,intron_variant,,ENST00000287898,;ARHGEF28,intron_variant,,ENST00000296794,;ARHGEF28,intron_variant,,ENST00000296799,NM_001244364.1;ARHGEF28,intron_variant,,ENST00000426542,;ARHGEF28,intron_variant,,ENST00000437974,;ARHGEF28,intron_variant,,ENST00000513042,NM_001177693.1;ARHGEF28,intron_variant,,ENST00000545377,NM_001080479.2;	-	ENSG00000214944	ENST00000545377	Transcript	intron_variant						rs11288253	1		1	ARHGEF28	HGNC	30322	protein_coding	YES	CCDS47231.2	ENSP00000441913	Q8N1W1	D6RAP0	UPI00004DF58E	NM_001080479.2				14/36			0.0832	0.3256		0.0744	0.2654	0.1933										MODIFIER	1	deletion														.	TATT	.	.																					73151924
COL4A3BP	10087	.	GRCh37	5	74680298	74680299	+	Intron	DEL	GA	GA	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GA	GA																c.1872+168_1872+169del			ENST00000380494		3	.	3	0	.	0	COL4A3BP,intron_variant,,ENST00000261415,NM_031361.2;COL4A3BP,intron_variant,,ENST00000357457,;COL4A3BP,intron_variant,,ENST00000380494,NM_001130105.1;COL4A3BP,intron_variant,,ENST00000405807,NM_005713.2;COL4A3BP,upstream_gene_variant,,ENST00000508809,;COL4A3BP,intron_variant,,ENST00000508692,;	-	ENSG00000113163	ENST00000380494	Transcript	intron_variant							1		-1	COL4A3BP	HGNC	2205	protein_coding	YES	CCDS47235.1	ENSP00000369862	Q9Y5P4		UPI00003E5FC3	NM_001130105.1				15/18																		MODIFIER	1	deletion														.	CTGAA	.	.																					74680297
RPL7P23	0	.	GRCh37	5	76880952	76880953	+	3'Flank	INS	-	-	A	rs537337720		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000593668		3	.	3	0	.	0	WDR41,intron_variant,,ENST00000509971,;WDR41,intron_variant,,ENST00000509858,;RPL7P23,downstream_gene_variant,,ENST00000493874,;RPL7P23,downstream_gene_variant,,ENST00000593668,;	A	ENSG00000244363	ENST00000593668	Transcript	downstream_gene_variant						rs537337720	1	1942	1	RPL7P23	HGNC	35658	processed_pseudogene	YES																												MODIFIER	1	insertion														.	AGA	.	.																					76880952
SCAMP1	9522	.	GRCh37	5	77758850	77758851	+	Intron	INS	-	-	G	rs35082026		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.852+3665_852+3666insG			ENST00000538629		4	.	4	0	.	0	SCAMP1,intron_variant,,ENST00000538629,NM_004866.4;SCAMP1,intron_variant,,ENST00000320280,;SCAMP1,intron_variant,,ENST00000339292,;SCAMP1,intron_variant,,ENST00000506858,;SCAMP1,intron_variant,,ENST00000508822,;SCAMP1,intron_variant,,ENST00000509998,;	G	ENSG00000085365	ENST00000538629	Transcript	intron_variant						rs35082026	1		1	SCAMP1	HGNC	10563	protein_coding	YES		ENSP00000475496		U3KQ30	UPI00001B94D7	NM_004866.4				8/8		0.7256	0.8593	0.5202		0.627	0.7694	0.7474										MODIFIER	1	insertion														.	TTT	.	.																					77758850
BHMT2	23743	.	GRCh37	5	78384181	78384182	+	Intron	INS	-	-	TG	rs202040828		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1011-96_1011-95dup			ENST00000255192		7	4	3	4	4	0	BHMT2,intron_variant,,ENST00000255192,NM_017614.4;BHMT2,intron_variant,,ENST00000521567,NM_001178005.1;DMGDH,intron_variant,,ENST00000520388,;	TG	ENSG00000132840	ENST00000255192	Transcript	intron_variant						rs202040828	1		1	BHMT2	HGNC	1048	protein_coding	YES	CCDS4045.1	ENSP00000255192	Q9H2M3	E5RH96	UPI00000701B9	NM_017614.4				7/7																		MODIFIER	1	insertion														.	ACT	.	.																					78384181
Unknown	0	.	GRCh37	5	85974803	85974804	+	IGR	DEL	TT	TT	-	rs11293434		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																					3	.	3	0	.	0		-				intergenic_variant						rs11293434	1																																			MODIFIER	1	deletion														.	AATTT	.	.																					85974802
GPR98	84059	.	GRCh37	5	89879663	89879664	+	Intron	DEL	AT	AT	-	rs3041942		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																c.22+24929_22+24930del			ENST00000405460		5	.	5	0	.	0	GPR98,intron_variant,,ENST00000405460,NM_032119.3;GPR98,intron_variant,,ENST00000508842,;	-	ENSG00000164199	ENST00000405460	Transcript	intron_variant						rs3041942	1		1	GPR98	HGNC	17416	protein_coding	YES	CCDS47246.1	ENSP00000384582	Q8WXG9		UPI00002127A7	NM_032119.3				1/89		0.4503	0.3623	0.3646		0.5754	0.4742	0.4765										MODIFIER	1	deletion													1	.	AAATG	.	.																					89879662
MCTP1	79772	.	GRCh37	5	94372615	94372616	+	Intron	INS	-	-	TCACTCACTCAC	rs141556044		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.721-19439_721-19428dup			ENST00000515393		6	.	6	0	.	0	MCTP1,intron_variant,,ENST00000312216,NM_001002796.2;MCTP1,intron_variant,,ENST00000429576,;MCTP1,intron_variant,,ENST00000503301,;MCTP1,intron_variant,,ENST00000505208,;MCTP1,intron_variant,,ENST00000505465,;MCTP1,intron_variant,,ENST00000508509,;MCTP1,intron_variant,,ENST00000510732,;MCTP1,intron_variant,,ENST00000512425,;MCTP1,intron_variant,,ENST00000515393,NM_024717.4;MCTP1,intron_variant,,ENST00000513695,;MCTP1,intron_variant,,ENST00000513857,;,regulatory_region_variant,,ENSR00001695685,;	TCACTCACTCAC	ENSG00000175471	ENST00000515393	Transcript	intron_variant						rs141556044	1		-1	MCTP1	HGNC	26183	protein_coding	YES	CCDS34203.1	ENSP00000424126	Q6DN14	E5RJR1	UPI0000D6165C	NM_024717.4				1/22			0.5242	0.8573		0.8879	0.9235	0.8906										MODIFIER	1	insertion														.	TTT	.	.																					94372615
CAST	831	.	GRCh37	5	96072163	96072166	+	Intron	DEL	AAAC	AAAC	-	rs34594086		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAC	AAAC																c.576+227_576+230del			ENST00000395812		8	.	8	0	.	0	CAST,intron_variant,,ENST00000309190,NM_173060.3,NM_001284213.1;CAST,intron_variant,,ENST00000325674,;CAST,intron_variant,,ENST00000338252,NM_001190442.1;CAST,intron_variant,,ENST00000341926,;CAST,intron_variant,,ENST00000359176,NM_001284213.1;CAST,intron_variant,,ENST00000395812,NM_001042440.2,NM_001284213.1,NM_001284212.1;CAST,intron_variant,,ENST00000395813,NM_001284213.1;CAST,intron_variant,,ENST00000421689,;CAST,intron_variant,,ENST00000504465,;CAST,intron_variant,,ENST00000505143,;CAST,intron_variant,,ENST00000508197,;CAST,intron_variant,,ENST00000508608,;CAST,intron_variant,,ENST00000508830,;CAST,intron_variant,,ENST00000509903,;CAST,intron_variant,,ENST00000510156,;CAST,intron_variant,,ENST00000510756,;CAST,intron_variant,,ENST00000511049,;CAST,intron_variant,,ENST00000511097,;CAST,intron_variant,,ENST00000511782,;CAST,intron_variant,,ENST00000512620,;CAST,upstream_gene_variant,,ENST00000437034,;CAST,upstream_gene_variant,,ENST00000510500,;CTC-506B8.1,downstream_gene_variant,,ENST00000502568,;CAST,intron_variant,,ENST00000348386,;CAST,intron_variant,,ENST00000513666,;CAST,intron_variant,,ENST00000515063,;CAST,downstream_gene_variant,,ENST00000508117,;	-	ENSG00000153113	ENST00000395812	Transcript	intron_variant						rs34594086	1		1	CAST	HGNC	1515	protein_coding	YES	CCDS54882.1	ENSP00000379157	P20810	E7EQ12	UPI0000DA4C59	NM_001042440.2,NM_001284213.1,NM_001284212.1				8/29			0.0696	0.2248		0.0923	0.34	0.2004										MODIFIER	1	deletion													1	.	AAAAACA	.	.																					96072162
RP11-1152B5.1	0	.	GRCh37	5	101309976	101309980	+	5'Flank	DEL	TAACT	TAACT	-	rs141396863		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAACT	TAACT																			ENST00000515228		4	.	4	0	.	0	RP11-1152B5.1,upstream_gene_variant,,ENST00000515228,;	-	ENSG00000249495	ENST00000515228	Transcript	upstream_gene_variant						rs141396863	1	2020	1	RP11-1152B5.1	Clone_based_vega_gene		processed_pseudogene	YES													0.1694	0.0922			0.1233	0.0245										MODIFIER	1	deletion														.	GCTAACTT	.	.																					101309975
Unknown	0	.	GRCh37	5	101380173	101380174	+	IGR	INS	-	-	AAT	rs3040000		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AAT				intergenic_variant						rs3040000	1																				0.3593	0.2594		0.1141	0.2793	0.1769										MODIFIER	1	insertion														.	AAA	.	.																					101380173
CTC-254B4.1	102467213	.	GRCh37	5	106337780	106337781	+	Intron	INS	-	-	ATTA	rs10692244		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.75+8860_75+8861insTAAT			ENST00000513273		4	.	4	0	.	0	CTC-254B4.1,intron_variant,,ENST00000513273,;	ATTA	ENSG00000251027	ENST00000513273	Transcript	intron_variant,non_coding_transcript_variant						rs10692244	1		-1	CTC-254B4.1	Clone_based_vega_gene		lincRNA											1/3			0.6838	0.804		0.8829	0.7664	0.7975										MODIFIER	1	insertion														.	TCA	.	.																					106337780
NREP-AS1	100873948	.	GRCh37	5	111339982	111339982	+	Intron	DEL	C	C	-	rs34079753		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																n.444-12848del			ENST00000507222		4	.	4	0	.	0	NREP-AS1,intron_variant,,ENST00000503242,;NREP-AS1,intron_variant,,ENST00000507222,;	-	ENSG00000250095	ENST00000507222	Transcript	intron_variant,non_coding_transcript_variant						rs34079753	1		1	NREP-AS1	HGNC	40780	antisense	YES										3/3			0.1921	0.4957		0.5675	0.3738	0.589										MODIFIER	1	deletion														.	CACC	.	.																					111339981
APC	324	.	GRCh37	5	112166045	112166047	+	Intron	DEL	ACT	ACT	-	rs34481414		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACT	ACT																c.1743+1378_1743+1380del			ENST00000457016		3	.	3	0	.	0	APC,intron_variant,,ENST00000257430,NM_000038.5;APC,intron_variant,,ENST00000457016,;APC,intron_variant,,ENST00000504915,;APC,intron_variant,,ENST00000507379,NM_001127511.2;APC,intron_variant,,ENST00000508376,NM_001127510.2;APC,intron_variant,,ENST00000512211,;APC,intron_variant,,ENST00000502371,;APC,intron_variant,,ENST00000508624,;APC,intron_variant,,ENST00000514164,;CTC-554D6.1,intron_variant,,ENST00000520401,;APC,downstream_gene_variant,,ENST00000505084,;	-	ENSG00000134982	ENST00000457016	Transcript	intron_variant						rs34481414	1		1	APC	HGNC	583	protein_coding	YES	CCDS4107.1	ENSP00000413133	P25054	Q9UM98,Q9P119,Q9HAW6,Q4LE70,E9PFT7,D6RFL6,B2ZRE1,A5HB97,A5HB96,A5HB95,A5HB94,A1YIQ7	UPI000013CF60					14/15			0.4932	0.6671		0.8155	0.5249	0.6534										MODIFIER	1	deletion													1	.	AAACTA	.	.																					112166044
Unknown	0	.	GRCh37	5	113076658	113076659	+	IGR	INS	-	-	CT	rs10627250		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		CT				intergenic_variant						rs10627250	1																				0.9402	0.9712		1	0.9463	0.9673										MODIFIER	1	insertion														.	CAC	.	.																					113076658
ENSR00001697866	0	.	GRCh37	5	121600405	121600406	+	IGR	INS	-	-	TTTTCC	rs3031364		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001697866		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001697866,;	TTTTCC		ENSR00001697866	RegulatoryFeature	regulatory_region_variant						rs3031364	1																				0.0756	0.1916		0.0933	0.2296	0.3098										MODIFIER	1	insertion														.	GGT	.	.																					121600405
Unknown	0	.	GRCh37	5	121875453	121875454	+	IGR	INS	-	-	A	rs71623254		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		A				intergenic_variant						rs71623254	1																				0.6157	0.6023		0.8026	0.6074	0.6176										MODIFIER	1	insertion														.	GTA	.	.																					121875453
ZNF608	57507	.	GRCh37	5	124003152	124003153	+	Intron	INS	-	-	CACCGT	rs61246286		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1163-17768_1163-17763dup			ENST00000306315		3	.	3	0	.	0	ZNF608,intron_variant,,ENST00000306315,NM_020747.2;ZNF608,intron_variant,,ENST00000504926,;ZNF608,intron_variant,,ENST00000509799,;ZNF608,intron_variant,,ENST00000513986,;ZNF608,intron_variant,,ENST00000503896,;ZNF608,intron_variant,,ENST00000507508,;ZNF608,intron_variant,,ENST00000511308,;ZNF608,intron_variant,,ENST00000505686,;,regulatory_region_variant,,ENSR00001339186,;	CACCGT	ENSG00000168916	ENST00000306315	Transcript	intron_variant						rs61246286	1		-1	ZNF608	HGNC	29238	protein_coding	YES	CCDS34219.1	ENSP00000307746	Q9ULD9	Q9UFL4,B3KPE6	UPI000013EB23	NM_020747.2				2/8																		MODIFIER	1	insertion														.	CCC	.	.																					124003152
RP11-114J13.1	0	.	GRCh37	5	125512766	125512767	+	Intron	INS	-	-	C	rs138491381		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.72-78913dup			ENST00000450613		3	.	3	0	.	0	RP11-114J13.1,intron_variant,,ENST00000450613,;CTC-339D2.1,upstream_gene_variant,,ENST00000507428,;	C	ENSG00000248752	ENST00000450613	Transcript	intron_variant,non_coding_transcript_variant						rs138491381	1		-1	RP11-114J13.1	Clone_based_vega_gene		lincRNA	YES										1/2			0.9985	1		0.999	1	1										MODIFIER	1	insertion														.	TAC	.	.																					125512766
RP11-114H7.2	0	.	GRCh37	5	130331989	130331989	+	3'Flank	DEL	A	A	-	rs34671325		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000508316		3	.	3	0	.	0	RP11-114H7.2,downstream_gene_variant,,ENST00000508316,;	-	ENSG00000250405	ENST00000508316	Transcript	downstream_gene_variant						rs34671325	1	132	1	RP11-114H7.2	Clone_based_vega_gene		processed_pseudogene	YES													0.5295	0.6354		0.5873	0.6352	0.5716										MODIFIER	1	deletion														.	CCAA	.	.																					130331988
FSTL4	23105	.	GRCh37	5	132628247	132628248	+	Intron	INS	-	-	A	rs35459497		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.727+20098dup			ENST00000265342		3	.	3	0	.	0	FSTL4,intron_variant,,ENST00000265342,NM_015082.1;,regulatory_region_variant,,ENSR00001699006,;	A	ENSG00000053108	ENST00000265342	Transcript	intron_variant						rs35459497	1		-1	FSTL4	HGNC	21389	protein_coding	YES	CCDS34238.1	ENSP00000265342	Q6MZW2		UPI000003AFB0	NM_015082.1				6/15			0.4871	0.4409		0.3522	0.4761	0.3906										MODIFIER	1	insertion														.	TCA	.	.																					132628247
FAM13B	51306	.	GRCh37	5	137347734	137347736	+	Intron	DEL	ACA	ACA	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACA	ACA																c.371-102_371-100del			ENST00000033079		6	4	2	17	0	0	FAM13B,intron_variant,,ENST00000033079,NM_016603.2;FAM13B,intron_variant,,ENST00000420893,NM_001101800.1;FAM13B,intron_variant,,ENST00000425075,NM_001101801.1;FAM13B,intron_variant,,ENST00000514310,;,regulatory_region_variant,,ENSR00001699585,;	-	ENSG00000031003	ENST00000033079	Transcript	intron_variant							1		-1	FAM13B	HGNC	1335	protein_coding	YES	CCDS4195.1	ENSP00000033079	Q9NYF5	D6RE97,D6RDL7,D6RCA0,D6RBJ3,D6RAT6	UPI000004A03C	NM_016603.2				4/22																		MODIFIER	1	deletion														.	ATACAA	.	.																					137347733
UBE2D2	7322	.	GRCh37	5	138945963	138945976	+	Intron	DEL	GGTCATGCACAGTG	GGTCATGCACAGTG	-	rs59548103		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GGTCATGCACAGTG	GGTCATGCACAGTG																c.24+4582_24+4595del			ENST00000398733		4	.	4	0	.	0	UBE2D2,intron_variant,,ENST00000253815,NM_181838.1;UBE2D2,intron_variant,,ENST00000398733,NM_003339.2;UBE2D2,intron_variant,,ENST00000505007,;UBE2D2,intron_variant,,ENST00000505548,;UBE2D2,intron_variant,,ENST00000511725,;UBE2D2,intron_variant,,ENST00000398734,;UBE2D2,intron_variant,,ENST00000510470,;	-	ENSG00000131508	ENST00000398733	Transcript	intron_variant						rs59548103	1		1	UBE2D2	HGNC	12475	protein_coding	YES	CCDS43369.1	ENSP00000381717	P62837	D6RFM0,D6RAW0	UPI0000006BD0	NM_003339.2				1/6																		MODIFIER	1	deletion														.	CAGGTCATGCACAGTGG	.	.																					138945962
PCDHGA3	56112	.	GRCh37	5	140795208	140795209	+	Intron	INS	-	-	A	rs113784532		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2424+69195dup			ENST00000253812		50	.	5	40	.	0	PCDHGA3,intron_variant,,ENST00000253812,NM_018916.3,NM_032011.1;PCDHGA2,intron_variant,,ENST00000394576,NM_018915.2;PCDHGA8,intron_variant,,ENST00000398604,NM_032088.1;PCDHGA10,intron_variant,,ENST00000398610,NM_018913.2,NM_032090.1;PCDHGA1,intron_variant,,ENST00000517417,NM_018912.2;PCDHGA6,intron_variant,,ENST00000517434,NM_018919.2,NM_032086.1;PCDHGA5,intron_variant,,ENST00000518069,NM_018918.2,NM_032054.1;PCDHGA7,intron_variant,,ENST00000518325,NM_018920.2;PCDHGB4,intron_variant,,ENST00000519479,NM_003736.2,NM_018925.2,NM_032098.1;PCDHGB6,intron_variant,,ENST00000520790,NM_018926.2,NM_032100.1;PCDHGB2,intron_variant,,ENST00000522605,NM_018923.2,NM_032096.1;PCDHGB1,intron_variant,,ENST00000523390,NM_018922.2,NM_032095.1;PCDHGA4,intron_variant,,ENST00000571252,NM_018917.2;PCDHGA9,intron_variant,,ENST00000573521,NM_018921.2,NM_032089.1;PCDHGB3,intron_variant,,ENST00000576222,NM_018924.2,NM_032097.1;PCDHGB7,upstream_gene_variant,,ENST00000398594,NM_018927.3;	A	ENSG00000254245	ENST00000253812	Transcript	intron_variant						rs113784532	1		1	PCDHGA3	HGNC	8701	protein_coding	YES	CCDS47290.1	ENSP00000253812	Q9Y5H0	Q9UKW1,Q9BT64	UPI0000161C1A	NM_018916.3,NM_032011.1				1/3									0.08189	0.06387								MODIFIER		insertion														.	TTA	.	.												0.1101	0.1061	0.1036	0.1567	0.08737	0.07974	0.1056	0.1213	0.1635	140795208
ARHGAP26	23092	.	GRCh37	5	142543610	142543611	+	Intron	INS	-	-	T	rs543247118		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1988+16678dup			ENST00000274498		3	.	3	0	.	0	ARHGAP26,intron_variant,,ENST00000274498,NM_015071.4;ARHGAP26,intron_variant,,ENST00000378004,NM_001135608.1;ARHGAP26,intron_variant,,ENST00000418236,;ARHGAP26,intron_variant,,ENST00000443674,;ARHGAP26,upstream_gene_variant,,ENST00000486650,;ARHGAP26,intron_variant,,ENST00000419676,;ARHGAP26,intron_variant,,ENST00000424007,;	T	ENSG00000145819	ENST00000274498	Transcript	intron_variant						rs543247118	1		1	ARHGAP26	HGNC	17073	protein_coding	YES	CCDS4277.1	ENSP00000274498	Q9UNA1	Q9HBW4,Q8NFJ1,C9J6V4	UPI0000130D6B	NM_015071.4				20/22																		MODIFIER	1	insertion													1	.	TCT	.	.																					142543610
YIPF5	81555	.	GRCh37	5	143553465	143553466	+	5'Flank	DEL	TT	TT	-	rs58804094		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																			ENST00000274496		3	.	3	0	.	0	KCTD16,intron_variant,,ENST00000512467,;YIPF5,upstream_gene_variant,,ENST00000274496,NM_030799.8;YIPF5,upstream_gene_variant,,ENST00000448443,NM_001024947.3;YIPF5,upstream_gene_variant,,ENST00000513112,NM_001271732.1;YIPF5,upstream_gene_variant,,ENST00000519064,;YIPF5,upstream_gene_variant,,ENST00000522203,;YIPF5,upstream_gene_variant,,ENST00000508754,;	-	ENSG00000145817	ENST00000274496	Transcript	upstream_gene_variant						rs58804094	1	3242	-1	YIPF5	HGNC	24877	protein_coding	YES	CCDS4279.1	ENSP00000274496	Q969M3	E5RHH4,E5RGR9	UPI00000474FE	NM_030799.8																						MODIFIER	1	deletion														.	GATTT	.	.																					143553464
CTC-295J13.3	0	.	GRCh37	5	147626673	147626673	+	3'Flank	DEL	T	T	-	rs35867610		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000513133		3	.	3	0	.	0	CTC-295J13.3,downstream_gene_variant,,ENST00000513133,;	-	ENSG00000248109	ENST00000513133	Transcript	downstream_gene_variant						rs35867610	1	4516	1	CTC-295J13.3	Clone_based_vega_gene		lincRNA	YES													0.3669	0.8948		0.8343	0.9254	0.8579										MODIFIER	1	deletion														.	AGTT	.	.																					147626672
MIR145	406937	.	GRCh37	5	148816511	148816512	+	3'Flank	INS	-	-	A	rs35797277		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000602315		3	.	3	0	.	0	MIR145,downstream_gene_variant,,ENST00000602315,;	A	ENSG00000269936	ENST00000602315	Transcript	downstream_gene_variant						rs35797277	1	4114	1	MIR145	HGNC	31532	lincRNA	YES													0.1838	0.4885		0.4306	0.4672	0.3333										MODIFIER	1	insertion														.	TCA	.	.																					148816511
ENSR00001700999	0	.	GRCh37	5	149062283	149062290	+	IGR	DEL	GAAGGAAG	GAAGGAAG	-	rs144812362		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAAGGAAG	GAAGGAAG																			ENSR00001700999		6	.	6	0	.	0	,regulatory_region_variant,,ENSR00001700999,;	-		ENSR00001700999	RegulatoryFeature	regulatory_region_variant						rs144812362	1																				0.1142	0.1066		0.1101	0.1779	0.1186										MODIFIER	1	deletion														.	TTGAAGGAAGG	.	.																					149062282
PPARGC1B	133522	.	GRCh37	5	149157656	149157675	+	Intron	DEL	ACACACACACACACACACAG	ACACACACACACACACACAG	-	rs1183022472		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACACACACACACACACAG	ACACACACACACACACACAG																c.79-42339_79-42320del			ENST00000309241		3	.	3	0	.	0	PPARGC1B,intron_variant,,ENST00000309241,NM_133263.3;PPARGC1B,intron_variant,,ENST00000360453,NM_001172698.1;PPARGC1B,intron_variant,,ENST00000394320,;PPARGC1B,intron_variant,,ENST00000403750,NM_001172699.1;PPARGC1B,intron_variant,,ENST00000461780,;,regulatory_region_variant,,ENSR00001701013,;	-	ENSG00000155846	ENST00000309241	Transcript	intron_variant						rs1183022472	1		1	PPARGC1B	HGNC	30022	protein_coding	YES	CCDS4298.1	ENSP00000312649	Q86YN6		UPI000006F49D	NM_133263.3				1/11																		MODIFIER	1	deletion														.	ACACACACACACACACACACAGA	.	.																					149157655
Unknown	0	.	GRCh37	5	151756435	151756436	+	IGR	INS	-	-	T	rs11389017		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					10	.	10	0	.	0		T				intergenic_variant						rs11389017	1																				0.5242	0.4856		0.2569	0.4821	0.5286										MODIFIER	1	insertion														.	TAT	.	.																					151756435
Unknown	0	.	GRCh37	5	154024675	154024679	+	IGR	DEL	ACTCC	ACTCC	-	rs4031836		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACTCC	ACTCC																					3	.	3	0	.	0		-				intergenic_variant						rs4031836	1																				0.1097	0.1873		0.3671	0.1431	0.1738										MODIFIER	1	deletion														.	TGACTCCA	.	.																					154024674
Unknown	0	.	GRCh37	5	154690133	154690134	+	IGR	DEL	TC	TC	-	rs59615030		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TC	TC																					8	5	3	5	5	0		-				intergenic_variant						rs59615030	1																																			MODIFIER	1	deletion														.	TGTCT	.	.																					154690132
Unknown	0	.	GRCh37	5	158982037	158982038	+	IGR	INS	-	-	A	rs35538979		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	4	3	.	0		A				intergenic_variant						rs35538979	1																				0.056	0.072		0.0714	0.1302	0.0389										MODIFIER	1	insertion														.	TGA	.	.																					158982037
Unknown	0	.	GRCh37	5	161415692	161415692	+	IGR	DEL	A	A	-	rs568464685		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs568464685	1																																			MODIFIER	1	deletion														.	AGAA	.	.																					161415691
RP11-541P9.3	0	.	GRCh37	5	162698632	162698637	+	Intron	DEL	AAAAAA	AAAAAA	-	rs5872811		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAAAA	AAAAAA																n.322+154172_322+154177del			ENST00000458002		4	.	4	0	.	0	RP11-541P9.3,intron_variant,,ENST00000458002,;RP11-541P9.3,intron_variant,,ENST00000503504,;	-	ENSG00000250061	ENST00000458002	Transcript	intron_variant,non_coding_transcript_variant						rs5872811	1		-1	RP11-541P9.3	Clone_based_vega_gene		antisense											3/4																		MODIFIER		deletion														.	TCAAAAAAA	.	.																					162698631
CTC-340A15.2	102546299	.	GRCh37	5	164532254	164532255	+	Intron	INS	-	-	CAAT	rs10645008		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.118-24563_118-24562insTCAA			ENST00000519267		3	.	3	0	.	0	CTC-340A15.2,intron_variant,,ENST00000519267,;CTC-340A15.2,intron_variant,,ENST00000519570,;CTC-340A15.2,intron_variant,,ENST00000522303,;CTC-340A15.2,intron_variant,,ENST00000522646,;	CAAT	ENSG00000241956	ENST00000519267	Transcript	intron_variant,non_coding_transcript_variant						rs10645008	1		1	CTC-340A15.2	Clone_based_vega_gene		antisense											2/2			0.8359	0.647		0.6716	0.4911	0.5532										MODIFIER		insertion														.	ACC	.	.																					164532254
CTC-340A15.2	102546299	.	GRCh37	5	164535644	164535645	+	Intron	INS	-	-	TC	rs140017076		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.118-21162_118-21161dup			ENST00000519267		3	.	3	0	.	0	CTC-340A15.2,intron_variant,,ENST00000519267,;CTC-340A15.2,intron_variant,,ENST00000519570,;CTC-340A15.2,intron_variant,,ENST00000522303,;CTC-340A15.2,intron_variant,,ENST00000522646,;	TC	ENSG00000241956	ENST00000519267	Transcript	intron_variant,non_coding_transcript_variant						rs140017076	1		1	CTC-340A15.2	Clone_based_vega_gene		antisense											2/2																		MODIFIER		insertion														.	TTT	.	.																					164535644
CTB-7E3.1	102557615	.	GRCh37	5	166330820	166330821	+	3'Flank	INS	-	-	CAAA	rs10680665		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000523742		4	.	4	0	.	0	CTB-7E3.1,downstream_gene_variant,,ENST00000523742,;	CAAA	ENSG00000254130	ENST00000523742	Transcript	downstream_gene_variant						rs10680665	1	1406	-1	CTB-7E3.1	Clone_based_vega_gene		lincRNA	YES													0.8684	0.9366		0.9514	0.8976	0.8415										MODIFIER	1	insertion														.	TCC	.	.																					166330820
WWC1	23286	.	GRCh37	5	167889247	167889248	+	Intron	INS	-	-	AGC	rs60823427		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2916+1502_2916+1503insCAG			ENST00000521089		3	.	3	0	.	0	WWC1,intron_variant,,ENST00000265293,NM_001161662.1,NM_001161661.1,NM_015238.2;WWC1,intron_variant,,ENST00000393895,;WWC1,intron_variant,,ENST00000521089,;WWC1,intron_variant,,ENST00000524038,;WWC1,intron_variant,,ENST00000524228,;WWC1,intron_variant,,ENST00000522140,;WWC1,upstream_gene_variant,,ENST00000521391,;,regulatory_region_variant,,ENSR00001702567,;	AGC	ENSG00000113645	ENST00000521089	Transcript	intron_variant						rs60823427	1		1	WWC1	HGNC	29435	protein_coding	YES	CCDS54945.1	ENSP00000427772	Q8IX03		UPI00017A7149					20/22			0.9523	0.804		0.5407	0.8022	0.7219										MODIFIER	1	insertion														.	AGA	.	.																					167889247
Unknown	0	.	GRCh37	5	168966296	168966297	+	IGR	INS	-	-	AG	rs1160923		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AG				intergenic_variant						rs1160923	1																			0.5677	0.3548	0.5476		0.754	0.6322	0.6115										MODIFIER	1	insertion														.	AAG	.	.																					168966296
DOCK2	1794	.	GRCh37	5	169126093	169126094	+	Intron	INS	-	-	CAAGTCTTTACC	rs3841609		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1056-292_1056-291insAAGTCTTTACCC			ENST00000256935		6	.	3	6	.	0	DOCK2,intron_variant,,ENST00000256935,NM_004946.2;DOCK2,upstream_gene_variant,,ENST00000520908,;DOCK2,upstream_gene_variant,,ENST00000540750,;DOCK2,intron_variant,,ENST00000519734,;DOCK2,intron_variant,,ENST00000523684,;DOCK2,intron_variant,,ENST00000519223,;DOCK2,intron_variant,,ENST00000524185,;	CAAGTCTTTACC	ENSG00000134516	ENST00000256935	Transcript	intron_variant						rs3841609	1		1	DOCK2	HGNC	2988	protein_coding	YES	CCDS4371.1	ENSP00000256935	Q92608	Q5XG91,B3KXW9	UPI00001A38CC	NM_004946.2				11/51			0.9629	0.6513		0.3859	0.4712	0.6912										MODIFIER	1	insertion													1	.	CTC	.	.																					169126093
STC2	8614	.	GRCh37	5	172745270	172745271	+	Intron	DEL	AG	AG	-	rs4041247		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																c.507-19_507-18del			ENST00000265087		23	.	3	10	.	0	STC2,intron_variant,,ENST00000265087,NM_003714.2;STC2,downstream_gene_variant,,ENST00000520648,;STC2,intron_variant,,ENST00000520593,;	-	ENSG00000113739	ENST00000265087	Transcript	intron_variant						rs4041247	1		-1	STC2	HGNC	11374	protein_coding	YES	CCDS4388.1	ENSP00000265087	O76061	Q6FHC9,E5RG57,B3KNF2	UPI00001360B8	NM_003714.2				3/3																		MODIFIER	1	deletion														.	AAAGA	.	.												0.1509	0.1332	0.1785	0.1741	0.2773	0.1564	0.1333	0.1334	0.169	172745269
Unknown	0	.	GRCh37	5	174659247	174659248	+	IGR	INS	-	-	AGAAGG	rs72395999		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		AGAAGG				intergenic_variant						rs72395999	1																																			MODIFIER	1	insertion														.	GAA	.	.																					174659247
SIMC1	375484	.	GRCh37	5	175763071	175763072	+	Intron	INS	-	-	AGGG	rs55945576		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.870-649_870-646dup			ENST00000341199		3	.	3	0	.	0	SIMC1,intron_variant,,ENST00000332772,;SIMC1,intron_variant,,ENST00000341199,NM_198567.4;SIMC1,intron_variant,,ENST00000430704,;SIMC1,intron_variant,,ENST00000443967,;	AGGG	ENSG00000170085	ENST00000341199	Transcript	intron_variant						rs55945576	1		1	SIMC1	HGNC	24779	protein_coding	YES	CCDS4398.2	ENSP00000342075	Q8NDZ2		UPI00000742BB	NM_198567.4				6/8			0.6725	0.6354		0.6349	0.7147	0.592										MODIFIER	1	insertion														.	GAA	.	.																					175763071
RP11-375B1.1	0	.	GRCh37	5	176142859	176142860	+	Intron	DEL	CT	CT	-	rs35095448		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CT	CT																n.220-8145_220-8144del			ENST00000507236		3	.	3	0	.	0	RP11-375B1.1,intron_variant,,ENST00000507236,;	-	ENSG00000248484	ENST00000507236	Transcript	intron_variant,non_coding_transcript_variant						rs35095448	1		-1	RP11-375B1.1	Clone_based_vega_gene		lincRNA	YES										1/1			0.1551	0.2349		0.127	0.2485	0.2035										MODIFIER	1	deletion														.	AACTC	.	.																					176142858
Unknown	0	.	GRCh37	5	178252377	178252378	+	IGR	DEL	AT	AT	-	rs142573217		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																					3	.	3	0	.	0		-				intergenic_variant						rs142573217	1																			0.5132	0.4697	0.4308		0.5823	0.5567	0.5143										MODIFIER	1	deletion														.	AGATT	.	.																					178252376
CTC-241N9.1	0	.	GRCh37	5	179287622	179287623	+	Frame_Shift_Ins	INS	-	-	TA	rs1611076		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.314_315dup	p.Ala106Ter	p.A106*	ENST00000499601	2/2	3	.	3	0	.	0	CTC-241N9.1,frameshift_variant,p.Ala106Ter,ENST00000499601,;C5orf45,upstream_gene_variant,,ENST00000292586,NM_016175.3;TBC1D9B,downstream_gene_variant,,ENST00000355235,NM_015043.3;TBC1D9B,downstream_gene_variant,,ENST00000356834,NM_198868.2;C5orf45,upstream_gene_variant,,ENST00000376931,NM_001017987.2;C5orf45,upstream_gene_variant,,ENST00000403396,;TBC1D9B,downstream_gene_variant,,ENST00000444477,;C5orf45,upstream_gene_variant,,ENST00000518219,;C5orf45,upstream_gene_variant,,ENST00000518235,;TBC1D9B,downstream_gene_variant,,ENST00000519746,;C5orf45,upstream_gene_variant,,ENST00000520698,;C5orf45,upstream_gene_variant,,ENST00000521333,;TBC1D9B,downstream_gene_variant,,ENST00000522472,;C5orf45,upstream_gene_variant,,ENST00000523084,;TBC1D9B,downstream_gene_variant,,ENST00000524222,;C5orf45,upstream_gene_variant,,ENST00000517338,;TBC1D9B,downstream_gene_variant,,ENST00000518085,;C5orf45,non_coding_transcript_exon_variant,,ENST00000519398,;C5orf45,upstream_gene_variant,,ENST00000519208,;C5orf45,upstream_gene_variant,,ENST00000519213,;C5orf45,upstream_gene_variant,,ENST00000519318,;C5orf45,upstream_gene_variant,,ENST00000520150,;TBC1D9B,downstream_gene_variant,,ENST00000520794,;C5orf45,upstream_gene_variant,,ENST00000520995,;C5orf45,upstream_gene_variant,,ENST00000521299,;TBC1D9B,downstream_gene_variant,,ENST00000521469,;C5orf45,upstream_gene_variant,,ENST00000522157,;C5orf45,upstream_gene_variant,,ENST00000522663,;C5orf45,upstream_gene_variant,,ENST00000523737,;C5orf45,upstream_gene_variant,,ENST00000523835,;C5orf45,upstream_gene_variant,,ENST00000524068,;,regulatory_region_variant,,ENSR00001703964,;	TA	ENSG00000245317	ENST00000499601	Transcript	frameshift_variant	793-794/1454	313-314/471	105/156	V/VX	gta/gTAta	rs1611076	1		1	CTC-241N9.1	Clone_based_vega_gene		protein_coding	YES		ENSP00000426367		D6RGH1	UPI0000197922				2/2				0.2141	0.6196		0.746	0.3598	0.6033										HIGH	1	insertion		2												.	TGT	.	.												0.4982	0.2479	0.7103	0.4473	0.7396	0.4291	0.3667	0.4761	0.5749	179287622
RASGEF1C	255426	.	GRCh37	5	179612290	179612290	+	Intron	DEL	A	A	-	rs59604565		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.-7+23738del			ENST00000361132		6	.	6	0	.	0	RASGEF1C,intron_variant,,ENST00000361132,NM_175062.3;	-	ENSG00000146090	ENST00000361132	Transcript	intron_variant						rs59604565	1		-1	RASGEF1C	HGNC	27400	protein_coding		CCDS4452.1	ENSP00000354963	Q8N431		UPI0000037308	NM_175062.3				1/13			0.997	0.9986		0.999	0.997	0.999										MODIFIER	1	deletion														.	CTAA	.	.																					179612289
MAPK9	5601	.	GRCh37	5	179680897	179680898	+	Intron	DEL	AC	AC	-	rs34715282		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																c.451-4760_451-4759del			ENST00000452135		4	.	4	0	.	0	MAPK9,intron_variant,,ENST00000343111,;MAPK9,intron_variant,,ENST00000347470,;MAPK9,intron_variant,,ENST00000393360,NM_002752.4,NM_139068.2;MAPK9,intron_variant,,ENST00000397072,;MAPK9,intron_variant,,ENST00000425491,NM_001135044.1;MAPK9,intron_variant,,ENST00000452135,;MAPK9,intron_variant,,ENST00000455781,NM_139070.2,NM_139069.2;MAPK9,intron_variant,,ENST00000539014,;MAPK9,intron_variant,,ENST00000523135,;MAPK9,intron_variant,,ENST00000524170,;MAPK9,intron_variant,,ENST00000393362,;RP11-252I14.2,upstream_gene_variant,,ENST00000523026,;	-	ENSG00000050748	ENST00000452135	Transcript	intron_variant						rs34715282	1		-1	MAPK9	HGNC	6886	protein_coding	YES	CCDS4453.1	ENSP00000394560	P45984	E5RJ57	UPI000006E3AD					5/11			0.2995	0.4841		0.7421	0.4364	0.3466										MODIFIER	1	deletion														.	AGACA	.	.																					179680896
FARS2	10667	.	GRCh37	6	5423325	5423325	+	Intron	DEL	C	C	-	rs34499406		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.773-7949del			ENST00000324331		7	.	4	2	.	0	FARS2,intron_variant,,ENST00000274680,NM_006567.3;FARS2,intron_variant,,ENST00000324331,;FARS2,intron_variant,,ENST00000445533,;	-	ENSG00000145982	ENST00000324331	Transcript	intron_variant						rs34499406	1		1	FARS2	HGNC	21062	protein_coding	YES	CCDS4494.1	ENSP00000316335	O95363	R4GMX6	UPI000006CF04					3/6		0.2232	0.0106	0.2334		0.4792	0.161	0.3037										MODIFIER	1	deletion													1	.	AGCT	.	.																					5423324
Unknown	0	.	GRCh37	6	6806698	6806698	+	IGR	DEL	A	A	-	rs11301583		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs11301583	1																				0.4054	0.4467		0.6677	0.4523	0.4816										MODIFIER	1	deletion														.	CGAA	.	.																					6806697
ENSR00001705192	0	.	GRCh37	6	7032591	7032591	+	IGR	DEL	A	A	-	rs35944141		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENSR00001705192		8	.	4	3	.	0	,regulatory_region_variant,,ENSR00001705192,;	-		ENSR00001705192	RegulatoryFeature	regulatory_region_variant						rs35944141	1																			0.2492	0.1619	0.451		0.004	0.5278	0.1902										MODIFIER	1	deletion														.	ACAG	.	.																					7032590
RREB1	6239	.	GRCh37	6	7157867	7157868	+	Intron	INS	-	-	G	rs946342394		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-284-19019dup			ENST00000379938		3	.	3	0	.	0	RREB1,intron_variant,,ENST00000334984,;RREB1,intron_variant,,ENST00000349384,NM_001003698.3;RREB1,intron_variant,,ENST00000379933,NM_001168344.1;RREB1,intron_variant,,ENST00000379938,NM_001003700.1,NM_001003699.3;RREB1,intron_variant,,ENST00000467782,;RREB1,intron_variant,,ENST00000471433,;RREB1,intron_variant,,ENST00000483150,;RREB1,intron_variant,,ENST00000491191,;RREB1,intron_variant,,ENST00000475946,;,regulatory_region_variant,,ENSR00001353550,;	G	ENSG00000124782	ENST00000379938	Transcript	intron_variant						rs946342394	1		1	RREB1	HGNC	10449	protein_coding	YES	CCDS34335.1	ENSP00000369270	Q92766	C9JU34,C9JPJ6,C9JE09	UPI000020E496	NM_001003700.1,NM_001003699.3				1/12																		MODIFIER	1	insertion													1	.	GTG	.	.																					7157867
BLOC1S5-TXNDC5	0	.	GRCh37	6	8002684	8002685	+	Intron	INS	-	-	TAAC	rs148932440		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.372+23915_372+23916insGTTA			ENST00000439343		4	.	4	0	.	0	TXNDC5,intron_variant,,ENST00000539054,;BLOC1S5-TXNDC5,intron_variant,,ENST00000439343,;	TAAC	ENSG00000259040	ENST00000439343	Transcript	intron_variant,NMD_transcript_variant						rs148932440	1		-1	BLOC1S5-TXNDC5	HGNC	42001	nonsense_mediated_decay	YES		ENSP00000454697		H3BN57	UPI0001B793F7					4/12			0.289	0.183		0.1419	0.161	0.0695										MODIFIER	1	insertion														.	TAT	.	.																					8002684
Unknown	0	.	GRCh37	6	8675612	8675615	+	IGR	DEL	TAAT	TAAT	-	rs144185570		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAAT	TAAT																					7	.	7	0	.	0		-				intergenic_variant						rs144185570	1																				0.0144	0.2536		0.2599	0.2197	0.1738										MODIFIER	1	deletion														.	ACTAATT	.	.																					8675611
Unknown	0	.	GRCh37	6	9069227	9069240	+	IGR	DEL	GTGTGTGTGTGTGT	GTGTGTGTGTGTGT	-	rs35271148		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GTGTGTGTGTGTGT	GTGTGTGTGTGTGT																					3	.	3	0	.	0		-				intergenic_variant						rs35271148	1																																			MODIFIER	1	deletion														.	GAGTGTGTGTGTGTGTG	.	.																					9069226
OFCC1	266553	.	GRCh37	6	9661051	9661052	+	Intron	DEL	AA	AA	-	rs200722880		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																c.*1555+12216_*1555+12217del			ENST00000492094		3	.	3	0	.	0	OFCC1,intron_variant,,ENST00000492094,;	-	ENSG00000181355	ENST00000492094	Transcript	intron_variant,NMD_transcript_variant						rs200722880	1		-1	OFCC1	HGNC	21017	nonsense_mediated_decay			ENSP00000473634			UPI0002B832A9					16/18																		MODIFIER	1	deletion														.	GCAAA	.	.																					9661050
RP11-716O23.1	0	.	GRCh37	6	11427631	11427631	+	Intron	DEL	G	G	-	rs59060518		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																n.230+9819del			ENST00000419796		5	.	5	0	.	0	RP11-716O23.1,intron_variant,,ENST00000419796,;,regulatory_region_variant,,ENSR00000406403,;	-	ENSG00000233656	ENST00000419796	Transcript	intron_variant,non_coding_transcript_variant						rs59060518	1		1	RP11-716O23.1	Clone_based_vega_gene		lincRNA	YES										1/2		1	1	1		1	1	1										MODIFIER	1	deletion														.	TCGA	.	.																					11427630
Unknown	0	.	GRCh37	6	16088559	16088559	+	IGR	DEL	A	A	-	rs11338836		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					5	.	5	0	.	0		-				intergenic_variant						rs11338836	1																				0.8669	0.8386		0.875	0.8211	0.8793										MODIFIER	1	deletion														.	AGAA	.	.																					16088558
Unknown	0	.	GRCh37	6	18028222	18028222	+	IGR	DEL	T	T	-	rs530142272		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs530142272	1																																			MODIFIER	1	deletion														.	CCTT	.	.																					18028221
RNF144B	255488	.	GRCh37	6	18445315	18445316	+	Intron	INS	-	-	T	rs34323770		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.331+5347dup			ENST00000259939		4	.	4	3	.	0	RNF144B,intron_variant,,ENST00000259939,NM_182757.3;RNF144B,intron_variant,,ENST00000429054,;,regulatory_region_variant,,ENSR00001706677,;	T	ENSG00000137393	ENST00000259939	Transcript	intron_variant						rs34323770	1		1	RNF144B	HGNC	21578	protein_coding	YES	CCDS34345.1	ENSP00000259939	Q7Z419		UPI00001B2DA3	NM_182757.3				4/7			0.0575	0.2205		0.0119	0.1431	0.0706										MODIFIER	1	insertion														.	GAT	.	.																					18445315
CASC15	401237	.	GRCh37	6	22108290	22108295	+	Intron	DEL	ACACAC	ACACAC	-	rs61414874		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACAC	ACACAC																n.888-2650_888-2645del			ENST00000444265		3	.	3	0	.	0	CASC15,intron_variant,,ENST00000444265,;CASC15,intron_variant,,ENST00000606851,;CASC15,intron_variant,,ENST00000607048,;	-	ENSG00000272168	ENST00000444265	Transcript	intron_variant,non_coding_transcript_variant						rs61414874	1		1	CASC15	HGNC	28245	lincRNA											6/10																		MODIFIER		deletion														.	ATACACACA	.	.																					22108289
GPLD1	2822	.	GRCh37	6	24480026	24480027	+	Intron	DEL	AT	AT	-	rs3032260		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																c.232+82_232+83del			ENST00000230036		13	.	4	11	.	0	GPLD1,intron_variant,,ENST00000230036,NM_001503.3;GPLD1,intron_variant,,ENST00000474784,;GPLD1,intron_variant,,ENST00000475417,;GPLD1,intron_variant,,ENST00000378243,;GPLD1,intron_variant,,ENST00000486892,;	-	ENSG00000112293	ENST00000230036	Transcript	intron_variant						rs3032260	1		-1	GPLD1	HGNC	4459	protein_coding	YES	CCDS4553.1	ENSP00000230036	P80108		UPI000013C91C	NM_001503.3				3/24			0.6263	0.3501		0.2649	0.508	0.4622										MODIFIER	1	deletion														.	ACATA	.	.																					24480025
GUSBP2	387036	.	GRCh37	6	26910763	26910773	+	Intron	DEL	AAGGAAAGCAG	AAGGAAAGCAG	-	rs77454751		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAGGAAAGCAG	AAGGAAAGCAG																n.240+8092_240+8102del			ENST00000479900		4	.	4	0	.	0	GUSBP2,intron_variant,,ENST00000479900,;GUSBP2,intron_variant,,ENST00000383335,;	-	ENSG00000241549	ENST00000479900	Transcript	intron_variant,non_coding_transcript_variant						rs77454751	1		-1	GUSBP2	HGNC	18792	processed_transcript											2/8																		MODIFIER	1	deletion														.	AAAAGGAAAGCAGA	.	.																					26910762
HLA-H	0	.	GRCh37	6	29860378	29860380	+	3'Flank	DEL	ATC	ATC	-	rs72217183		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATC	ATC																			ENST00000383326		3	.	3	0	.	0	HLA-H,downstream_gene_variant,,ENST00000383326,;HLA-H,downstream_gene_variant,,ENST00000383620,;HCG4P7,upstream_gene_variant,,ENST00000420084,;HLA-T,upstream_gene_variant,,ENST00000429813,;	-	ENSG00000206341	ENST00000383326	Transcript	downstream_gene_variant						rs72217183	1	3297	1	HLA-H	HGNC	4965	unprocessed_pseudogene	YES													0.7292	0.7666		0.5903	0.7336	0.6738										MODIFIER		deletion														.	GAATCA	.	.																					29860377
HLA-A	3105	.	GRCh37	6	29916036	29916036	+	3'Flank	DEL	C	C	-	rs67873629		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENST00000396634		5	.	1	6	.	6	HLA-A,downstream_gene_variant,,ENST00000376802,;HLA-A,downstream_gene_variant,,ENST00000376806,;HLA-A,downstream_gene_variant,,ENST00000376809,NM_002116.7,NM_001242758.1;HLA-A,downstream_gene_variant,,ENST00000396634,;HLA-A,downstream_gene_variant,,ENST00000461903,;HLA-A,downstream_gene_variant,,ENST00000479320,;HLA-A,downstream_gene_variant,,ENST00000495183,;HLA-A,downstream_gene_variant,,ENST00000496081,;	-	ENSG00000206503	ENST00000396634	Transcript	downstream_gene_variant						rs67873629	1	2375	1	HLA-A	HGNC	4931	protein_coding	YES	CCDS34373.1	ENSP00000379873	P04439,P16188,P13746	S5CRT1,S4TZI2,S4TZE1,R9WYX8,R4I501,R4I3H2,M9PNR0,M9PAA7,M9PAA4,M9P8Z4,M4N6L9,M1SQT4,M1KE04,M1FYE6,M1FYE3,M1FWW6,M1F5P2,Q9UEX6,Q9TQ84,Q9MYA8,Q8HWS5,Q861Q7,Q5XLD1,Q2L4E7,Q29840,Q1M2R8,Q0MSI1,O78086,O78085,O78081,O19689,L7PHV2,L7PHU7,L7PH13,L0BVP5,K9LDJ0,K9LCM8,K9L7Y8,K7WPD7,K7P600,K7P5W6,K7P5U2,K7P5E0,K7P5B6,K7P562,K7P558,J9UP83,J9TNR8,J9PWV5,J9PWL3,J7GM07,J7FNZ2,J7F8L2,I6SJ64,I6QU16,I6NS25,I6NS19,I3UI58,I3UI47,I3QHQ4,I2B2Z9,I1W1L8,H9BQ78,H6UV72,H6UV69,H6UV68,H2BE80,H2BDP5,G9I2J6,G9HW24,G3DR81,G1EPB1,G1EP98,G1EP96,G1EP95,G1EP88,G1EP78,G1EP71,G1EP55,G1EP50,G1EP19,G1EP18,G1EP05,G1ENY5,G1DUW4,G0ZMG9,G0ZMG4,G0ZMG3,G0ZMF4,G0ZDS9,G0WVA6,G0WVA0,F8RHD1,F8RHC2,F8RHB9,F8R8I1,F8R119,F8R110,F6KRP1,F6KRM4,F6IQV7,F4YU26,F4YU20,F2X604,F2X5Y0,F2X5X9,F2VNH3,F2VNH0,F2VNG0,F2VNF7,F2VNF2,F2VNE0,F2VND0,F2VNC4,E9LY14,E9LY02,E9LY00,E8ZF52,E7BY93,E7BY85,E7BBA1,E5DCM4,E5DCM2,E5DCM0,E3SG86,E2DH82,E2D5M3,E2D5L9,E2D5K9,E0YTI8,E0YTI1,E0X9K2,E0WBX4,E0WBX1,D7NSP0,D7NPA3,D7NP98,D7NP92,D7NNU1,D7NNT9,D7NNT6,D7NNT3,D7NNS2,D7NNR5,D7NNM6,D6MLN9,D6MLN3,D6MLM4,D6MLL1,D6MLK2,D6MLJ4,D6MLJ1,D6ML56,D6ML55,D6ML54,D6ML44,D6ML42,D6ML40,D6ML35,D6ML33,D6ML18,D6ML16,D6ML10,D6ML09,D6ML06,D6ML01,D6MKY9,D6MJF7,D5M8G4,D5M8G1,D5M8E4,D5G2J2,D5FIG9,D5FHQ9,D5FHN7,D5FHM5,D5FHM3,D5FHM1,D5FHK5,D5FHG0,D3U484,D3U454,D3U442,D1MYY8,D0RAY3,D0EZK0,D0EZJ9,D0AB29,C9WEL3,C9WEL2,C9WEL1,C9E1E8,C9E1E7,C8XTP8,C8XTP7,C8XTN9,C8XTN7,C8CH66,C6K4J6,C6K4I6,C6K4I1,C6K4H8,C6K4H3,C6K4H0,C6K4G0,C6K4E3,C5J029,C5J027,C5IZR4,C5IZQ3,C4PFZ1,B8YCR7,B8XRE8,B6VA02,B6ECH2,B4DVC4,B1PKY1,A7MAP4,A5PHP7,A0ZXY8	UPI000008AB1D								0.2973	0.366		0.4484	0.4225	0.364										MODIFIER	1	deletion													1	.	TACC	.	.																					29916035
HLA-A	3105	.	GRCh37	6	29916040	29916041	+	3'Flank	INS	-	-	A	rs66531952		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000396634		5	.	1	6	.	6	HLA-A,downstream_gene_variant,,ENST00000376802,;HLA-A,downstream_gene_variant,,ENST00000376806,;HLA-A,downstream_gene_variant,,ENST00000376809,NM_002116.7,NM_001242758.1;HLA-A,downstream_gene_variant,,ENST00000396634,;HLA-A,downstream_gene_variant,,ENST00000461903,;HLA-A,downstream_gene_variant,,ENST00000479320,;HLA-A,downstream_gene_variant,,ENST00000495183,;HLA-A,downstream_gene_variant,,ENST00000496081,;	A	ENSG00000206503	ENST00000396634	Transcript	downstream_gene_variant						rs66531952	1	2379	1	HLA-A	HGNC	4931	protein_coding	YES	CCDS34373.1	ENSP00000379873	P04439,P16188,P13746	S5CRT1,S4TZI2,S4TZE1,R9WYX8,R4I501,R4I3H2,M9PNR0,M9PAA7,M9PAA4,M9P8Z4,M4N6L9,M1SQT4,M1KE04,M1FYE6,M1FYE3,M1FWW6,M1F5P2,Q9UEX6,Q9TQ84,Q9MYA8,Q8HWS5,Q861Q7,Q5XLD1,Q2L4E7,Q29840,Q1M2R8,Q0MSI1,O78086,O78085,O78081,O19689,L7PHV2,L7PHU7,L7PH13,L0BVP5,K9LDJ0,K9LCM8,K9L7Y8,K7WPD7,K7P600,K7P5W6,K7P5U2,K7P5E0,K7P5B6,K7P562,K7P558,J9UP83,J9TNR8,J9PWV5,J9PWL3,J7GM07,J7FNZ2,J7F8L2,I6SJ64,I6QU16,I6NS25,I6NS19,I3UI58,I3UI47,I3QHQ4,I2B2Z9,I1W1L8,H9BQ78,H6UV72,H6UV69,H6UV68,H2BE80,H2BDP5,G9I2J6,G9HW24,G3DR81,G1EPB1,G1EP98,G1EP96,G1EP95,G1EP88,G1EP78,G1EP71,G1EP55,G1EP50,G1EP19,G1EP18,G1EP05,G1ENY5,G1DUW4,G0ZMG9,G0ZMG4,G0ZMG3,G0ZMF4,G0ZDS9,G0WVA6,G0WVA0,F8RHD1,F8RHC2,F8RHB9,F8R8I1,F8R119,F8R110,F6KRP1,F6KRM4,F6IQV7,F4YU26,F4YU20,F2X604,F2X5Y0,F2X5X9,F2VNH3,F2VNH0,F2VNG0,F2VNF7,F2VNF2,F2VNE0,F2VND0,F2VNC4,E9LY14,E9LY02,E9LY00,E8ZF52,E7BY93,E7BY85,E7BBA1,E5DCM4,E5DCM2,E5DCM0,E3SG86,E2DH82,E2D5M3,E2D5L9,E2D5K9,E0YTI8,E0YTI1,E0X9K2,E0WBX4,E0WBX1,D7NSP0,D7NPA3,D7NP98,D7NP92,D7NNU1,D7NNT9,D7NNT6,D7NNT3,D7NNS2,D7NNR5,D7NNM6,D6MLN9,D6MLN3,D6MLM4,D6MLL1,D6MLK2,D6MLJ4,D6MLJ1,D6ML56,D6ML55,D6ML54,D6ML44,D6ML42,D6ML40,D6ML35,D6ML33,D6ML18,D6ML16,D6ML10,D6ML09,D6ML06,D6ML01,D6MKY9,D6MJF7,D5M8G4,D5M8G1,D5M8E4,D5G2J2,D5FIG9,D5FHQ9,D5FHN7,D5FHM5,D5FHM3,D5FHM1,D5FHK5,D5FHG0,D3U484,D3U454,D3U442,D1MYY8,D0RAY3,D0EZK0,D0EZJ9,D0AB29,C9WEL3,C9WEL2,C9WEL1,C9E1E8,C9E1E7,C8XTP8,C8XTP7,C8XTN9,C8XTN7,C8CH66,C6K4J6,C6K4I6,C6K4I1,C6K4H8,C6K4H3,C6K4H0,C6K4G0,C6K4E3,C5J029,C5J027,C5IZR4,C5IZQ3,C4PFZ1,B8YCR7,B8XRE8,B6VA02,B6ECH2,B4DVC4,B1PKY1,A7MAP4,A5PHP7,A0ZXY8	UPI000008AB1D								0.4123	0.5101		0.5823	0.5636	0.5532										MODIFIER	1	insertion													1	.	TGT	.	.																					29916040
HCG9	10255	.	GRCh37	6	29944101	29944102	+	Intron	INS	-	-	TAA	rs3842131		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.406+816_406+818dup			ENST00000376800		4	.	4	0	.	0	HCG9,intron_variant,,ENST00000376800,;HCG9,upstream_gene_variant,,ENST00000463275,;MICD,upstream_gene_variant,,ENST00000413248,;,regulatory_region_variant,,ENSR00000195350,;,regulatory_region_variant,,ENSR00001358316,;	TAA	ENSG00000204625	ENST00000376800	Transcript	intron_variant,non_coding_transcript_variant						rs3842131	1		1	HCG9	HGNC	21243	lincRNA	YES										1/2																		MODIFIER	1	insertion														.	ACT	.	.																					29944101
TRIM39	56658	.	GRCh37	6	30302084	30302085	+	Intron	INS	-	-	TTCT	rs35724275		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.550-1435_550-1432dup			ENST00000376656		6	.	6	0	.	0	TRIM39,intron_variant,,ENST00000376656,NM_021253.3;TRIM39,intron_variant,,ENST00000376659,NM_172016.2;TRIM39,intron_variant,,ENST00000396547,;TRIM39,intron_variant,,ENST00000396548,;TRIM39,intron_variant,,ENST00000396551,;TRIM39,intron_variant,,ENST00000420746,;TRIM39,intron_variant,,ENST00000428728,;TRIM39-RPP21,intron_variant,,ENST00000513556,NM_001199119.1;TRIM39,intron_variant,,ENST00000540416,;TRIM39,downstream_gene_variant,,ENST00000428404,;TRIM39,downstream_gene_variant,,ENST00000428555,;TRIM39,downstream_gene_variant,,ENST00000440271,;TRIM39,downstream_gene_variant,,ENST00000458516,;,regulatory_region_variant,,ENSR00001707840,;	TTCT	ENSG00000204599	ENST00000376656	Transcript	intron_variant						rs35724275	1		1	TRIM39	HGNC	10065	protein_coding	YES	CCDS34377.1	ENSP00000365844	Q9HCM9	A2AAZ5,A2AAZ4,A2AAZ3,A2AAZ2	UPI000013D097	NM_021253.3				4/8			0.857	0.7104		0.7212	0.6302	0.8497										MODIFIER	1	insertion														.	AAT	.	.																					30302084
CDSN	1041	.	GRCh37	6	31083798	31083800	+	3'UTR	DEL	CTT	-	-	rs56899166		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTT	CTT																c.*2_*4del			ENST00000376288	2/2	5	.	0	4	.	3	CDSN,3_prime_UTR_variant,,ENST00000376288,NM_001264.4;PSORS1C1,intron_variant,,ENST00000259881,NM_014068.2;C6orf15,upstream_gene_variant,,ENST00000259870,NM_014070.2;PSORS1C1,non_coding_transcript_exon_variant,,ENST00000467107,;PSORS1C1,intron_variant,,ENST00000479581,;PSORS1C1,intron_variant,,ENST00000493289,;PSORS1C1,intron_variant,,ENST00000548049,;PSORS1C1,intron_variant,,ENST00000550838,;PSORS1C1,intron_variant,,ENST00000552747,;,regulatory_region_variant,,ENSR00001707952,;	-	ENSG00000204539	ENST00000376288	Transcript	3_prime_UTR_variant	1619-1621/2552					rs56899166	1		-1	CDSN	HGNC	1802	protein_coding	YES	CCDS34389.1	ENSP00000365465		Q7Z560,G8JLG2	UPI00001AFE92	NM_001264.4			2/2				0.7065	0.6138		0.7113	0.5487	0.6247	0.6565	0.4893			24200957					MODIFIER	1	deletion													1	.	GACTTC	.	.												0.5736	0.6798	0.5877	0.6637	0.7233	0.5098	0.5144	0.5888	0.6427	31083797
RNU6-283P	0	.	GRCh37	6	31336926	31336927	+	5'Flank	INS	-	-	TT	rs9281394		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000364788		4	.	4	0	.	0	RNU6-283P,upstream_gene_variant,,ENST00000364788,;DHFRP2,upstream_gene_variant,,ENST00000414224,;	TT	ENSG00000201658	ENST00000364788	Transcript	upstream_gene_variant						rs9281394	1	984	1	RNU6-283P	HGNC	47246	snRNA	YES													0.854	0.9193		0.9306	0.839	0.9294										MODIFIER		insertion														.	ACG	.	.																					31336926
C6orf10	10665	.	GRCh37	6	32335558	32335559	+	Intron	INS	-	-	AGAG	rs3038543		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.166+140_166+143dup			ENST00000447241		3	.	3	0	.	0	C6orf10,intron_variant,,ENST00000375007,;C6orf10,intron_variant,,ENST00000375015,;C6orf10,intron_variant,,ENST00000442822,;C6orf10,intron_variant,,ENST00000447241,NM_006781.3;C6orf10,intron_variant,,ENST00000527965,;C6orf10,intron_variant,,ENST00000532023,;C6orf10,intron_variant,,ENST00000533191,NM_001286475.1,NM_001286474.1;C6orf10,intron_variant,,ENST00000534588,;	AGAG	ENSG00000204296	ENST00000447241	Transcript	intron_variant						rs3038543	1		-1	C6orf10	HGNC	13922	protein_coding	YES	CCDS34422.1	ENSP00000415517	Q5SRN2		UPI0000470279	NM_006781.3				4/22			0.6974	0.7983		0.871	0.7823	0.8998										MODIFIER	1	insertion														.	AAA	.	.																					32335558
HLA-DQB2	3120	.	GRCh37	6	32721410	32721411	+	3'Flank	DEL	TG	TG	-	rs9280175		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																			ENST00000411527		4	.	4	0	.	0	HLA-DQB2,downstream_gene_variant,,ENST00000411527,NM_001198858.1;HLA-DQB2,downstream_gene_variant,,ENST00000427449,;HLA-DQB2,downstream_gene_variant,,ENST00000435145,;HLA-DQB2,downstream_gene_variant,,ENST00000437316,;MIR3135B,upstream_gene_variant,,ENST00000581098,;	-	ENSG00000232629	ENST00000411527	Transcript	downstream_gene_variant						rs9280175	1	2464	-1	HLA-DQB2	HGNC	4945	protein_coding	YES	CCDS56419.1	ENSP00000390431	P05538		UPI0000457414	NM_001198858.1							0.6369	0.7147		0.8075	0.6133	0.6718										MODIFIER	1	deletion														.	ATTGT	.	.																					32721409
GRM4	2914	.	GRCh37	6	34108114	34108115	+	Intron	INS	-	-	G	rs5875496		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-364+5662dup			ENST00000538487		5	.	5	0	.	0	GRM4,intron_variant,,ENST00000374177,NM_001256809.1;GRM4,intron_variant,,ENST00000538487,NM_000841.2,NM_001256811.1;GRM4,intron_variant,,ENST00000609278,NM_001282847.1;	G	ENSG00000124493	ENST00000538487	Transcript	intron_variant						rs5875496	1		-1	GRM4	HGNC	4596	protein_coding	YES	CCDS4787.1	ENSP00000440556	Q14833	A8K0J8,A1L4F9	UPI000004A7DE	NM_000841.2,NM_001256811.1				1/10			0.5817	0.8026		0.5248	0.6342	0.5297										MODIFIER	1	insertion														.	ATG	.	.																					34108114
C6orf1	221491	.	GRCh37	6	34221259	34221273	+	5'Flank	DEL	AAAAAAAAAAAAAAG	AAAAAAAAAAAAAAG	-	rs150005915		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAAAAAAAAAAAAG	AAAAAAAAAAAAAAG																			ENST00000476320		3	.	3	0	.	0	C6orf1,upstream_gene_variant,,ENST00000335352,NM_001287397.1;C6orf1,upstream_gene_variant,,ENST00000394990,NM_001008704.1;C6orf1,upstream_gene_variant,,ENST00000413013,NM_001287398.1;C6orf1,upstream_gene_variant,,ENST00000468145,NM_001287396.1;C6orf1,upstream_gene_variant,,ENST00000476320,NM_001008703.1;C6orf1,upstream_gene_variant,,ENST00000481533,NM_178508.3;C6orf1,upstream_gene_variant,,ENST00000463083,;C6orf1,upstream_gene_variant,,ENST00000495581,;	-	ENSG00000186577	ENST00000476320	Transcript	upstream_gene_variant						rs150005915	1	4012	-1	C6orf1	HGNC	1340	protein_coding	YES	CCDS4790.1	ENSP00000417604	Q86T20	G8JLJ3	UPI00001618A4	NM_001008703.1							0.9365	0.9712		0.999	0.998	1										MODIFIER	1	deletion														.	AAAAAAAAAAAAAAAAGA	.	.																					34221258
Unknown	0	.	GRCh37	6	38635140	38635141	+	IGR	INS	-	-	C	rs113577879		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		C				intergenic_variant						rs113577879	1																				0.4183	0.3746		0.2431	0.3976	0.3067										MODIFIER	1	insertion														.	GGC	.	.																					38635140
DNAH8	1769	.	GRCh37	6	38804223	38804223	+	Intron	DEL	A	A	-	rs71543945		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.3715-1485del			ENST00000359357		3	.	3	0	.	0	DNAH8,intron_variant,,ENST00000327475,NM_001206927.1;DNAH8,intron_variant,,ENST00000359357,;DNAH8,intron_variant,,ENST00000441566,;DNAH8,intron_variant,,ENST00000449981,;	-	ENSG00000124721	ENST00000359357	Transcript	intron_variant						rs71543945	1		1	DNAH8	HGNC	2952	protein_coding	YES		ENSP00000352312	Q96JB1		UPI00003677EB					30/90																		MODIFIER	1	deletion														.	TCAA	.	.																					38804222
Unknown	0	.	GRCh37	6	39204832	39204855	+	IGR	DEL	ATATATGAGGTCACCACTCCCCTC	ATATATGAGGTCACCACTCCCCTC	-	rs59614432		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATATATGAGGTCACCACTCCCCTC	ATATATGAGGTCACCACTCCCCTC																					3	.	3	0	.	0		-				intergenic_variant						rs59614432	1																				0.0333	0.4294		0.2212	0.5427	0.5583										MODIFIER	1	deletion														.	ATATATATGAGGTCACCACTCCCCTCA	.	.																					39204831
Unknown	0	.	GRCh37	6	40644957	40644958	+	IGR	INS	-	-	T	rs113587752		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					7	.	4	3	.	0		T				intergenic_variant						rs113587752	1																				0.0885	0.1873		0.1905	0.2594	0.2025										MODIFIER	1	insertion														.	CCT	.	.																					40644957
CCND3	896	.	GRCh37	6	41969852	41969853	+	Intron	INS	-	-	A	rs55946125		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-46+46386dup			ENST00000372988		3	.	3	0	.	0	CCND3,intron_variant,,ENST00000372988,NM_001136017.2;CCND3,intron_variant,,ENST00000415497,NM_001136126.1;CCND3,intron_variant,,ENST00000502771,;CCND3,intron_variant,,ENST00000508143,;CCND3,intron_variant,,ENST00000510503,;CCND3,intron_variant,,ENST00000511642,;CCND3,intron_variant,,ENST00000514588,;CCND3,intron_variant,,ENST00000511686,;CCND3,intron_variant,,ENST00000513956,;CCND3,intron_variant,,ENST00000514382,;CCND3,intron_variant,,ENST00000505672,;CCND3,intron_variant,,ENST00000505884,;CCND3,intron_variant,,ENST00000511161,;	A	ENSG00000112576	ENST00000372988	Transcript	intron_variant						rs55946125	1		-1	CCND3	HGNC	1585	protein_coding		CCDS47426.1	ENSP00000362079	P30281	D6RIX2,D6RDL3	UPI000178DF96	NM_001136017.2				1/4			0.7148	0.8429		0.8621	0.8728	0.8497										MODIFIER	1	insertion													1	.	TTA	.	.																					41969852
RUNX2	860	.	GRCh37	6	45521848	45521851	+	3'Flank	DEL	TGTG	TGTG	-	rs70996341		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGTG	TGTG																			ENST00000371438		3	.	3	3	.	0	RUNX2,intron_variant,,ENST00000576263,;RUNX2,downstream_gene_variant,,ENST00000359524,;RUNX2,downstream_gene_variant,,ENST00000371432,NM_001278478.1;RUNX2,downstream_gene_variant,,ENST00000371438,NM_001024630.3;RUNX2,intron_variant,,ENST00000478660,;,regulatory_region_variant,,ENSR00001362539,;	-	ENSG00000124813	ENST00000371438	Transcript	downstream_gene_variant						rs70996341	1	3032	1	RUNX2	HGNC	10472	protein_coding	YES	CCDS43467.2	ENSP00000360493	Q13950	U3RG86	UPI000013532F	NM_001024630.3							0.112	0.304		0.0456	0.34	0.2178										MODIFIER	1	deletion													1	.	TATGTGT	.	.																					45521847
GPR115	221393	.	GRCh37	6	47665768	47665768	+	5'Flank	DEL	G	G	-	rs3215998		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																			ENST00000283303		8	.	8	3	.	0	GPR115,intron_variant,,ENST00000371220,;GPR115,upstream_gene_variant,,ENST00000283303,NM_153838.3;GPR115,upstream_gene_variant,,ENST00000327753,;GPR111,downstream_gene_variant,,ENST00000398742,;GPR111,downstream_gene_variant,,ENST00000467205,NM_153839.6;,regulatory_region_variant,,ENSR00001710382,;	-	ENSG00000153294	ENST00000283303	Transcript	upstream_gene_variant						rs3215998	1	521	1	GPR115	HGNC	19011	protein_coding	YES	CCDS4922.2	ENSP00000283303	Q8IZF3		UPI000046FF2B	NM_153838.3						0.3758	0.1573	0.5216		0.6915	0.3678	0.2505										MODIFIER	1	deletion														.	TAGA	.	.																					47665767
Unknown	0	.	GRCh37	6	48341273	48341274	+	IGR	INS	-	-	A	rs369904395		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		A				intergenic_variant						rs369904395	1																				0.3283	0.1671		0.1171	0.0905	0.1575										MODIFIER	1	insertion														.	TTA	.	.																					48341273
CENPQ	55166	.	GRCh37	6	49450369	49450375	+	Intron	DEL	TCGGCGA	TCGGCGA	-	rs58765118		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCGGCGA	TCGGCGA																c.477+1577_477+1583del			ENST00000335783		6	.	3	5	.	0	CENPQ,intron_variant,,ENST00000335783,NM_018132.3;	-	ENSG00000031691	ENST00000335783	Transcript	intron_variant						rs58765118	1		1	CENPQ	HGNC	21347	protein_coding	YES	CCDS4925.1	ENSP00000337289	Q7L2Z9		UPI000020DE7B	NM_018132.3				6/8			0.4251	0.6066		0.5208	0.4135	0.3221										MODIFIER	1	deletion														.	GCTCGGCGAT	.	.																					49450368
TFAP2D	83741	.	GRCh37	6	50680321	50680322	+	5'Flank	INS	-	-	A	rs398084929		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000008391		3	.	3	0	.	0	TFAP2D,upstream_gene_variant,,ENST00000008391,NM_172238.3;	A	ENSG00000008197	ENST00000008391	Transcript	upstream_gene_variant						rs398084929	1	1219	1	TFAP2D	HGNC	15581	protein_coding	YES	CCDS4933.1	ENSP00000008391	Q7Z6R9		UPI00001A3A89	NM_172238.3							0.0915	0.2089		0.4345	0.3131	0.2301										MODIFIER	1	insertion														.	CTA	.	.																					50680321
GCM1	8521	.	GRCh37	6	52998130	52998131	+	Intron	DEL	TG	TG	-	rs5876306		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																c.328+739_328+740del			ENST00000259803		4	.	4	0	.	0	GCM1,intron_variant,,ENST00000259803,NM_003643.3;	-	ENSG00000137270	ENST00000259803	Transcript	intron_variant						rs5876306	1		-1	GCM1	HGNC	4197	protein_coding	YES	CCDS4950.1	ENSP00000259803	Q9NP62		UPI0000073F99	NM_003643.3				3/5																		MODIFIER	1	deletion														.	AATGT	.	.																					52998129
DST	667	.	GRCh37	6	56473006	56473007	+	Intron	INS	-	-	T	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.3672+2218dup			ENST00000244364		57	.	32	61	.	59	DST,frameshift_variant,p.Asn2107LysfsTer6,ENST00000370754,;DST,frameshift_variant,p.Asn1929LysfsTer6,ENST00000370769,;DST,frameshift_variant,p.Asn1929LysfsTer6,ENST00000312431,;DST,frameshift_variant,p.Asn1603LysfsTer6,ENST00000446842,;DST,frameshift_variant,p.Asn1929LysfsTer6,ENST00000361203,;DST,frameshift_variant,p.Asn1603LysfsTer6,ENST00000439203,;DST,intron_variant,,ENST00000244364,NM_015548.4;DST,intron_variant,,ENST00000370788,NM_001144769.2,NM_183380.3,NM_001144770.1;DST,intron_variant,,ENST00000421834,;	T	ENSG00000151914	ENST00000244364	Transcript	intron_variant							1		-1	DST	HGNC	1090	protein_coding	YES	CCDS47443.1	ENSP00000244364	Q03001	Q86T18	UPI00001C1577	NM_015548.4				25/83																		MODIFIER	1	insertion													1	.	TAT	.	.																					56473006
PRIM2	5558	.	GRCh37	6	57262323	57262324	+	Intron	INS	-	-	G	rs142886884		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.693+15357_693+15358insG			ENST00000607273		6	.	3	3	.	0	PRIM2,intron_variant,,ENST00000607273,NM_000947.3;PRIM2,intron_variant,,ENST00000389488,;PRIM2,intron_variant,,ENST00000490313,;	G	ENSG00000146143	ENST00000607273	Transcript	intron_variant						rs142886884	1		1	PRIM2	HGNC	9370	protein_coding	YES		ENSP00000475738		U3KQB9,I0CMK6,I0CMJ8,H9XFA6	UPI00004588DE	NM_000947.3				7/13																		MODIFIER	1	insertion														.	TTT	.	.																					57262323
PRIM2	5558	.	GRCh37	6	57314153	57314154	+	Intron	INS	-	-	TTG	rs74362561		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.694-58132_694-58130dup			ENST00000607273		3	.	3	0	.	0	PRIM2,intron_variant,,ENST00000607273,NM_000947.3;PRIM2,intron_variant,,ENST00000389488,;	TTG	ENSG00000146143	ENST00000607273	Transcript	intron_variant						rs74362561	1		1	PRIM2	HGNC	9370	protein_coding	YES		ENSP00000475738		U3KQB9,I0CMK6,I0CMJ8,H9XFA6	UPI00004588DE	NM_000947.3				7/13																		MODIFIER	1	insertion														.	TAT	.	.																					57314153
PRIM2	5558	.	GRCh37	6	57388106	57388106	+	Intron	DEL	A	A	-	rs55988029		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.762-5006del			ENST00000607273		4	.	4	0	.	0	PRIM2,intron_variant,,ENST00000607273,NM_000947.3;PRIM2,intron_variant,,ENST00000389488,;PRIM2,intron_variant,,ENST00000470638,;PRIM2,upstream_gene_variant,,ENST00000550475,;,regulatory_region_variant,,ENSR00001364914,;	-	ENSG00000146143	ENST00000607273	Transcript	intron_variant						rs55988029	1		1	PRIM2	HGNC	9370	protein_coding	YES		ENSP00000475738		U3KQB9,I0CMK6,I0CMJ8,H9XFA6	UPI00004588DE	NM_000947.3				8/13																		MODIFIER	1	deletion														.	CTAC	.	.																					57388105
PRIM2	5558	.	GRCh37	6	57406654	57406655	+	Intron	INS	-	-	T	rs66899453		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1020+8338dup			ENST00000607273		6	.	6	0	.	0	PRIM2,intron_variant,,ENST00000607273,NM_000947.3;PRIM2,intron_variant,,ENST00000389488,;PRIM2,intron_variant,,ENST00000550475,;	T	ENSG00000146143	ENST00000607273	Transcript	intron_variant						rs66899453	1		1	PRIM2	HGNC	9370	protein_coding	YES		ENSP00000475738		U3KQB9,I0CMK6,I0CMJ8,H9XFA6	UPI00004588DE	NM_000947.3				10/13																		MODIFIER	1	insertion														.	AGT	.	.																					57406654
PRIM2	5558	.	GRCh37	6	57488800	57488800	+	Intron	DEL	G	G	-	rs111409818		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.*190-10167del			ENST00000607273		9	.	3	6	.	0	PRIM2,intron_variant,,ENST00000607273,NM_000947.3;PRIM2,intron_variant,,ENST00000389488,;	-	ENSG00000146143	ENST00000607273	Transcript	intron_variant						rs111409818	1		1	PRIM2	HGNC	9370	protein_coding	YES		ENSP00000475738		U3KQB9,I0CMK6,I0CMJ8,H9XFA6	UPI00004588DE	NM_000947.3				12/13																		MODIFIER	1	deletion														.	CAGT	.	.																					57488799
PRIM2	5558	.	GRCh37	6	57503445	57503445	+	Intron	DEL	C	C	-	rs11343070		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.*258+4410del			ENST00000607273		6	.	4	3	.	0	PRIM2,intron_variant,,ENST00000607273,NM_000947.3;PRIM2,intron_variant,,ENST00000389488,;	-	ENSG00000146143	ENST00000607273	Transcript	intron_variant						rs11343070	1		1	PRIM2	HGNC	9370	protein_coding	YES		ENSP00000475738		U3KQB9,I0CMK6,I0CMJ8,H9XFA6	UPI00004588DE	NM_000947.3				13/13																		MODIFIER	1	deletion														.	CACA	.	.																					57503444
Unknown	0	.	GRCh37	6	57539905	57539906	+	IGR	INS	-	-	TTTCCATA	rs371730861		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TTTCCATA				intergenic_variant						rs371730861	1																																			MODIFIER	1	insertion														.	TTT	.	.																					57539905
Unknown	0	.	GRCh37	6	63670853	63670854	+	IGR	INS	-	-	C	rs35604933		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		C				intergenic_variant						rs35604933	1																				0.5287	0.7262		0.751	0.5885	0.7086										MODIFIER	1	insertion														.	TAT	.	.																					63670853
LGSN	51557	.	GRCh37	6	63986922	63986923	+	3'Flank	INS	-	-	A	rs5876850		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000370657		3	.	3	0	.	0	LGSN,3_prime_UTR_variant,,ENST00000370658,NM_016571.2,NM_001143940.1;LGSN,downstream_gene_variant,,ENST00000370657,;LGSN,downstream_gene_variant,,ENST00000485906,;	A	ENSG00000146166	ENST00000370657	Transcript	downstream_gene_variant						rs5876850	1	2618	-1	LGSN	HGNC	21016	protein_coding	YES	CCDS4964.1	ENSP00000359691	Q5TDP6		UPI000013DA35								0.3601	0.3862		0.4484	0.492	0.3814										MODIFIER	1	insertion														.	ACA	.	.																					63986922
Unknown	0	.	GRCh37	6	67263544	67263544	+	IGR	DEL	T	T	-	rs34677477		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs34677477	1																				0.4039	0.1902		0.0952	0.2992	0.2802										MODIFIER	1	deletion														.	TGTT	.	.																					67263543
Unknown	0	.	GRCh37	6	67846718	67846719	+	IGR	DEL	AT	AT	-	rs139946808		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																					6	.	3	4	.	0		-				intergenic_variant						rs139946808	1																			0.5184	0.3366	0.5245		0.5933	0.5467	0.6534										MODIFIER	1	deletion														.	ACATG	.	.																					67846717
COL19A1	1310	.	GRCh37	6	70688016	70688020	+	Intron	DEL	GAGAA	GAGAA	-	rs70987492		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAGAA	GAGAA																c.1026+15257_1026+15261del			ENST00000322773		3	.	3	0	.	0	COL19A1,intron_variant,,ENST00000322773,NM_001858.4;COL19A1,downstream_gene_variant,,ENST00000483745,;	-	ENSG00000082293	ENST00000322773	Transcript	intron_variant						rs70987492	1		1	COL19A1	HGNC	2196	protein_coding	YES	CCDS4970.1	ENSP00000316030	Q14993		UPI000004F1E3	NM_001858.4				11/50			0.0121	0.2176		0.2748	0.325	0.271										MODIFIER	1	deletion														.	CTGAGAAG	.	.																					70688015
OGFRL1	79627	.	GRCh37	6	72022860	72022861	+	3'Flank	DEL	AA	AA	-	rs35372424		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																			ENST00000370435		6	.	6	0	.	0	OGFRL1,downstream_gene_variant,,ENST00000370435,NM_024576.3;RP3-331H24.5,intron_variant,,ENST00000602823,;RP11-154D6.1,intron_variant,,ENST00000434683,;RP11-154D6.1,intron_variant,,ENST00000450998,;RP11-154D6.1,intron_variant,,ENST00000585882,;RP11-154D6.1,intron_variant,,ENST00000585945,;RP11-154D6.1,intron_variant,,ENST00000586030,;RP11-154D6.1,intron_variant,,ENST00000586232,;RP11-154D6.1,intron_variant,,ENST00000587015,;RP11-154D6.1,intron_variant,,ENST00000587036,;RP11-154D6.1,intron_variant,,ENST00000587253,;RP11-154D6.1,intron_variant,,ENST00000587397,;RP11-154D6.1,intron_variant,,ENST00000588612,;RP11-154D6.1,intron_variant,,ENST00000589255,;RP11-154D6.1,intron_variant,,ENST00000590213,;RP11-154D6.1,intron_variant,,ENST00000590780,;RP11-154D6.1,intron_variant,,ENST00000591156,;RP11-154D6.1,upstream_gene_variant,,ENST00000412751,;RP11-154D6.1,upstream_gene_variant,,ENST00000423255,;RP11-154D6.1,upstream_gene_variant,,ENST00000432050,;RP11-154D6.1,upstream_gene_variant,,ENST00000586974,;,regulatory_region_variant,,ENSR00001711683,;	-	ENSG00000119900	ENST00000370435	Transcript	downstream_gene_variant						rs35372424	1	4207	1	OGFRL1	HGNC	21378	protein_coding	YES	CCDS34482.1	ENSP00000359464	Q5TC84		UPI000021D446	NM_024576.3							0.2141	0.402		0.3433	0.2207	0.1677										MODIFIER	1	deletion														.	ATAAA	.	.																					72022859
Unknown	0	.	GRCh37	6	79138140	79138140	+	IGR	DEL	T	T	-	rs60375620		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					5	.	5	4	.	0		-				intergenic_variant						rs60375620	1																				0.4705	0.3689		0.252	0.3807	0.2689										MODIFIER	1	deletion														.	GATT	.	.																					79138139
UBE3D	90025	.	GRCh37	6	83703070	83703071	+	Intron	INS	-	-	AT	rs10680743		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1010+25621_1010+25622insAT			ENST00000369747		3	.	3	0	.	0	UBE3D,intron_variant,,ENST00000369747,NM_198920.1;UBE3D,intron_variant,,ENST00000237186,;UBE3D,intron_variant,,ENST00000430071,;UBE3D,intron_variant,,ENST00000509102,;	AT	ENSG00000118420	ENST00000369747	Transcript	intron_variant						rs10680743	1		-1	UBE3D	HGNC	21381	protein_coding	YES	CCDS34491.1	ENSP00000358762	Q7Z6J8	D6RHY9	UPI0000160DBE	NM_198920.1				8/9			0.8563	0.8876		0.9454	0.8738	0.9182										MODIFIER	1	insertion														.	ACA	.	.																					83703070
Unknown	0	.	GRCh37	6	85316464	85316464	+	IGR	DEL	T	T	-	rs60178649		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs60178649	1																				0.8064	0.7349		0.7808	0.9026	0.9243										MODIFIER	1	deletion														.	TATT	.	.																					85316463
RPL7P27	0	.	GRCh37	6	86801532	86801533	+	5'Flank	INS	-	-	CTGAGGCATTGCCTCA	rs71006499		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000403775		3	.	3	0	.	0	RPL7P27,upstream_gene_variant,,ENST00000403775,;	CTGAGGCATTGCCTCA	ENSG00000220069	ENST00000403775	Transcript	upstream_gene_variant						rs71006499	1	4680	-1	RPL7P27	HGNC	36649	processed_pseudogene	YES													0.9917	0.9611		0.997	0.9374	0.9847										MODIFIER	1	insertion														.	CCC	.	.																					86801532
RNGTT	8732	.	GRCh37	6	89454400	89454404	+	Intron	DEL	TATGA	TATGA	-	rs66750671		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TATGA	TATGA																c.1439+25089_1439+25093del			ENST00000369485		3	.	3	0	.	0	RNGTT,intron_variant,,ENST00000265607,NM_001286428.1,NM_001286426.1;RNGTT,intron_variant,,ENST00000369475,;RNGTT,intron_variant,,ENST00000369485,NM_003800.3;RNGTT,intron_variant,,ENST00000538899,;	-	ENSG00000111880	ENST00000369485	Transcript	intron_variant						rs66750671	1		-1	RNGTT	HGNC	10073	protein_coding	YES	CCDS5017.1	ENSP00000358497	O60942	Q7Z3R6,B4DIQ0	UPI000012ED6E	NM_003800.3				13/15																		MODIFIER	1	deletion														.	GCTATGAT	.	.																					89454399
ENSR00001369164	0	.	GRCh37	6	89742782	89742783	+	IGR	INS	-	-	ATTTTTTTTTC	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001369164		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001369164,;	ATTTTTTTTTC		ENSR00001369164	RegulatoryFeature	regulatory_region_variant							1																																			MODIFIER	1	insertion														.	TAA	.	.																					89742782
MDN1	23195	.	GRCh37	6	90474976	90474977	+	Intron	DEL	AC	AC	-	rs5878110		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																c.2145-2728_2145-2727del			ENST00000369393		3	.	3	0	.	0	MDN1,intron_variant,,ENST00000369393,;MDN1,intron_variant,,ENST00000428876,NM_014611.1;MDN1,intron_variant,,ENST00000439638,;	-	ENSG00000112159	ENST00000369393	Transcript	intron_variant						rs5878110	1		-1	MDN1	HGNC	18302	protein_coding	YES	CCDS5024.1	ENSP00000358400	Q9NU22	M0QXR3	UPI000013C4B8					15/101			0.9092	0.8646		0.9177	0.7992	0.681										MODIFIER	1	deletion														.	ATACA	.	.																					90474975
BACH2	60468	.	GRCh37	6	90806991	90806991	+	Intron	DEL	T	T	-	rs5878115		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.-161-8163del			ENST00000257749		3	.	3	0	.	0	BACH2,intron_variant,,ENST00000257749,NM_021813.2;BACH2,intron_variant,,ENST00000343122,;BACH2,intron_variant,,ENST00000406998,;BACH2,intron_variant,,ENST00000453877,;BACH2,intron_variant,,ENST00000537989,NM_001170794.1;BACH2,intron_variant,,ENST00000470301,;BACH2,intron_variant,,ENST00000472023,;BACH2,intron_variant,,ENST00000493201,;,regulatory_region_variant,,ENSR00001712963,;	-	ENSG00000112182	ENST00000257749	Transcript	intron_variant						rs5878115	1		-1	BACH2	HGNC	14078	protein_coding	YES	CCDS5026.1	ENSP00000257749	Q9BYV9	S0BE05,S0BDZ6,S0BDY5,Q7Z6Q0	UPI000004F8AD	NM_021813.2				4/8			0.9569	0.7997		0.9782	0.7087	0.8599										MODIFIER	1	deletion														.	GATT	.	.																					90806990
Unknown	0	.	GRCh37	6	93552771	93552772	+	IGR	DEL	TC	TC	-	rs5878271		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TC	TC																					3	.	3	0	.	0		-				intergenic_variant						rs5878271	1																																			MODIFIER	1	deletion														.	TGTCT	.	.																					93552770
Unknown	0	.	GRCh37	6	94210956	94210957	+	IGR	INS	-	-	TGTT	rs61542359		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		TGTT				intergenic_variant						rs61542359	1																				0.5915	0.1916		0.1161	0.1193	0.0971										MODIFIER	1	insertion														.	TCT	.	.																					94210956
RP11-524K14.1	0	.	GRCh37	6	94601224	94601225	+	3'Flank	INS	-	-	TAAAC	rs111676124		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000424678		3	.	3	0	.	0	RP11-524K14.1,downstream_gene_variant,,ENST00000424678,;	TAAAC	ENSG00000229600	ENST00000424678	Transcript	downstream_gene_variant						rs111676124	1	2096	1	RP11-524K14.1	Clone_based_vega_gene		lincRNA	YES													0.6505	0.6124		0.9663	0.5964	0.7669										MODIFIER	1	insertion														.	ATT	.	.																					94601224
Unknown	0	.	GRCh37	6	97128301	97128302	+	IGR	INS	-	-	T	rs11429781		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs11429781	1																				0.8548	0.9914		1	0.999	1										MODIFIER	1	insertion														.	ACT	.	.																					97128301
RP1-199J3.5	0	.	GRCh37	6	100022909	100022913	+	5'Flank	DEL	ACTAT	ACTAT	-	rs79115935		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACTAT	ACTAT																			ENST00000407121		6	.	4	3	.	0	RP1-199J3.5,upstream_gene_variant,,ENST00000407121,;	-	ENSG00000219755	ENST00000407121	Transcript	upstream_gene_variant						rs79115935	1	675	1	RP1-199J3.5	Clone_based_vega_gene		processed_pseudogene	YES													0.053	0.1859		0.0893	0.1938	0.136										MODIFIER	1	deletion														.	GGACTATA	.	.																					100022908
HACE1	57531	.	GRCh37	6	105232461	105232461	+	Intron	DEL	A	A	-	rs71763197		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1410-101del			ENST00000262903		11	.	4	6	.	0	HACE1,intron_variant,,ENST00000262903,NM_020771.3;HACE1,intron_variant,,ENST00000369125,;HACE1,upstream_gene_variant,,ENST00000518503,;HACE1,upstream_gene_variant,,ENST00000517995,;HACE1,intron_variant,,ENST00000369127,;HACE1,intron_variant,,ENST00000416605,;HACE1,intron_variant,,ENST00000517424,;,regulatory_region_variant,,ENSR00001713671,;	-	ENSG00000085382	ENST00000262903	Transcript	intron_variant						rs71763197	2		-1	HACE1	HGNC	21033	protein_coding	YES	CCDS5050.1	ENSP00000262903	Q8IYU2	E5RFX0,E3W983	UPI00001602DC	NM_020771.3				12/23																		MODIFIER	1	sequence_alteration													1	.	CCAA	.	.																					105232460
LIN28B	389421	.	GRCh37	6	105420986	105420986	+	Intron	DEL	A	A	-	rs574004784		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.198+14839del			ENST00000345080		3	.	3	0	.	0	LIN28B,intron_variant,,ENST00000345080,NM_001004317.3;,regulatory_region_variant,,ENSR00001713685,;	-	ENSG00000187772	ENST00000345080	Transcript	intron_variant						rs574004784	1		1	LIN28B	HGNC	32207	protein_coding	YES	CCDS34504.1	ENSP00000344401	Q6ZN17	A7E2T3	UPI000035E7BD	NM_001004317.3				2/3																		MODIFIER	1	deletion													1	.	TCAA	.	.																					105420985
POPDC3	64208	.	GRCh37	6	105608326	105608327	+	Intron	INS	-	-	GACC	rs34700827		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.486-636_486-633dup			ENST00000254765		4	.	4	0	.	0	POPDC3,intron_variant,,ENST00000254765,NM_022361.4;POPDC3,upstream_gene_variant,,ENST00000429112,;BVES-AS1,intron_variant,,ENST00000369122,;BVES-AS1,intron_variant,,ENST00000580511,;BVES-AS1,intron_variant,,ENST00000580854,;BVES-AS1,downstream_gene_variant,,ENST00000369120,;POPDC3,intron_variant,,ENST00000474760,;POPDC3,intron_variant,,ENST00000489134,;	GACC	ENSG00000132429	ENST00000254765	Transcript	intron_variant						rs34700827	1		-1	POPDC3	HGNC	17649	protein_coding	YES	CCDS5052.1	ENSP00000254765	Q9HBV1		UPI000006FA58	NM_022361.4				2/3			0.5439	0.9467		0.9177	0.9573	0.8988										MODIFIER	1	insertion														.	GTG	.	.																					105608326
Unknown	0	.	GRCh37	6	105711566	105711566	+	IGR	DEL	C	C	-	rs200648935		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					3	.	3	0	.	0		-				intergenic_variant						rs200648935	1																			0.1082	0.2179	0.049		0.0565	0.0586	0.1063										MODIFIER	1	deletion														.	AACA	.	.																					105711565
ARMC2	84071	.	GRCh37	6	109285993	109285993	+	Intron	DEL	A	A	-	rs879292492		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.2286-180del			ENST00000392644		7	.	3	10	.	0	ARMC2,intron_variant,,ENST00000368972,NM_001286609.1;ARMC2,intron_variant,,ENST00000392644,NM_032131.4;ARMC2,intron_variant,,ENST00000481850,;	-	ENSG00000118690	ENST00000392644	Transcript	intron_variant						rs879292492	1		1	ARMC2	HGNC	23045	protein_coding	YES	CCDS5069.2	ENSP00000376417	Q8NEN0	G5E993,B0QZC1	UPI000022CC80	NM_032131.4				16/17																		MODIFIER	1	deletion													1	.	TCAA	.	.																					109285992
SLC22A16	85413	.	GRCh37	6	110759758	110759764	+	Intron	DEL	ATATAAC	ATATAAC	-	rs10603592		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATATAAC	ATATAAC																c.1311+159_1311+165del			ENST00000368919		5	.	3	3	.	0	SLC22A16,intron_variant,,ENST00000330550,;SLC22A16,intron_variant,,ENST00000368919,NM_033125.3;SLC22A16,intron_variant,,ENST00000439654,;SLC22A16,intron_variant,,ENST00000451557,;SLC22A16,downstream_gene_variant,,ENST00000434949,;SLC22A16,downstream_gene_variant,,ENST00000437378,;SLC22A16,downstream_gene_variant,,ENST00000456137,;RN7SL617P,downstream_gene_variant,,ENST00000485298,;	-	ENSG00000004809	ENST00000368919	Transcript	intron_variant						rs10603592	1		-1	SLC22A16	HGNC	20302	protein_coding	YES	CCDS5084.1	ENSP00000357915	Q86VW1	Q96ER0,C9JU94,C9JGT0	UPI000000DC13	NM_033125.3				5/7			0.0038	0.049		0.0536	0.0775	0.0982										MODIFIER	1	deletion														.	TTATATAACA	.	.																					110759757
RNU6-1115P	0	.	GRCh37	6	111179399	111179400	+	3'Flank	INS	-	-	T	rs74640188		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000362490		5	.	5	0	.	0	RNU6-1115P,downstream_gene_variant,,ENST00000362490,;CNN2P9,upstream_gene_variant,,ENST00000417134,;	T	ENSG00000199360	ENST00000362490	Transcript	downstream_gene_variant						rs74640188	1	1674	1	RNU6-1115P	HGNC	48078	snRNA	YES													0.4289	0.1859		0.6528	0.2654	0.4939										MODIFIER		insertion														.	CGT	.	.																					111179399
RP11-397G5.2	0	.	GRCh37	6	111243272	111243284	+	5'Flank	DEL	TCAGCTGGTGTGA	TCAGCTGGTGTGA	-	rs56802906		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCAGCTGGTGTGA	TCAGCTGGTGTGA																			ENST00000402967		3	.	3	0	.	0	RP11-397G5.2,upstream_gene_variant,,ENST00000402967,;	-	ENSG00000219329	ENST00000402967	Transcript	upstream_gene_variant						rs56802906	1	1485	1	RP11-397G5.2	Clone_based_vega_gene		processed_pseudogene	YES													1	1		1	1	1										MODIFIER	1	deletion														.	GTTCAGCTGGTGTGAT	.	.																					111243271
RP11-505K1.1	0	.	GRCh37	6	113142780	113142782	+	5'Flank	DEL	TCT	TCT	-	rs10586135		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCT	TCT																			ENST00000604713		6	.	4	6	.	0	RP11-505K1.1,upstream_gene_variant,,ENST00000604713,;	-	ENSG00000271498	ENST00000604713	Transcript	upstream_gene_variant						rs10586135	1	4359	1	RP11-505K1.1	Clone_based_vega_gene		processed_pseudogene	YES													0.1188	0.1729		0.0486	0.2147	0.2495										MODIFIER	1	deletion														.	AATCTT	.	.																					113142779
SOCS5P5	0	.	GRCh37	6	113541009	113541010	+	5'Flank	INS	-	-	TCCAGGAG	rs2307877		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000402732		4	.	4	0	.	0	SOCS5P5,upstream_gene_variant,,ENST00000402732,;	TCCAGGAG	ENSG00000216904	ENST00000402732	Transcript	upstream_gene_variant						rs2307877	1	2358	1	SOCS5P5	HGNC	44601	processed_pseudogene	YES													0.8835	0.9597		0.8968	0.9573	0.8773										MODIFIER	1	insertion														.	ATT	.	.																					113541009
Unknown	0	.	GRCh37	6	115938601	115938602	+	IGR	INS	-	-	T	rs35134705		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs35134705	1																				0.0877	0.3473		0.4008	0.3469	0.273										MODIFIER	1	insertion														.	TCT	.	.																					115938601
HSF2	3298	.	GRCh37	6	122727921	122727921	+	Intron	DEL	G	G	-	rs34444982		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.94-5597del			ENST00000368455		3	.	3	0	.	0	HSF2,intron_variant,,ENST00000368455,NM_004506.3;HSF2,intron_variant,,ENST00000452194,NM_001135564.1;,regulatory_region_variant,,ENSR00001715407,;	-	ENSG00000025156	ENST00000368455	Transcript	intron_variant						rs34444982	1		1	HSF2	HGNC	5225	protein_coding	YES	CCDS5124.1	ENSP00000357440	Q03933		UPI000012CCE8	NM_004506.3				1/12		0.1410	0.1029	0.1239		0.252	0.1511	0.0798										MODIFIER	1	deletion														.	TAGT	.	.																					122727920
NKAIN2	154215	.	GRCh37	6	124167989	124167990	+	Intron	INS	-	-	CA	rs34106417		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.54+42607_54+42608dup			ENST00000368417		6	2	3	4	4	0	NKAIN2,intron_variant,,ENST00000368416,;NKAIN2,intron_variant,,ENST00000368417,NM_001040214.1;NKAIN2,intron_variant,,ENST00000546092,;NKAIN2,intron_variant,,ENST00000476571,;	CA	ENSG00000188580	ENST00000368417	Transcript	intron_variant						rs34106417	1		1	NKAIN2	HGNC	16443	protein_coding	YES	CCDS34526.1	ENSP00000357402	Q5VXU1	B3KNZ0,B0AZU5	UPI0000458919	NM_001040214.1				1/6			0.1271	0.3588		0.4812	0.3996	0.41										MODIFIER	1	insertion														.	CGC	.	.																					124167989
RNF217	154214	.	GRCh37	6	125313324	125313324	+	Intron	DEL	T	T	-	rs35561609		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.-184-4397del			ENST00000359704		5	.	5	2	.	0	RNF217,intron_variant,,ENST00000359704,NM_152553.2;RNF217,intron_variant,,ENST00000368414,;RNF217,intron_variant,,ENST00000519799,;RNF217,intron_variant,,ENST00000521654,NM_001286398.1;RNF217,intron_variant,,ENST00000560949,;RNF217,intron_variant,,ENST00000454842,;RNF217,intron_variant,,ENST00000519565,;	-	ENSG00000146373	ENST00000359704	Transcript	intron_variant						rs35561609	1		1	RNF217	HGNC	21487	protein_coding	YES	CCDS5129.1	ENSP00000352734	Q8TC41		UPI000007307D	NM_152553.2				1/8		0.2516	0.0961	0.2795		0.4117	0.2734	0.2546										MODIFIER	1	deletion														.	GCTG	.	.																					125313323
RP1-293L8.2	643623	.	GRCh37	6	125990837	125990837	+	5'Flank	DEL	T	T	-	rs200661396		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000423208		3	.	3	0	.	0	RP1-293L8.2,upstream_gene_variant,,ENST00000423208,;RP11-624M8.1,intron_variant,,ENST00000427852,;RP11-624M8.1,intron_variant,,ENST00000451660,;RP11-624M8.1,intron_variant,,ENST00000606334,;	-	ENSG00000224506	ENST00000423208	Transcript	upstream_gene_variant						rs200661396	1	4662	1	RP1-293L8.2	Clone_based_vega_gene		lincRNA	YES													0.1006	0.0086			0.001											MODIFIER	1	deletion														.	GGTT	.	.																					125990836
Unknown	0	.	GRCh37	6	126898932	126898933	+	IGR	INS	-	-	TTG	rs3030277		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	6	0	.	0		TTG				intergenic_variant						rs3030277	1																				0.5461	0.8516		0.998	0.7247	0.9622										MODIFIER	1	insertion														.	AAT	.	.																					126898932
Unknown	0	.	GRCh37	6	127372170	127372171	+	IGR	DEL	AC	AC	-	rs35631508		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																					3	.	3	0	.	0		-				intergenic_variant						rs35631508	1																																			MODIFIER	1	deletion														.	AAACA	.	.																					127372169
RPS12	6206	.	GRCh37	6	133139121	133139123	+	3'Flank	DEL	CTT	CTT	-	rs67074708		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTT	CTT																			ENST00000230050		5	.	5	3	.	0	RPS12,downstream_gene_variant,,ENST00000230050,NM_001016.3;SNORA33,downstream_gene_variant,,ENST00000363664,NR_002436.1;SNORD101,downstream_gene_variant,,ENST00000384027,NR_002434.1;SNORD100,downstream_gene_variant,,ENST00000408573,NR_002435.1;RPS12,downstream_gene_variant,,ENST00000484616,;	-	ENSG00000112306	ENST00000230050	Transcript	downstream_gene_variant						rs67074708	1	418	1	RPS12	HGNC	10385	protein_coding	YES	CCDS5164.1	ENSP00000230050	P25398		UPI000000096F	NM_001016.3							0.4402	0.536		0.2282	0.3012	0.3507										MODIFIER	1	deletion														.	GACTTC	.	.																					133139120
RP3-323P13.2	100507308	.	GRCh37	6	133899669	133899669	+	Intron	DEL	T	T	-	rs60316888		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																n.624-10283del			ENST00000607033		6	.	3	4	.	0	RP3-323P13.2,intron_variant,,ENST00000606292,;RP3-323P13.2,intron_variant,,ENST00000606544,;RP3-323P13.2,intron_variant,,ENST00000607033,;RP3-323P13.2,intron_variant,,ENST00000607573,;	-	ENSG00000227954	ENST00000607033	Transcript	intron_variant,non_coding_transcript_variant						rs60316888	1		-1	RP3-323P13.2	Clone_based_vega_gene		antisense	YES										4/8																		MODIFIER	1	deletion														.	AGTT	.	.																					133899668
RP11-557H15.3	0	.	GRCh37	6	134825720	134825720	+	Intron	DEL	A	A	-	rs11343908		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																n.77+15927del			ENST00000417483		3	.	3	0	.	0	RP11-557H15.3,intron_variant,,ENST00000417483,;LINC01010,downstream_gene_variant,,ENST00000431422,;LINC01010,downstream_gene_variant,,ENST00000440090,;LINC01010,downstream_gene_variant,,ENST00000456749,;	-	ENSG00000231971	ENST00000417483	Transcript	intron_variant,non_coding_transcript_variant						rs11343908	1		-1	RP11-557H15.3	Clone_based_vega_gene		lincRNA	YES										1/4			0.5159	0.2536		0.1865	0.3072	0.363										MODIFIER	1	deletion														.	ACAA	.	.																					134825719
Unknown	0	.	GRCh37	6	135019582	135019584	+	IGR	DEL	GAG	GAG	-	rs78479050		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAG	GAG																					4	.	4	0	.	0		-				intergenic_variant						rs78479050	1																				0.2489	0.2363		0.2867	0.2087	0.2096										MODIFIER	1	deletion														.	CTGAGG	.	.																					135019581
Unknown	0	.	GRCh37	6	139320512	139320513	+	IGR	INS	-	-	CCTGGAAAG	rs57363069		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		CCTGGAAAG				intergenic_variant						rs57363069	1																				0.146	0.1441		0.3442	0.2366	0.2526										MODIFIER	1	insertion														.	AAC	.	.																					139320512
TIAM2	26230	.	GRCh37	6	155523170	155523170	+	Intron	DEL	A	A	-	rs5881125		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.3065-9160del			ENST00000461783		3	.	3	0	.	0	TIAM2,intron_variant,,ENST00000318981,NM_012454.3;TIAM2,intron_variant,,ENST00000360366,;TIAM2,intron_variant,,ENST00000367174,;TIAM2,intron_variant,,ENST00000456144,;TIAM2,intron_variant,,ENST00000456877,;TIAM2,intron_variant,,ENST00000461783,;TIAM2,intron_variant,,ENST00000528391,;TIAM2,intron_variant,,ENST00000528535,;TIAM2,intron_variant,,ENST00000529824,;TIAM2,intron_variant,,ENST00000543712,;,regulatory_region_variant,,ENSR00001719049,;,TF_binding_site_variant,,ENSM00533419933,;,TF_binding_site_variant,,ENSM00533127090,;	-	ENSG00000146426	ENST00000461783	Transcript	intron_variant						rs5881125	1		1	TIAM2	HGNC	11806	protein_coding	YES	CCDS34558.1	ENSP00000437188	Q8IVF5	F5H8H5,F5H6W6,F5H6R0,F5H1M3,E9PMZ8	UPI00004DF8BE					16/28			0.8351	0.8026		0.494	0.7286	0.683										MODIFIER	1	deletion														.	ATAA	.	.																					155523169
Unknown	0	.	GRCh37	6	156130859	156130859	+	IGR	DEL	T	T	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					6	4	2	4	4	0		-				intergenic_variant							1																																			MODIFIER	1	deletion														.	TATT	.	.																					156130858
ENSR00001381812	0	.	GRCh37	6	156208599	156208600	+	IGR	INS	-	-	CTAA	rs10670368		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001381812		5	.	5	0	.	0	,regulatory_region_variant,,ENSR00001381812,;	CTAA		ENSR00001381812	RegulatoryFeature	regulatory_region_variant						rs10670368	1																				0.7829	0.7968		0.8681	0.6829	0.8415										MODIFIER	1	insertion														.	ATC	.	.																					156208599
Unknown	0	.	GRCh37	6	156312125	156312126	+	IGR	INS	-	-	CGTTC	rs139649478		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		CGTTC				intergenic_variant						rs139649478	1																				0.5946	0.4251		0.3889	0.4672	0.3701										MODIFIER	1	insertion														.	TTC	.	.																					156312125
TULP4	56995	.	GRCh37	6	158750859	158750860	+	Intron	INS	-	-	CTAT	rs10640677		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.252+15560_252+15563dup			ENST00000367097		3	.	3	0	.	0	TULP4,intron_variant,,ENST00000367094,NM_001007466.2;TULP4,intron_variant,,ENST00000367097,NM_020245.4;	CTAT	ENSG00000130338	ENST00000367097	Transcript	intron_variant						rs10640677	1		1	TULP4	HGNC	15530	protein_coding	YES	CCDS34561.1	ENSP00000356064	Q9NRJ4		UPI000013CD76	NM_020245.4				1/13																		MODIFIER	1	insertion														.	AAC	.	.																					158750859
IGF2R	3482	.	GRCh37	6	160463028	160463029	+	Intron	INS	-	-	T	rs3839347		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1481-1140dup			ENST00000356956		3	.	3	0	.	0	IGF2R,intron_variant,,ENST00000356956,NM_000876.2;,regulatory_region_variant,,ENSR00000206327,;	T	ENSG00000197081	ENST00000356956	Transcript	intron_variant						rs3839347	1		1	IGF2R	HGNC	5467	protein_coding	YES	CCDS5273.1	ENSP00000349437	P11717	A0N9R7,A0N9R6	UPI0000072478	NM_000876.2				11/47			0.2564	0.3516		0.7242	0.3459	0.4622										MODIFIER	1	insertion														.	ACT	.	.																					160463028
SLC22A2	6582	.	GRCh37	6	160636860	160636861	+	3'Flank	INS	-	-	GGTAGAGCC	rs11280578		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000366953		4	.	4	0	.	0	SLC22A2,downstream_gene_variant,,ENST00000366953,NM_003058.3;SLC22A2,intron_variant,,ENST00000486916,;SLC22A2,downstream_gene_variant,,ENST00000491092,;SLC22A2,downstream_gene_variant,,ENST00000498556,;	GGTAGAGCC	ENSG00000112499	ENST00000366953	Transcript	downstream_gene_variant						rs11280578	1	933	-1	SLC22A2	HGNC	10966	protein_coding	YES	CCDS5276.1	ENSP00000355920	O15244	Q5T7Q5	UPI000013D5BB	NM_003058.3							0.6732	0.9121		0.869	0.8907	0.8548										MODIFIER	1	insertion														.	CTG	.	.																					160636860
PARK2	5071	.	GRCh37	6	162575557	162575557	+	Intron	DEL	A	A	-	rs5881452		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.534+46606del			ENST00000366898		3	.	3	0	.	0	PARK2,intron_variant,,ENST00000338468,;PARK2,intron_variant,,ENST00000366892,;PARK2,intron_variant,,ENST00000366894,;PARK2,intron_variant,,ENST00000366896,NM_013988.2;PARK2,intron_variant,,ENST00000366897,NM_013987.2;PARK2,intron_variant,,ENST00000366898,NM_004562.2;PARK2,intron_variant,,ENST00000479615,;,regulatory_region_variant,,ENSR00001719860,;	-	ENSG00000185345	ENST00000366898	Transcript	intron_variant						rs5881452	1		-1	PARK2	HGNC	8607	protein_coding	YES	CCDS5281.1	ENSP00000355865	O60260	M4T2U2,Q6S8G7,Q6Q2I8,Q5XNR7	UPI00003673FE	NM_004562.2				4/11																		MODIFIER	1	deletion													1	.	AGAA	.	.																					162575556
Unknown	0	.	GRCh37	6	165346570	165346570	+	IGR	DEL	T	T	-	rs140498464		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs140498464	1																			0.2644	0.2821	0.3343		0.3591	0.1044	0.2577										MODIFIER	1	deletion														.	AATA	.	.																					165346569
RPS6KA2	6196	.	GRCh37	6	167156685	167156686	+	Intron	INS	-	-	C	rs5881715		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.123+115002dup			ENST00000503859		9	.	4	3	.	0	RPS6KA2,intron_variant,,ENST00000503859,NM_001006932.1;RPS6KA2,intron_variant,,ENST00000506565,;RPS6KA2,intron_variant,,ENST00000507371,;RPS6KA2,intron_variant,,ENST00000510118,;RPS6KA2,intron_variant,,ENST00000512860,;	C	ENSG00000071242	ENST00000503859	Transcript	intron_variant						rs5881715	1		-1	RPS6KA2	HGNC	10431	protein_coding	YES	CCDS34570.1	ENSP00000427015	Q15349	D6RHW7,D6RD75,D6R910,B7Z3B5	UPI000020D48C	NM_001006932.1				2/21			0.8971	0.3602		0.5407	0.2942	0.3272										MODIFIER	1	insertion														.	CAC	.	.																					167156685
SMOC2	64094	.	GRCh37	6	168909736	168909736	+	Intron	DEL	T	T	-	rs145987209		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.85-858del			ENST00000354536		4	.	4	0	.	0	SMOC2,intron_variant,,ENST00000354536,NM_022138.2;SMOC2,intron_variant,,ENST00000356284,NM_001166412.1;	-	ENSG00000112562	ENST00000354536	Transcript	intron_variant						rs145987209	1		1	SMOC2	HGNC	20323	protein_coding	YES	CCDS5307.1	ENSP00000346537	Q9H3U7	B4DNB1	UPI0000072A56	NM_022138.2				1/12			0.2519	0.0461		0.0069	0.0487	0.2198										MODIFIER	1	deletion													1	.	AGTT	.	.																					168909735
Unknown	0	.	GRCh37	6	169208187	169208187	+	IGR	DEL	A	A	-	rs34616891		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	4	0	.	0		-				intergenic_variant						rs34616891	1																				0.0613	0.0965		0.1429	0.0905	0.09										MODIFIER	1	deletion														.	TTAA	.	.																					169208186
Unknown	0	.	GRCh37	6	169322891	169322899	+	IGR	DEL	CCATAGGCC	CCATAGGCC	-	rs57291478		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCATAGGCC	CCATAGGCC																					4	.	4	0	.	0		-				intergenic_variant						rs57291478	1																				0.5628	0.8444		0.6875	0.8807	0.7536										MODIFIER	1	deletion														.	CTCCATAGGCCC	.	.																					169322890
Unknown	0	.	GRCh37	7	572026	572027	+	IGR	DEL	AG	AG	-	rs35459772		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																					3	.	3	0	.	0		-				intergenic_variant						rs35459772	1																				0.0635	0.1916		0.2044	0.3499	0.2474										MODIFIER	1	deletion														.	GAAGA	.	.																					572025
HEATR2	54919	.	GRCh37	7	765699	765715	+	5'Flank	DEL	AGCCAGTTTCTGCATGC	AGCCAGTTTCTGCATGC	-	rs66479052		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGCCAGTTTCTGCATGC	AGCCAGTTTCTGCATGC																			ENST00000297440		3	.	3	0	.	0	PRKAR1B,intron_variant,,ENST00000403562,NM_001164758.1;PRKAR1B,intron_variant,,ENST00000417852,;PRKAR1B,intron_variant,,ENST00000537384,NM_001164760.1;HEATR2,upstream_gene_variant,,ENST00000297440,NM_017802.3;HEATR2,upstream_gene_variant,,ENST00000313147,;HEATR2,upstream_gene_variant,,ENST00000437419,;HEATR2,upstream_gene_variant,,ENST00000440747,;PRKAR1B,intron_variant,,ENST00000478198,;PRKAR1B,intron_variant,,ENST00000488474,;HEATR2,upstream_gene_variant,,ENST00000438961,;,regulatory_region_variant,,ENSR00000207477,;	-	ENSG00000164818	ENST00000297440	Transcript	upstream_gene_variant						rs66479052	1	623	1	HEATR2	HGNC	26013	protein_coding	YES	CCDS34580.1	ENSP00000297440	Q86Y56		UPI0000D61BE2	NM_017802.3																						MODIFIER	1	deletion													1	.	TTAGCCAGTTTCTGCATGCA	.	.																					765698
ADAP1	11033	.	GRCh37	7	945071	945071	+	Intron	DEL	A	A	-	rs1379936267		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.389-262del			ENST00000265846		11	.	6	6	.	3	ADAP1,intron_variant,,ENST00000265846,NM_006869.2,NM_001284311.1;ADAP1,intron_variant,,ENST00000435943,;ADAP1,intron_variant,,ENST00000437486,;ADAP1,intron_variant,,ENST00000446141,;ADAP1,intron_variant,,ENST00000449296,NM_001284309.1,NM_001284310.1;ADAP1,intron_variant,,ENST00000453823,;ADAP1,intron_variant,,ENST00000454383,;ADAP1,intron_variant,,ENST00000539900,NM_001284308.1;ADAP1,upstream_gene_variant,,ENST00000453175,;ADAP1,intron_variant,,ENST00000463358,;ADAP1,intron_variant,,ENST00000477906,;ADAP1,intron_variant,,ENST00000488527,;ADAP1,non_coding_transcript_exon_variant,,ENST00000478000,;COX19,intron_variant,,ENST00000457254,;ADAP1,upstream_gene_variant,,ENST00000481406,;ADAP1,upstream_gene_variant,,ENST00000495809,;,regulatory_region_variant,,ENSR00001385349,;,regulatory_region_variant,,ENSR00001720874,;	-	ENSG00000105963	ENST00000265846	Transcript	intron_variant						rs1379936267	1		-1	ADAP1	HGNC	16486	protein_coding	YES	CCDS5318.1	ENSP00000265846	O75689	H7C2Q4	UPI000013D694	NM_006869.2,NM_001284311.1				4/10																		MODIFIER	1	deletion														.	GGAG	.	.																					945070
MAFK	7975	.	GRCh37	7	1579166	1579174	+	Intron	DEL	CAGCGTGGC	CAGCGTGGC	-	rs3217410		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAGCGTGGC	CAGCGTGGC																c.36+312_36+320del			ENST00000343242		3	.	3	0	.	0	MAFK,intron_variant,,ENST00000343242,NM_002360.3;MAFK,intron_variant,,ENST00000406174,;TMEM184A,downstream_gene_variant,,ENST00000297477,NM_001097620.1;TMEM184A,downstream_gene_variant,,ENST00000421996,;TMEM184A,downstream_gene_variant,,ENST00000449955,;MAFK,intron_variant,,ENST00000403150,;TMEM184A,downstream_gene_variant,,ENST00000319018,;AC093734.1,upstream_gene_variant,,ENST00000540816,;	-	ENSG00000198517	ENST00000343242	Transcript	intron_variant						rs3217410	1		1	MAFK	HGNC	6782	protein_coding	YES	CCDS5325.1	ENSP00000344903	O60675	A8WFP5,A4D214	UPI000012EB23	NM_002360.3				2/2			0.9607	0.7795		0.6865	0.7018	0.6268										MODIFIER	1	deletion														.	GGCAGCGTGGCC	.	.																					1579165
LFNG	3955	.	GRCh37	7	2570869	2570870	+	3'Flank	INS	-	-	CTTCTGAGCCCAGCCCCAC	rs6149960		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000222725		4	.	4	0	.	0	LFNG,downstream_gene_variant,,ENST00000222725,NM_001040167.1;LFNG,downstream_gene_variant,,ENST00000338732,;LFNG,downstream_gene_variant,,ENST00000359574,NM_001040168.1;LFNG,downstream_gene_variant,,ENST00000402045,NM_002304.2;LFNG,downstream_gene_variant,,ENST00000402506,NM_001166355.1;MIR4648,downstream_gene_variant,,ENST00000580107,;LFNG,downstream_gene_variant,,ENST00000493850,;	CTTCTGAGCCCAGCCCCAC	ENSG00000106003	ENST00000222725	Transcript	downstream_gene_variant						rs6149960	1	2806	1	LFNG	HGNC	6560	protein_coding	YES	CCDS34587.1	ENSP00000222725	Q8NES3		UPI000012E5D5	NM_001040167.1							0.9077	0.7392		0.748	0.7286	0.7239										MODIFIER	1	insertion													1	.	TGC	.	.																					2570869
Unknown	0	.	GRCh37	7	4520435	4520435	+	IGR	DEL	T	T	-	rs59719510		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					6	.	6	0	.	0		-				intergenic_variant						rs59719510	1																																			MODIFIER	1	deletion														.	TCTT	.	.																					4520434
FBXL18	80028	.	GRCh37	7	5498329	5498330	+	Intron	INS	-	-	A	rs879787732		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2001-10856dup			ENST00000415009		3	.	3	0	.	0	FBXL18,intron_variant,,ENST00000415009,;,regulatory_region_variant,,ENSR00001721502,;	A	ENSG00000155034	ENST00000415009	Transcript	intron_variant,NMD_transcript_variant						rs879787732	1		-1	FBXL18	HGNC	21874	nonsense_mediated_decay			ENSP00000415064	Q96ME1		UPI000006D25C					4/6																		MODIFIER	1	insertion														.	CCA	.	.																					5498329
RAC1	5879	.	GRCh37	7	6411993	6411993	+	5'Flank	DEL	A	A	-	rs34272534		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000356142		3	.	3	0	.	0	RAC1,upstream_gene_variant,,ENST00000348035,NM_006908.4;RAC1,upstream_gene_variant,,ENST00000356142,NM_018890.3;RAC1,upstream_gene_variant,,ENST00000488373,;	-	ENSG00000136238	ENST00000356142	Transcript	upstream_gene_variant						rs34272534	1	2177	1	RAC1	HGNC	9801	protein_coding	YES	CCDS5349.1	ENSP00000348461	P63000	A4D2P0	UPI000002B20E	NM_018890.3							0.3949	0.5303		0.7649	0.4533	0.4796										MODIFIER	1	deletion													1	.	ACAA	.	.																					6411992
DAGLB	221955	.	GRCh37	7	6485944	6485946	+	Intron	DEL	AAA	AAA	-	rs11315985		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAA	AAA																c.96-211_96-209del			ENST00000297056		3	.	3	0	.	0	DAGLB,intron_variant,,ENST00000297056,NM_139179.3;DAGLB,intron_variant,,ENST00000421761,;DAGLB,intron_variant,,ENST00000425398,NM_001142936.1;DAGLB,intron_variant,,ENST00000428902,;DAGLB,intron_variant,,ENST00000432248,;DAGLB,intron_variant,,ENST00000436575,;KDELR2,intron_variant,,ENST00000463747,;DAGLB,intron_variant,,ENST00000479922,;DAGLB,intron_variant,,ENST00000483716,;DAGLB,intron_variant,,ENST00000454738,;,regulatory_region_variant,,ENSR00000208227,;	-	ENSG00000164535	ENST00000297056	Transcript	intron_variant						rs11315985	1		-1	DAGLB	HGNC	28923	protein_coding	YES	CCDS5350.1	ENSP00000297056	Q8NCG7	E7ET49,B3KR38	UPI000006E01F	NM_139179.3				1/14																		MODIFIER	1	deletion														.	ACAAAA	.	.																					6485943
RSPH10B2	728194	.	GRCh37	7	6798598	6798599	+	Intron	INS	-	-	T	rs1305154747		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.255-116dup			ENST00000403107		14	.	12	27	.	27	RSPH10B2,intron_variant,,ENST00000297186,;RSPH10B2,intron_variant,,ENST00000359718,;RSPH10B2,intron_variant,,ENST00000403107,;RSPH10B2,intron_variant,,ENST00000404077,NM_001099697.1;RSPH10B2,intron_variant,,ENST00000433859,;RSPH10B2,downstream_gene_variant,,ENST00000418406,;RSPH10B2,downstream_gene_variant,,ENST00000435395,;RSPH10B2,intron_variant,,ENST00000485129,;RSPH10B2,upstream_gene_variant,,ENST00000463354,;RSPH10B2,upstream_gene_variant,,ENST00000489190,;RSPH10B2,upstream_gene_variant,,ENST00000497737,;	T	ENSG00000169402	ENST00000403107	Transcript	intron_variant						rs1305154747	1		1	RSPH10B2	HGNC	34385	protein_coding	YES	CCDS43552.1	ENSP00000384766	B2RC85	C9JJN2	UPI000020EAF6					2/19																		MODIFIER	1	insertion														.	TAT	.	.																					6798598
RP11-740N7.4	0	.	GRCh37	7	6958896	6958896	+	3'Flank	DEL	A	A	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000461922		6	4	2	6	6	0	RP11-740N7.4,downstream_gene_variant,,ENST00000461922,;ALG1L5P,upstream_gene_variant,,ENST00000482043,;	-	ENSG00000241539	ENST00000461922	Transcript	downstream_gene_variant							1	4813	-1	RP11-740N7.4	Clone_based_vega_gene		processed_pseudogene	YES																												MODIFIER		deletion														.	GTAA	.	.																					6958895
ICA1	3382	.	GRCh37	7	8192427	8192429	+	Intron	DEL	CCA	CCA	-	rs79753788		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCA	CCA																c.804+4317_804+4319del			ENST00000402384		7	3	4	8	8	0	ICA1,intron_variant,,ENST00000265577,;ICA1,intron_variant,,ENST00000396675,NM_022307.2;ICA1,intron_variant,,ENST00000401396,;ICA1,intron_variant,,ENST00000402384,NM_001136020.2;ICA1,intron_variant,,ENST00000406470,NM_001276478.1,NM_004968.3;ICA1,intron_variant,,ENST00000422063,;ICA1,downstream_gene_variant,,ENST00000317367,;ICA1,downstream_gene_variant,,ENST00000407906,;AC007009.2,downstream_gene_variant,,ENST00000577980,;ICA1,intron_variant,,ENST00000486677,;ICA1,intron_variant,,ENST00000339809,;ICA1,intron_variant,,ENST00000455539,;ICA1,intron_variant,,ENST00000470696,;,regulatory_region_variant,,ENSR00001721821,;	-	ENSG00000003147	ENST00000402384	Transcript	intron_variant						rs79753788	1		-1	ICA1	HGNC	5343	protein_coding	YES	CCDS34602.1	ENSP00000385570	Q05084	Q9UDQ6,F8WET5,C9J3Y4	UPI000012D139	NM_001136020.2				8/13																		MODIFIER	1	deletion														.	CTCCAC	.	.																					8192426
Unknown	0	.	GRCh37	7	10641093	10641097	+	IGR	DEL	ATAAT	ATAAT	-	rs71023862		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATAAT	ATAAT																					4	.	4	0	.	0		-				intergenic_variant						rs71023862	1																				0.0439	0.2464		0.0397	0.2972	0.182										MODIFIER	1	deletion														.	CAATAATA	.	.																					10641092
PHF14	9678	.	GRCh37	7	11166403	11166403	+	Intron	DEL	A	A	-	rs748777005		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1917+15322del			ENST00000445996		3	.	3	0	.	0	PHF14,intron_variant,,ENST00000445996,;PHF14,intron_variant,,ENST00000469407,;PHF14,intron_variant,,ENST00000493922,;PHF14,intron_variant,,ENST00000423760,;PHF14,intron_variant,,ENST00000470665,;PHF14,intron_variant,,ENST00000473050,;	-	ENSG00000106443	ENST00000445996	Transcript	intron_variant						rs748777005	1		1	PHF14	HGNC	22203	protein_coding			ENSP00000403907	O94880		UPI0000EE431B					16/16																		MODIFIER	1	deletion														.	TGAA	.	.																					11166402
AGMO	392636	.	GRCh37	7	15470018	15470019	+	Intron	INS	-	-	A	rs201115742		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.513+611dup			ENST00000342526		3	.	3	0	.	0	AGMO,intron_variant,,ENST00000342526,NM_001004320.1;	A	ENSG00000187546	ENST00000342526	Transcript	intron_variant						rs201115742	1		-1	AGMO	HGNC	33784	protein_coding	YES	CCDS34604.1	ENSP00000341662	Q6ZNB7		UPI0000050343	NM_001004320.1				4/12			0.0257	0.0591		0.0704	0.1093	0.1524										MODIFIER	1	insertion														.	ACA	.	.																					15470018
AGMO	392636	.	GRCh37	7	15528542	15528543	+	Intron	DEL	TG	TG	-	rs34792607		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																c.409+55854_409+55855del			ENST00000342526		3	.	3	0	.	0	AGMO,intron_variant,,ENST00000342526,NM_001004320.1;	-	ENSG00000187546	ENST00000342526	Transcript	intron_variant						rs34792607	1		-1	AGMO	HGNC	33784	protein_coding	YES	CCDS34604.1	ENSP00000341662	Q6ZNB7		UPI0000050343	NM_001004320.1				3/12																		MODIFIER	1	deletion														.	ACTGT	.	.																					15528541
Unknown	0	.	GRCh37	7	16112092	16112093	+	IGR	INS	-	-	AGT	rs4001550		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AGT				intergenic_variant						rs4001550	1																			0.8311	0.7126	0.8977		0.8492	0.8787	0.8763										MODIFIER	1	insertion														.	TCG	.	.																					16112092
AC005682.5	101927841	.	GRCh37	7	22902331	22902332	+	3'Flank	DEL	TT	TT	-	rs10542417		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																			ENST00000415611		3	.	3	0	.	0	AC005682.5,downstream_gene_variant,,ENST00000415611,;AC005682.5,downstream_gene_variant,,ENST00000422542,;AC005682.6,downstream_gene_variant,,ENST00000452069,;	-	ENSG00000228649	ENST00000415611	Transcript	downstream_gene_variant						rs10542417	1	3225	1	AC005682.5	Clone_based_vega_gene		lincRNA	YES													0.4576	0.5303		0.5	0.3708	0.4806										MODIFIER		deletion														.	GATTT	.	.																					22902330
AC009508.1	0	.	GRCh37	7	23932780	23932781	+	Intron	INS	-	-	AC	rs34245074		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.76-1036_76-1035dup			ENST00000412828		4	.	4	2	.	0	AC009508.1,intron_variant,,ENST00000412828,;snoU13,downstream_gene_variant,,ENST00000459324,;	AC	ENSG00000227930	ENST00000412828	Transcript	intron_variant,non_coding_transcript_variant						rs34245074	1		-1	AC009508.1	Clone_based_vega_gene		lincRNA	YES										1/1																		MODIFIER	1	insertion														.	AGA	.	.																					23932780
DFNA5	1687	.	GRCh37	7	24778273	24778273	+	Intron	DEL	A	A	-	rs143422463		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.404+5908del			ENST00000342947		5	.	5	0	.	0	DFNA5,intron_variant,,ENST00000342947,NM_004403.2;DFNA5,intron_variant,,ENST00000409775,;DFNA5,intron_variant,,ENST00000409970,NM_001127453.1;DFNA5,intron_variant,,ENST00000414428,;DFNA5,intron_variant,,ENST00000419307,NM_001127454.1;DFNA5,intron_variant,,ENST00000545231,;DFNA5,intron_variant,,ENST00000411476,;DFNA5,intron_variant,,ENST00000493723,;DFNA5,downstream_gene_variant,,ENST00000473990,;	-	ENSG00000105928	ENST00000342947	Transcript	intron_variant						rs143422463	1		-1	DFNA5	HGNC	2810	protein_coding	YES	CCDS5389.1	ENSP00000339587	O60443		UPI00001291FC	NM_004403.2				3/9			0.059	0.219		0.1736	0.1233	0.1728										MODIFIER	1	deletion													1	.	ACAA	.	.																					24778272
AC091705.1	0	.	GRCh37	7	25590589	25590590	+	RNA	INS	-	-	T	rs35228764		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.93dup			ENST00000412197	1/2	4	.	4	0	.	0	AC091705.1,non_coding_transcript_exon_variant,,ENST00000412197,;	T	ENSG00000227386	ENST00000412197	Transcript	non_coding_transcript_exon_variant	93-94/209					rs35228764	1		-1	AC091705.1	Clone_based_vega_gene		lincRNA	YES									1/2																			MODIFIER	1	insertion														.	GAT	.	.																					25590589
AC004947.2	100506289	.	GRCh37	7	26592328	26592329	+	Intron	INS	-	-	GTGCACACACACGCCC	rs141907807		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.389+501_389+516dup			ENST00000420912		3	.	3	0	.	0	AC004947.2,intron_variant,,ENST00000420912,;AC004947.2,intron_variant,,ENST00000430426,;AC004947.2,intron_variant,,ENST00000457000,;,regulatory_region_variant,,ENSR00001390818,;	GTGCACACACACGCCC	ENSG00000233760	ENST00000420912	Transcript	intron_variant,non_coding_transcript_variant						rs141907807	1		1	AC004947.2	Clone_based_vega_gene		lincRNA	YES										1/1																		MODIFIER	1	insertion														.	CTG	.	.																					26592328
INMT	11185	.	GRCh37	7	30794253	30794256	+	Intron	DEL	ATCC	ATCC	-	rs58315408		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATCC	ATCC																c.362+737_362+740del			ENST00000013222		9	5	4	6	0	0	INMT,intron_variant,,ENST00000013222,NM_006774.4,NM_001199219.1;INMT,intron_variant,,ENST00000409539,;INMT,intron_variant,,ENST00000484180,;INMT-FAM188B,intron_variant,,ENST00000451002,;INMT-FAM188B,intron_variant,,ENST00000458257,;,regulatory_region_variant,,ENSR00001724115,;	-	ENSG00000241644	ENST00000013222	Transcript	intron_variant						rs58315408	1		1	INMT	HGNC	6069	protein_coding	YES	CCDS5430.1	ENSP00000013222	O95050	Q3MIB5	UPI000013C526	NM_006774.4,NM_001199219.1				2/2																		MODIFIER	1	deletion														.	CTATCCA	.	.																					30794252
DPY19L1	23333	.	GRCh37	7	35002707	35002708	+	Intron	INS	-	-	A	rs202056559		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.873+3798_873+3799insT			ENST00000310974		4	.	4	0	.	0	DPY19L1,intron_variant,,ENST00000310974,NM_015283.1;DPY19L1,intron_variant,,ENST00000446375,;DPY19L1,intron_variant,,ENST00000462134,;	A	ENSG00000173852	ENST00000310974	Transcript	intron_variant						rs202056559	1		-1	DPY19L1	HGNC	22205	protein_coding	YES	CCDS43567.1	ENSP00000308695	Q2PZI1		UPI000067CB92	NM_015283.1				10/21		0.0100	0.003	0.0072			0.0348	0.0061										MODIFIER	1	insertion														.	CTG	.	.																					35002707
EEPD1	80820	.	GRCh37	7	36232908	36232908	+	Intron	DEL	T	T	-	rs70977115		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.878+38098del			ENST00000242108		3	.	3	0	.	0	EEPD1,intron_variant,,ENST00000242108,NM_030636.2;EEPD1,intron_variant,,ENST00000534978,;,regulatory_region_variant,,ENSR00001724706,;	-	ENSG00000122547	ENST00000242108	Transcript	intron_variant						rs70977115	1		1	EEPD1	HGNC	22223	protein_coding	YES	CCDS34619.1	ENSP00000242108	Q7L9B9		UPI000020ED9D	NM_030636.2				2/7			0.1346	0.1297		0.005	0.1471	0.0583										MODIFIER	1	deletion														.	AGTT	.	.																					36232907
AMPH	273	.	GRCh37	7	38605909	38605909	+	Intron	DEL	T	T	-	rs11305133		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.70-31298del			ENST00000356264		4	.	4	0	.	0	AMPH,intron_variant,,ENST00000325590,NM_139316.2;AMPH,intron_variant,,ENST00000356264,NM_001635.3;AMPH,intron_variant,,ENST00000428293,;	-	ENSG00000078053	ENST00000356264	Transcript	intron_variant						rs11305133	1		-1	AMPH	HGNC	471	protein_coding	YES	CCDS5456.1	ENSP00000348602	P49418	Q9UQI5,Q9UQI4,Q9UQI3,Q9UQI2	UPI00001259EA	NM_001635.3				1/20			0.5582	0.6614		0.2966	0.7316	0.5419										MODIFIER	1	deletion														.	TGTT	.	.																					38605908
HECW1	23072	.	GRCh37	7	43324597	43324598	+	Intron	INS	-	-	T	rs55642652		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.28-26752dup			ENST00000395891		4	.	4	0	.	0	HECW1,intron_variant,,ENST00000395891,NM_015052.3;HECW1,intron_variant,,ENST00000453890,NM_001287059.1;HECW1,intron_variant,,ENST00000464944,;HECW1,intron_variant,,ENST00000490954,;HECW1,intron_variant,,ENST00000492310,;	T	ENSG00000002746	ENST00000395891	Transcript	intron_variant						rs55642652	1		1	HECW1	HGNC	22195	protein_coding	YES	CCDS5469.2	ENSP00000379228	Q76N89	A4D1V5	UPI0000D74C41	NM_015052.3				3/29			0.3608	0.2666		0.0675	0.3469	0.1963										MODIFIER	1	insertion														.	GAT	.	.																					43324597
Unknown	0	.	GRCh37	7	44383401	44383401	+	IGR	DEL	G	G	-	rs372434146		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					3	.	3	0	.	0		-				intergenic_variant						rs372434146	1																																			MODIFIER	1	deletion														.	AAGA	.	.																					44383400
Unknown	0	.	GRCh37	7	50891444	50891444	+	IGR	DEL	T	T	-	rs35570351		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					5	.	5	0	.	0		-				intergenic_variant						rs35570351	1																				0.1596	0.7594		0.7877	0.838	0.7935										MODIFIER	1	deletion														.	TATT	.	.																					50891443
Unknown	0	.	GRCh37	7	51802799	51802800	+	IGR	INS	-	-	C	rs71024620		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		C				intergenic_variant						rs71024620	1																				0.8381	0.7867		0.7361	0.8419	0.7812										MODIFIER	1	insertion														.	CAC	.	.																					51802799
POM121L12	285877	.	GRCh37	7	53107473	53107475	+	3'Flank	DEL	ATA	ATA	-	rs57273324		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATA	ATA																			ENST00000408890		3	.	3	0	.	0	POM121L12,downstream_gene_variant,,ENST00000408890,NM_182595.3;	-	ENSG00000221900	ENST00000408890	Transcript	downstream_gene_variant						rs57273324	1	2856	1	POM121L12	HGNC	25369	protein_coding	YES	CCDS43584.1	ENSP00000386133	Q8N7R1		UPI00001B6540	NM_182595.3							0.1581	0.2421		0.4315	0.2982	0.4714										MODIFIER	1	deletion														.	AGATAA	.	.																					53107472
GS1-179L18.1	401337	.	GRCh37	7	53875114	53875115	+	Intron	INS	-	-	A	rs58792281		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.424+4086dup			ENST00000380970		3	.	3	0	.	0	GS1-179L18.1,intron_variant,,ENST00000380970,;	A	ENSG00000205628	ENST00000380970	Transcript	intron_variant,non_coding_transcript_variant						rs58792281	1		-1	GS1-179L18.1	Clone_based_vega_gene		lincRNA	YES										1/5																		MODIFIER	1	insertion														.	TCA	.	.																					53875114
Unknown	0	.	GRCh37	7	57413384	57413384	+	IGR	DEL	T	T	-	rs34046586		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs34046586	1																				0.3926	0.5043		0.5546	0.3618	0.5777										MODIFIER	1	deletion														.	GATT	.	.																					57413383
Unknown	0	.	GRCh37	7	61755271	61755272	+	IGR	INS	-	-	G	rs143086106		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					9	6	3	8	0	0		G				intergenic_variant						rs143086106	1																																			MODIFIER	1	insertion														.	ATG	.	.																					61755271
RP5-905H7.3	0	.	GRCh37	7	62705305	62705305	+	5'Flank	DEL	T	T	-	rs57242985		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000451381		3	.	3	0	.	0	RP5-905H7.3,upstream_gene_variant,,ENST00000451381,;SEPT7P4,intron_variant,,ENST00000437076,;	-	ENSG00000244550	ENST00000451381	Transcript	upstream_gene_variant						rs57242985	1	3282	-1	RP5-905H7.3	Clone_based_vega_gene		processed_transcript	YES																												MODIFIER		deletion														.	TATT	.	.																					62705304
RP11-561N12.2	0	.	GRCh37	7	63465800	63465804	+	5'Flank	DEL	TCTTT	TCTTT	-	rs56208372		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCTTT	TCTTT																			ENST00000330020		6	4	2	13	0	0	RP11-561N12.2,upstream_gene_variant,,ENST00000330020,;	-	ENSG00000241149	ENST00000330020	Transcript	upstream_gene_variant						rs56208372	1	150	1	RP11-561N12.2	Clone_based_vega_gene		unprocessed_pseudogene	YES													0.6331	0.6916		0.4583	0.7614	0.6053										MODIFIER	1	deletion														.	TCTCTTTT	.	.																					63465799
RP11-321E8.4	0	.	GRCh37	7	63601118	63601119	+	Intron	INS	-	-	AG	rs34563201		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.29+218_29+219insGA			ENST00000442436		3	.	3	0	.	0	RP11-321E8.4,intron_variant,,ENST00000442436,;GUSBP6,intron_variant,,ENST00000434932,;RP11-165H4.2,downstream_gene_variant,,ENST00000454924,;	AG	ENSG00000229881	ENST00000442436	Transcript	intron_variant,non_coding_transcript_variant						rs34563201	1		1	RP11-321E8.4	Clone_based_vega_gene		lincRNA	YES										1/2			0.5068	0.4856		0.6498	0.3499	0.3978										MODIFIER	1	insertion														.	ACA	.	.																					63601118
RP11-561N12.1	0	.	GRCh37	7	64043695	64043696	+	3'Flank	INS	-	-	GGC	rs57077555		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000414815		12	.	7	9	.	3	RP11-561N12.1,downstream_gene_variant,,ENST00000414815,;	GGC	ENSG00000224669	ENST00000414815	Transcript	downstream_gene_variant						rs57077555	1	110	1	RP11-561N12.1	Clone_based_vega_gene		processed_pseudogene	YES													0.0809	0.1196			0.0875	0.0501										MODIFIER	1	insertion														.	GGG	.	.																					64043695
TPST1	8460	.	GRCh37	7	65831235	65831236	+	Intron	INS	-	-	T	rs988822741		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.99+9390dup			ENST00000490159		3	.	3	0	.	0	TPST1,intron_variant,,ENST00000490159,;	T	ENSG00000169902	ENST00000490159	Transcript	intron_variant,non_coding_transcript_variant						rs988822741	1		1	TPST1	HGNC	12020	processed_transcript											2/2																		MODIFIER	1	insertion														.	AAT	.	.																					65831235
SBDS	51119	.	GRCh37	7	66455007	66455008	+	Intron	INS	-	-	T	rs71293171		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.624+1116dup			ENST00000246868		3	.	3	0	.	0	SBDS,intron_variant,,ENST00000246868,NM_016038.2;SBDS,intron_variant,,ENST00000414306,;SBDS,downstream_gene_variant,,ENST00000463579,;SBDS,downstream_gene_variant,,ENST00000490953,;	T	ENSG00000126524	ENST00000246868	Transcript	intron_variant						rs71293171	1		-1	SBDS	HGNC	19440	protein_coding	YES	CCDS5537.1	ENSP00000246868	Q9Y3A5		UPI000013559C	NM_016038.2				4/4																		MODIFIER	1	insertion													1	.	TCT	.	.																					66455007
Unknown	0	.	GRCh37	7	67882889	67882890	+	IGR	INS	-	-	CTCTCTTAAGCCCCTCCT	rs55752035		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		CTCTCTTAAGCCCCTCCT				intergenic_variant						rs55752035	1																				0.7292	0.9568		0.9385	0.9592	0.9703										MODIFIER	1	insertion														.	CCC	.	.																					67882889
AUTS2	26053	.	GRCh37	7	69174038	69174038	+	Intron	DEL	T	T	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.309+109091del			ENST00000342771		6	4	2	4	4	0	AUTS2,intron_variant,,ENST00000342771,NM_015570.2;AUTS2,intron_variant,,ENST00000403018,NM_001127232.1;AUTS2,intron_variant,,ENST00000406775,NM_001127231.1;,regulatory_region_variant,,ENSR00001398436,;,regulatory_region_variant,,ENSR00001398437,;	-	ENSG00000158321	ENST00000342771	Transcript	intron_variant							1		1	AUTS2	HGNC	14262	protein_coding	YES	CCDS5539.1	ENSP00000344087	Q8WXX7	Q75MQ7,Q75MQ4,Q75MQ3,Q75MD7	UPI0000126665	NM_015570.2				1/18																		MODIFIER	1	deletion													1	.	TGTT	.	.																					69174037
WBSCR17	64409	.	GRCh37	7	70713965	70713965	+	Intron	DEL	T	T	-	rs5884828		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.239-86570del			ENST00000333538		4	.	4	0	.	0	WBSCR17,intron_variant,,ENST00000333538,NM_022479.2;,regulatory_region_variant,,ENSR00001398813,;	-	ENSG00000185274	ENST00000333538	Transcript	intron_variant						rs5884828	1		1	WBSCR17	HGNC	16347	protein_coding	YES	CCDS5540.1	ENSP00000329654	Q6IS24	Q68CW8,Q2L4S5,B3KRD2	UPI00000502D5	NM_022479.2				1/10																		MODIFIER	1	deletion														.	TGTT	.	.																					70713964
CACNA2D1	781	.	GRCh37	7	81805252	81805252	+	Intron	DEL	A	A	-	rs10709904		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.295-5327del			ENST00000356860		3	.	3	0	.	0	CACNA2D1,intron_variant,,ENST00000356253,;CACNA2D1,intron_variant,,ENST00000356860,NM_000722.2;CACNA2D1,intron_variant,,ENST00000423588,;CACNA2D1,intron_variant,,ENST00000484706,;,regulatory_region_variant,,ENSR00001728529,;	-	ENSG00000153956	ENST00000356860	Transcript	intron_variant						rs10709904	1		-1	CACNA2D1	HGNC	1399	protein_coding	YES	CCDS5598.1	ENSP00000349320	P54289	Q9UDU5,Q9UDQ3,Q9UDL7,O95026	UPI00003674CD	NM_000722.2				3/38			0.5098	0.1628		0.1944	0.0586	0.1401										MODIFIER	1	deletion													1	.	TGAA	.	.																					81805251
PCLO	27445	.	GRCh37	7	82789870	82789870	+	Intron	DEL	A	A	-	rs11309799		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.248+1791del			ENST00000333891		3	.	3	0	.	0	PCLO,intron_variant,,ENST00000333891,NM_033026.5;PCLO,intron_variant,,ENST00000423517,NM_014510.2;	-	ENSG00000186472	ENST00000333891	Transcript	intron_variant						rs11309799	1		-1	PCLO	HGNC	13406	protein_coding	YES	CCDS47630.1	ENSP00000334319	Q9Y6V0		UPI0001573469	NM_033026.5				1/24		0.1390	0.1067	0.1744		0.0685	0.2793	0.0859										MODIFIER	1	deletion													1	.	TTAT	.	.																					82789869
Unknown	0	.	GRCh37	7	85482012	85482012	+	IGR	DEL	A	A	-	rs35386370		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					5	.	5	0	.	0		-				intergenic_variant						rs35386370	1																				0.3374	0.4986		0.879	0.4046	0.7004										MODIFIER	1	deletion														.	TTAA	.	.																					85482011
ENSR00000214831	0	.	GRCh37	7	87945280	87945281	+	IGR	INS	-	ACTC	ACTC	rs57080345		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00000214831		6	.	0	3	.	2	,regulatory_region_variant,,ENSR00000214831,;	ACTC		ENSR00000214831	RegulatoryFeature	regulatory_region_variant						rs57080345	1																																			MODIFIER	1	insertion														.	TTA	.	.																					87945280
CDK14	5218	.	GRCh37	7	90304714	90304715	+	Intron	INS	-	-	T	rs11397070		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.124-51158dup			ENST00000380050		3	.	3	0	.	0	CDK14,intron_variant,,ENST00000380050,NM_001287137.1,NM_001287135.1;CDK14,intron_variant,,ENST00000430760,;CDK14,intron_variant,,ENST00000446224,;CDK14,intron_variant,,ENST00000449528,;CDK14,intron_variant,,ENST00000456689,;CDK14,intron_variant,,ENST00000484035,;	T	ENSG00000058091	ENST00000380050	Transcript	intron_variant						rs11397070	1		1	CDK14	HGNC	8883	protein_coding			ENSP00000369390	O94921	C9JWL6,C9IYJ9	UPI000013EAF4	NM_001287137.1,NM_001287135.1				2/14			0.8359	0.879		0.9058	0.8231	0.8211										MODIFIER	1	insertion														.	GAT	.	.																					90304714
RN7SKP129	0	.	GRCh37	7	94433957	94433957	+	3'Flank	DEL	A	A	-	rs569590281		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000410288		3	.	3	0	.	0	RN7SKP129,downstream_gene_variant,,ENST00000410288,;	-	ENSG00000222220	ENST00000410288	Transcript	downstream_gene_variant						rs569590281	1	2833	1	RN7SKP129	HGNC	45853	misc_RNA	YES																												MODIFIER	1	deletion														.	TGAA	.	.																					94433956
Unknown	0	.	GRCh37	7	97720995	97720995	+	IGR	DEL	T	T	-	rs55808403		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	4	0	.	0		-				intergenic_variant						rs55808403	1																				0.7572	0.9553		0.9663	0.9791	0.956										MODIFIER	1	deletion														.	CCTT	.	.																					97720994
ZAN	7455	.	GRCh37	7	100327197	100327197	+	5'Flank	DEL	A	A	-	rs199783394		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000546292		4	.	4	0	.	0	ZAN,upstream_gene_variant,,ENST00000538115,;ZAN,upstream_gene_variant,,ENST00000542585,NM_003386.1;ZAN,upstream_gene_variant,,ENST00000546213,;ZAN,upstream_gene_variant,,ENST00000546292,NM_173059.1;ZAN,upstream_gene_variant,,ENST00000348028,;ZAN,upstream_gene_variant,,ENST00000349350,;ZAN,upstream_gene_variant,,ENST00000421100,;ZAN,upstream_gene_variant,,ENST00000427578,;ZAN,upstream_gene_variant,,ENST00000443370,;ZAN,upstream_gene_variant,,ENST00000449052,;	-	ENSG00000146839	ENST00000546292	Transcript	upstream_gene_variant						rs199783394	1	4447	1	ZAN	HGNC	12857	protein_coding	YES		ENSP00000445943		F5H0T8	UPI00004575C6	NM_173059.1																						MODIFIER	1	deletion														.	ATAA	.	.																					100327196
CUX1	1523	.	GRCh37	7	101900586	101900587	+	3'UTR	INS	-	-	T	rs35391223		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.*8275dup			ENST00000360264	24/24	3	.	3	0	.	0	CUX1,3_prime_UTR_variant,,ENST00000360264,NM_001202543.1;CUX1,3_prime_UTR_variant,,ENST00000292535,NM_181552.3;CUX1,intron_variant,,ENST00000292538,NM_001913.3;CUX1,intron_variant,,ENST00000393824,NM_001202546.1;CUX1,intron_variant,,ENST00000425244,NM_001202545.1;CUX1,intron_variant,,ENST00000437600,NM_181500.2;CUX1,intron_variant,,ENST00000547394,NM_001202544.1;CUX1,intron_variant,,ENST00000558836,;CUX1,intron_variant,,ENST00000560541,;	T	ENSG00000257923	ENST00000360264	Transcript	3_prime_UTR_variant	12835-12836/13762					rs35391223	1		1	CUX1	HGNC	2557	protein_coding	YES	CCDS56498.1	ENSP00000353401	P39880		UPI00001AEB98	NM_001202543.1			24/24				0.1331	0.2233		0.0437	0.174	0.092										MODIFIER	1	insertion													1	.	CCT	.	.																					101900586
LHFPL3	375612	.	GRCh37	7	104304763	104304764	+	Intron	INS	-	-	A	rs11434136		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.481+41300dup			ENST00000535008		3	.	3	0	.	0	LHFPL3,intron_variant,,ENST00000401970,;LHFPL3,intron_variant,,ENST00000424859,NM_199000.2;LHFPL3,intron_variant,,ENST00000535008,;LHFPL3,intron_variant,,ENST00000543266,;EIF4BP6,upstream_gene_variant,,ENST00000431936,;	A	ENSG00000187416	ENST00000535008	Transcript	intron_variant						rs11434136	1		1	LHFPL3	HGNC	6589	protein_coding	YES		ENSP00000444350		F5GZM2	UPI0002065540					3/4			0.7632	0.9813		0.9881	0.9891	0.9888										MODIFIER	1	insertion														.	ATA	.	.																					104304763
Unknown	0	.	GRCh37	7	105812232	105812233	+	IGR	INS	-	-	T	rs5886383		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs5886383	1																				0.615	0.2594		0.0546	0.33	0.1636										MODIFIER	1	insertion														.	CCT	.	.																					105812232
Unknown	0	.	GRCh37	7	109766459	109766462	+	IGR	DEL	AGAC	AGAC	-	rs149002978		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGAC	AGAC																					5	.	3	3	.	0		-				intergenic_variant						rs149002978	1																					0.0014			0.008											MODIFIER	1	deletion														.	TTAGACA	.	.																					109766458
TMEM168	64418	.	GRCh37	7	112434170	112434171	+	5'Flank	DEL	GT	GT	-	rs3082862		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																			ENST00000312814		3	.	3	0	.	0	TMEM168,upstream_gene_variant,,ENST00000312814,NM_001287497.1,NM_022484.5;TMEM168,upstream_gene_variant,,ENST00000441474,;TMEM168,upstream_gene_variant,,ENST00000447395,;TMEM168,upstream_gene_variant,,ENST00000449743,;TMEM168,upstream_gene_variant,,ENST00000454074,;	-	ENSG00000146802	ENST00000312814	Transcript	upstream_gene_variant						rs3082862	1	3523	-1	TMEM168	HGNC	25826	protein_coding	YES	CCDS5757.1	ENSP00000323068	Q9H0V1	C9JVE9,C9IZT1,B4DDS0	UPI000004DACB	NM_001287497.1,NM_022484.5							0.1732	0.5159		0.7232	0.5994	0.4243										MODIFIER	1	deletion														.	GGGTG	.	.																					112434169
POT1	25913	.	GRCh37	7	124464910	124464913	+	Intron	DEL	TAGT	TAGT	-	rs79646733		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAGT	TAGT																c.1792+393_1792+396del			ENST00000357628		3	.	3	0	.	0	POT1,intron_variant,,ENST00000357628,NM_015450.2;POT1,intron_variant,,ENST00000393329,NM_001042594.1;POT1,intron_variant,,ENST00000436534,;POT1,intron_variant,,ENST00000430927,;POT1,intron_variant,,ENST00000607932,;POT1,intron_variant,,ENST00000608057,;POT1,intron_variant,,ENST00000609106,;	-	ENSG00000128513	ENST00000357628	Transcript	intron_variant						rs79646733	1		-1	POT1	HGNC	17284	protein_coding	YES	CCDS5793.1	ENSP00000350249	Q9NUX5	C9JPG9,A8MTK3	UPI0000073E3F	NM_015450.2				18/18			0.2557	0.4294		0.4891	0.4414	0.3824										MODIFIER	1	deletion													1	.	ACTAGTT	.	.																					124464909
POT1-AS1	0	.	GRCh37	7	124774878	124774878	+	Intron	DEL	A	A	-	rs79909947		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																n.1314-3748del			ENST00000453342		3	.	3	0	.	0	POT1-AS1,intron_variant,,ENST00000435452,;POT1-AS1,intron_variant,,ENST00000449642,;POT1-AS1,intron_variant,,ENST00000453342,;	-	ENSG00000224897	ENST00000453342	Transcript	intron_variant,non_coding_transcript_variant						rs79909947	1		1	POT1-AS1	HGNC	49459	antisense	YES										9/10			0.289	0.219		0.3532	0.3221	0.1902										MODIFIER	1	deletion														.	CCAA	.	.																					124774877
Unknown	0	.	GRCh37	7	125249167	125249170	+	IGR	DEL	AATC	AATC	-	rs151280400		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AATC	AATC																					3	.	3	0	.	0		-				intergenic_variant						rs151280400	1																				0.0711	0.464		0.6131	0.3648	0.6022										MODIFIER	1	deletion														.	TTAATCA	.	.																					125249166
Unknown	0	.	GRCh37	7	127774680	127774680	+	IGR	DEL	A	A	-	rs56242362		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					6	.	6	0	.	0		-				intergenic_variant						rs56242362	1																																			MODIFIER	1	deletion														.	TCAA	.	.																					127774679
NRF1	4899	.	GRCh37	7	129397839	129397842	+	3'Flank	DEL	TGCT	TGCT	-	rs35246716		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGCT	TGCT																			ENST00000393232		4	.	4	0	.	0	NRF1,downstream_gene_variant,,ENST00000223190,;NRF1,downstream_gene_variant,,ENST00000311967,;NRF1,downstream_gene_variant,,ENST00000353868,;NRF1,downstream_gene_variant,,ENST00000393230,NM_001040110.1;NRF1,downstream_gene_variant,,ENST00000393231,;NRF1,downstream_gene_variant,,ENST00000393232,NM_005011.3;NRF1,downstream_gene_variant,,ENST00000539636,;RNA5SP244,downstream_gene_variant,,ENST00000390936,;	-	ENSG00000106459	ENST00000393232	Transcript	downstream_gene_variant						rs35246716	1	919	1	NRF1	HGNC	7996	protein_coding	YES	CCDS5813.2	ENSP00000376924	Q16656	C9JP85,B4DDV6	UPI000003BB3B	NM_005011.3							0.4017	0.6844		0.7946	0.6978	0.6043										MODIFIER	1	deletion														.	AATGCTT	.	.																					129397838
COPG2	26958	.	GRCh37	7	130292119	130292120	+	3'Flank	INS	-	-	ATAAATAA	rs5887469		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000445977		10	.	6	4	.	0	COPG2,downstream_gene_variant,,ENST00000330992,;COPG2,downstream_gene_variant,,ENST00000445977,;RNA5SP246,upstream_gene_variant,,ENST00000458909,;	ATAAATAA	ENSG00000158623	ENST00000445977	Transcript	downstream_gene_variant						rs5887469	1	3700	-1	COPG2	HGNC	2237	protein_coding	YES		ENSP00000393912		F6X838	UPI0000457604								0.6551	0.8271		0.8085	0.7266	0.6718										MODIFIER	1	insertion														.	TCA	.	.																					130292119
Unknown	0	.	GRCh37	7	132805576	132805577	+	IGR	INS	-	-	A	rs5887612		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		A				intergenic_variant						rs5887612	1																				0.3192	0.4424		0.3423	0.4165	0.3303										MODIFIER	1	insertion														.	TCA	.	.																					132805576
TBXAS1	6916	.	GRCh37	7	139501269	139501270	+	Intron	INS	-	-	T	rs56097281		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-77+14053dup			ENST00000263552		4	.	3	4	.	0	TBXAS1,intron_variant,,ENST00000263552,NM_001130966.2;TBXAS1,intron_variant,,ENST00000336425,;TBXAS1,intron_variant,,ENST00000425687,NM_001166254.1;TBXAS1,intron_variant,,ENST00000438104,;TBXAS1,downstream_gene_variant,,ENST00000462053,;TBXAS1,downstream_gene_variant,,ENST00000474763,;TBXAS1,downstream_gene_variant,,ENST00000481440,;	T	ENSG00000059377	ENST00000263552	Transcript	intron_variant						rs56097281	1		1	TBXAS1	HGNC	11609	protein_coding		CCDS5855.1	ENSP00000263552	P24557	Q9UDV3,Q86UL7,F8WD37,C9JS68	UPI000013D421	NM_001130966.2				4/16			0.5772	0.7118		0.9325	0.5427	0.7771										MODIFIER	1	insertion													1	.	CCT	.	.																					139501269
DENND2A	27147	.	GRCh37	7	140231622	140231623	+	Intron	INS	-	-	AAC	rs60323045		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2328-4330_2328-4328dup			ENST00000275884		4	.	4	0	.	0	DENND2A,intron_variant,,ENST00000275884,;DENND2A,intron_variant,,ENST00000469373,;DENND2A,intron_variant,,ENST00000496613,;DENND2A,intron_variant,,ENST00000537639,NM_015689.3;DENND2A,intron_variant,,ENST00000461883,;	AAC	ENSG00000146966	ENST00000275884	Transcript	intron_variant						rs60323045	1		-1	DENND2A	HGNC	22212	protein_coding	YES	CCDS43659.1	ENSP00000275884	Q9ULE3	C9JD15,C9JAA0,C9IYZ8,C9IY76	UPI00001C1E63					13/18			0.7012	0.964		0.9881	0.9811	0.9785										MODIFIER	1	insertion														.	AAA	.	.																					140231622
EPHA1	2041	.	GRCh37	7	143094328	143094329	+	Intron	DEL	AC	AC	-	rs146724598		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																c.1771+68_1771+69del			ENST00000275815		6	4	2	4	4	0	EPHA1,intron_variant,,ENST00000275815,NM_005232.4;EPHA1,intron_variant,,ENST00000488068,;EPHA1,upstream_gene_variant,,ENST00000465208,;EPHA1,downstream_gene_variant,,ENST00000479459,;EPHA1,upstream_gene_variant,,ENST00000494989,;EPHA1,downstream_gene_variant,,ENST00000497891,;	-	ENSG00000146904	ENST00000275815	Transcript	intron_variant						rs146724598	1		-1	EPHA1	HGNC	3385	protein_coding	YES	CCDS5884.1	ENSP00000275815	P21709		UPI000013DA82	NM_005232.4				10/17																		MODIFIER	1	deletion														.	CAACA	.	.																					143094327
CNTNAP2	26047	.	GRCh37	7	146402711	146402712	+	Intron	INS	-	-	C	rs11427461		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.98-68650dup			ENST00000361727		5	.	5	0	.	0	CNTNAP2,intron_variant,,ENST00000361727,NM_014141.5;	C	ENSG00000174469	ENST00000361727	Transcript	intron_variant						rs11427461	1		1	CNTNAP2	HGNC	13830	protein_coding	YES	CCDS5889.1	ENSP00000354778	Q9UHC6	Q9UDV4,Q96T77,Q86UL9,Q86UL6,Q86UL4,Q86UJ1,Q86UI8,Q75MQ9,Q75MF8,Q75MF6,Q75MD4,Q75MA1,Q75M92,Q75LG9,O75852,B7Z1Y6	UPI00001285FA	NM_014141.5				1/23																		MODIFIER	1	insertion													1	.	GTC	.	.																					146402711
CNTNAP2	26047	.	GRCh37	7	147403273	147403274	+	Intron	INS	-	-	T	rs767715009		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2098+66891dup			ENST00000361727		3	.	3	0	.	0	CNTNAP2,intron_variant,,ENST00000361727,NM_014141.5;CNTNAP2,intron_variant,,ENST00000455301,;RP4-777G9.1,upstream_gene_variant,,ENST00000603254,;	T	ENSG00000174469	ENST00000361727	Transcript	intron_variant						rs767715009	1		1	CNTNAP2	HGNC	13830	protein_coding	YES	CCDS5889.1	ENSP00000354778	Q9UHC6	Q9UDV4,Q96T77,Q86UL9,Q86UL6,Q86UL4,Q86UJ1,Q86UI8,Q75MQ9,Q75MF8,Q75MF6,Q75MD4,Q75MA1,Q75M92,Q75LG9,O75852,B7Z1Y6	UPI00001285FA	NM_014141.5				13/23																		MODIFIER	1	insertion													1	.	GGT	.	.																					147403273
CNTNAP2	26047	.	GRCh37	7	147960235	147960236	+	Intron	INS	-	-	ATTA	rs3057300		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.3382-3890_3382-3889insATTA			ENST00000361727		3	.	3	0	.	0	CNTNAP2,intron_variant,,ENST00000361727,NM_014141.5;CNTNAP2,intron_variant,,ENST00000538075,;,regulatory_region_variant,,ENSR00001734558,;,regulatory_region_variant,,ENSR00001734559,;	ATTA	ENSG00000174469	ENST00000361727	Transcript	intron_variant						rs3057300	1		1	CNTNAP2	HGNC	13830	protein_coding	YES	CCDS5889.1	ENSP00000354778	Q9UHC6	Q9UDV4,Q96T77,Q86UL9,Q86UL6,Q86UL4,Q86UJ1,Q86UI8,Q75MQ9,Q75MF8,Q75MF6,Q75MD4,Q75MA1,Q75M92,Q75LG9,O75852,B7Z1Y6	UPI00001285FA	NM_014141.5				20/23		0.1044	0.2632	0.0663		0.0218	0.0646	0.0429										MODIFIER	1	insertion													1	.	TTG	.	.																					147960235
ABCF2	10061	.	GRCh37	7	150918587	150918587	+	Intron	DEL	T	T	-	rs376711339		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.921+77del			ENST00000222388		27	.	3	24	.	0	ABCF2,intron_variant,,ENST00000222388,NM_005692.4;ABCF2,intron_variant,,ENST00000287844,NM_007189.2;ABCF2,downstream_gene_variant,,ENST00000441774,;ABCF2,downstream_gene_variant,,ENST00000468073,;ABCF2,intron_variant,,ENST00000473874,;ABCF2,downstream_gene_variant,,ENST00000477252,;	-	ENSG00000033050	ENST00000222388	Transcript	intron_variant						rs376711339	1		-1	ABCF2	HGNC	71	protein_coding	YES	CCDS5922.1	ENSP00000222388		Q75MJ1,C9JZV3,C9JHK9	UPI000004C4C9	NM_005692.4				7/15																		MODIFIER	1	deletion														.	CCTT	.	.																					150918586
PRKAG2	51422	.	GRCh37	7	151498507	151498508	+	Intron	INS	-	-	T	rs5888452		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.115-14881_115-14880insA			ENST00000287878		5	.	5	0	.	0	PRKAG2,intron_variant,,ENST00000287878,NM_016203.3;PRKAG2,intron_variant,,ENST00000392801,NM_001040633.1;PRKAG2,intron_variant,,ENST00000481434,;PRKAG2,intron_variant,,ENST00000488258,;	T	ENSG00000106617	ENST00000287878	Transcript	intron_variant						rs5888452	1		-1	PRKAG2	HGNC	9386	protein_coding	YES	CCDS5928.1	ENSP00000287878	Q9UGJ0	C9JUG1	UPI00001250B5	NM_016203.3				1/15		0.6881	0.8442	0.5879		0.6687	0.6938	0.5624										MODIFIER	1	insertion													1	.	CCA	.	.																					151498507
PRKAG2	51422	.	GRCh37	7	151552201	151552205	+	Intron	DEL	ACACA	ACACA	CACA	rs1554618727		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACA	ACACA																c.114+21391del			ENST00000287878		105	92	13	42	0	0	PRKAG2,intron_variant,,ENST00000287878,NM_016203.3;PRKAG2,intron_variant,,ENST00000474383,;PRKAG2,intron_variant,,ENST00000481434,;PRKAG2,intron_variant,,ENST00000488258,;,regulatory_region_variant,,ENSR00001735016,;	ACCACA	ENSG00000106617	ENST00000287878	Transcript	intron_variant						rs1554618727	2		-1	PRKAG2	HGNC	9386	protein_coding	YES	CCDS5928.1	ENSP00000287878	Q9UGJ0	C9JUG1	UPI00001250B5	NM_016203.3				1/15									0.06166	0.04696								MODIFIER	1	sequence_alteration													1	.	CTACACACAC	.	.																					151552198
KMT2C	58508	.	GRCh37	7	152068471	152068472	+	Intron	INS	-	-	A	rs143452702		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.162-12712dup			ENST00000262189		3	.	3	0	.	0	KMT2C,intron_variant,,ENST00000262189,NM_170606.2;KMT2C,intron_variant,,ENST00000355193,;KMT2C,intron_variant,,ENST00000452749,;KMT2C,intron_variant,,ENST00000558084,;SEPT7P6,downstream_gene_variant,,ENST00000469999,;RP11-208G20.2,downstream_gene_variant,,ENST00000472406,;RP11-208G20.3,downstream_gene_variant,,ENST00000603054,;,regulatory_region_variant,,ENSR00001735078,;	A	ENSG00000055609	ENST00000262189	Transcript	intron_variant						rs143452702	1		-1	KMT2C	HGNC	13726	protein_coding	YES	CCDS5931.1	ENSP00000262189	Q8NEZ4	Q6N019,Q75MN6,H0YMU7	UPI0000141B9F	NM_170606.2				1/58			0.0068	0.0504			0.0984	0.0215										MODIFIER	1	insertion													1	.	ATA	.	.																					152068471
KMT2C	58508	.	GRCh37	7	152115947	152115947	+	Intron	DEL	A	A	-	rs113222244		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.161+16764del			ENST00000262189		4	.	4	0	.	0	KMT2C,intron_variant,,ENST00000262189,NM_170606.2;KMT2C,intron_variant,,ENST00000355193,;KMT2C,intron_variant,,ENST00000452749,;KMT2C,intron_variant,,ENST00000558084,;,regulatory_region_variant,,ENSR00001735095,;	-	ENSG00000055609	ENST00000262189	Transcript	intron_variant						rs113222244	1		-1	KMT2C	HGNC	13726	protein_coding	YES	CCDS5931.1	ENSP00000262189	Q8NEZ4	Q6N019,Q75MN6,H0YMU7	UPI0000141B9F	NM_170606.2				1/58			0.3064	0.1484		0.1161	0.0596	0.1431										MODIFIER	1	deletion													1	.	ACAA	.	.																					152115946
ACTR3B	57180	.	GRCh37	7	152498092	152498092	+	Intron	DEL	T	T	-	rs368430946		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.225+362del			ENST00000256001		9	.	5	5	.	0	ACTR3B,intron_variant,,ENST00000256001,NM_020445.5;ACTR3B,intron_variant,,ENST00000377776,NM_001040135.2;ACTR3B,intron_variant,,ENST00000397282,;ACTR3B,intron_variant,,ENST00000537264,;ACTR3B,intron_variant,,ENST00000488782,;	-	ENSG00000133627	ENST00000256001	Transcript	intron_variant						rs368430946	1		1	ACTR3B	HGNC	17256	protein_coding	YES	CCDS5934.1	ENSP00000256001	Q9P1U1	C9J580,B3KM55	UPI0000073AC7	NM_020445.5				3/11			0.2761	0.438		0.4623	0.4394	0.4642										MODIFIER	1	deletion														.	ACTT	.	.																					152498091
DPP6	1804	.	GRCh37	7	154103515	154103516	+	Intron	DEL	CA	CA	-	rs10610650		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CA	CA																c.244-39767_244-39766del			ENST00000377770		3	.	3	0	.	0	DPP6,intron_variant,,ENST00000332007,;DPP6,intron_variant,,ENST00000377770,;DPP6,intron_variant,,ENST00000404039,NM_130797.2,NM_001936.3,NM_001039350.1;DPP6,intron_variant,,ENST00000406326,;DPP6,intron_variant,,ENST00000427557,;DPP6,intron_variant,,ENST00000496611,;DPP6,intron_variant,,ENST00000462622,;	-	ENSG00000130226	ENST00000377770	Transcript	intron_variant						rs10610650	1		1	DPP6	HGNC	3010	protein_coding	YES		ENSP00000367001	P42658	Q75MI8,Q75MI7,Q75MF0	UPI00001AE746					1/25			0.7791	0.9467		0.9881	0.9453	0.9908										MODIFIER	1	deletion													1	.	TGCAC	.	.																					154103514
UBE3C	9690	.	GRCh37	7	157047091	157047092	+	Intron	INS	-	-	ATTA	rs138121126		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2950+90_2950+91insAATT			ENST00000348165		5	.	5	0	.	0	UBE3C,intron_variant,,ENST00000348165,NM_014671.2;UBE3C,intron_variant,,ENST00000470408,;UBE3C,upstream_gene_variant,,ENST00000474153,;	ATTA	ENSG00000009335	ENST00000348165	Transcript	intron_variant						rs138121126	1		1	UBE3C	HGNC	16803	protein_coding	YES	CCDS34789.1	ENSP00000309198	Q15386		UPI000020E72A	NM_014671.2				21/22			0.8094	0.9294		0.9881	0.9364	0.9744										MODIFIER	1	insertion														.	TTA	.	.																					157047091
Unknown	0	.	GRCh37	8	5347901	5347902	+	IGR	INS	-	-	AA	rs112498755		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AA				intergenic_variant						rs112498755	1																				0.5923	0.4107		0.4494	0.4155	0.4969										MODIFIER	1	insertion														.	TGA	.	.																					5347901
MCPH1	79648	.	GRCh37	8	6310917	6310918	+	Intron	INS	-	-	T	rs11459930		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1826-1735dup			ENST00000344683		5	.	5	0	.	0	MCPH1,intron_variant,,ENST00000344683,NM_024596.3;MCPH1,upstream_gene_variant,,ENST00000522020,;	T	ENSG00000147316	ENST00000344683	Transcript	intron_variant						rs11459930	1		1	MCPH1	HGNC	6954	protein_coding	YES	CCDS43689.1	ENSP00000342924		Q6W7E5,Q6RBX4,Q6RBQ8,Q6RBJ2,Q6RBC6,Q6RB60,Q6RAZ4,Q6RAP8,Q6RAB6,Q6RA50	UPI000020FF7E	NM_024596.3				8/13			0.2405	0.6009		0.5585	0.5616	0.5501										MODIFIER	1	insertion													1	.	TCT	.	.																					6310917
ANGPT2	285	.	GRCh37	8	6408750	6408751	+	Intron	INS	-	-	T	rs10708602		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.288+11417dup			ENST00000325203		3	.	3	0	.	0	ANGPT2,intron_variant,,ENST00000325203,;ANGPT2,intron_variant,,ENST00000338312,;MCPH1,intron_variant,,ENST00000344683,NM_024596.3;ANGPT2,intron_variant,,ENST00000415216,NM_001147.2,NM_001118888.1,NM_001118887.1;ANGPT2,intron_variant,,ENST00000523120,;MCPH1,intron_variant,,ENST00000519221,;MCPH1,intron_variant,,ENST00000521129,;,regulatory_region_variant,,ENSR00001736187,;	T	ENSG00000091879	ENST00000325203	Transcript	intron_variant						rs10708602	1		-1	ANGPT2	HGNC	485	protein_coding	YES	CCDS5958.1	ENSP00000314897	O15123	Q9H4C0	UPI0000034767					1/8																		MODIFIER		insertion														.	GAT	.	.																					6408750
GFRA2	2675	.	GRCh37	8	21595567	21595567	+	Intron	DEL	A	A	-	rs142006405		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.794+12533del			ENST00000524240		4	.	4	2	.	0	GFRA2,intron_variant,,ENST00000400782,NM_001165039.1,NM_001165038.1;GFRA2,intron_variant,,ENST00000517328,;GFRA2,intron_variant,,ENST00000517892,;GFRA2,intron_variant,,ENST00000518077,;GFRA2,intron_variant,,ENST00000522071,;GFRA2,intron_variant,,ENST00000524240,NM_001495.4;GFRA2,intron_variant,,ENST00000306793,;	-	ENSG00000168546	ENST00000524240	Transcript	intron_variant						rs142006405	1		-1	GFRA2	HGNC	4244	protein_coding	YES	CCDS47816.1	ENSP00000428518	O00451	E5RJ44,E5RGR6	UPI000000D9B1	NM_001495.4				4/8		0.0771	0.1089	0.062		0.0466	0.0845	0.0685										MODIFIER	1	deletion														.	ACAT	.	.																					21595566
ENTPD4	9583	.	GRCh37	8	23300194	23300195	+	Intron	INS	-	-	AA	rs5890111		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.668-617_668-616dup			ENST00000358689		3	.	3	0	.	0	ENTPD4,intron_variant,,ENST00000356206,;ENTPD4,intron_variant,,ENST00000358689,NM_001128930.2,NM_004901.4;ENTPD4,intron_variant,,ENST00000417069,;ENTPD4,intron_variant,,ENST00000519839,;ENTPD4,downstream_gene_variant,,ENST00000518718,;ENTPD4,intron_variant,,ENST00000523958,;ENTPD4,upstream_gene_variant,,ENST00000520936,;	AA	ENSG00000197217	ENST00000358689	Transcript	intron_variant						rs5890111	1		-1	ENTPD4	HGNC	14573	protein_coding	YES	CCDS6041.1	ENSP00000351520	Q9Y227	E5RIB2	UPI0000129FB4	NM_001128930.2,NM_004901.4				6/12																		MODIFIER	1	insertion														.	TCA	.	.																					23300194
RBPMS	11030	.	GRCh37	8	30298311	30298311	+	Intron	DEL	T	T	-	rs34107190		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.67-33970del			ENST00000339877		3	.	3	0	.	0	RBPMS,intron_variant,,ENST00000287771,NM_001008711.2;RBPMS,intron_variant,,ENST00000320203,NM_006867.3;RBPMS,intron_variant,,ENST00000339877,NM_001008712.2;RBPMS,intron_variant,,ENST00000397323,NM_001008710.2;RBPMS,intron_variant,,ENST00000517860,;RBPMS,intron_variant,,ENST00000519647,;RBPMS,intron_variant,,ENST00000520161,;RBPMS,intron_variant,,ENST00000523115,;RBPMS,intron_variant,,ENST00000538486,;RBPMS,upstream_gene_variant,,ENST00000520191,;RBPMS,intron_variant,,ENST00000521816,;RBPMS,upstream_gene_variant,,ENST00000523717,;,regulatory_region_variant,,ENSR00001422833,;	-	ENSG00000157110	ENST00000339877	Transcript	intron_variant						rs34107190	1		1	RBPMS	HGNC	19097	protein_coding	YES	CCDS34876.1	ENSP00000340176	Q93062	E5RJD7,E5RFP4	UPI000002B229	NM_001008712.2				1/6			0.1354	0.3876		0.4246	0.2704	0.2474										MODIFIER	1	deletion														.	ACTT	.	.																					30298310
Unknown	0	.	GRCh37	8	30802830	30802831	+	IGR	INS	-	-	GTGT	rs72113332		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		GTGT				intergenic_variant						rs72113332	1																																			MODIFIER	1	insertion														.	TCG	.	.																					30802830
RP11-317N12.1	0	.	GRCh37	8	33653618	33653618	+	Intron	DEL	A	A	-	rs201521625		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																n.130-193del			ENST00000517292		3	.	3	0	.	0	RP11-317N12.1,intron_variant,,ENST00000517292,;RP11-317N12.1,intron_variant,,ENST00000523063,;,regulatory_region_variant,,ENSR00001423410,;	-	ENSG00000253642	ENST00000517292	Transcript	intron_variant,non_coding_transcript_variant						rs201521625	1		1	RP11-317N12.1	Clone_based_vega_gene		lincRNA											1/1				0.0245			0.0348	0.0041										MODIFIER		deletion														.	TCAA	.	.																					33653617
KCNU1	157855	.	GRCh37	8	36779848	36779849	+	Intron	INS	-	-	A	rs60216672		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2597-150dup			ENST00000399881		19	.	3	23	.	0	KCNU1,intron_variant,,ENST00000399881,NM_001031836.2;KCNU1,intron_variant,,ENST00000522372,;	A	ENSG00000215262	ENST00000399881	Transcript	intron_variant						rs60216672	1		1	KCNU1	HGNC	18867	protein_coding	YES	CCDS55220.1	ENSP00000382770	A8MYU2		UPI0000F079EF	NM_001031836.2				23/26																		MODIFIER	1	insertion														.	AGA	.	.																					36779848
Unknown	0	.	GRCh37	8	49616089	49616090	+	IGR	DEL	CA	CA	-	rs34798159		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CA	CA																					3	.	3	0	.	0		-				intergenic_variant						rs34798159	1																				0.0613	0.4395		0.4107	0.5984	0.4571										MODIFIER	1	deletion														.	AGCAC	.	.																					49616088
LYPLA1	10434	.	GRCh37	8	54983791	54983791	+	Intron	DEL	G	G	-	rs35502878		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.102-5418del			ENST00000316963		3	.	3	0	.	0	LYPLA1,intron_variant,,ENST00000316963,NM_001279357.1,NM_006330.3,NM_001279356.1,NM_001279358.1,NM_001279359.1,NM_001279360.1;LYPLA1,intron_variant,,ENST00000343231,;LYPLA1,intron_variant,,ENST00000518546,;LYPLA1,intron_variant,,ENST00000521352,;LYPLA1,intron_variant,,ENST00000521898,;LYPLA1,intron_variant,,ENST00000522007,;LYPLA1,intron_variant,,ENST00000519272,;LYPLA1,intron_variant,,ENST00000519891,;LYPLA1,intron_variant,,ENST00000519926,;LYPLA1,intron_variant,,ENST00000520896,;LYPLA1,intron_variant,,ENST00000517297,;TDGF1P5,upstream_gene_variant,,ENST00000523009,;,regulatory_region_variant,,ENSR00001740766,;	-	ENSG00000120992	ENST00000316963	Transcript	intron_variant						rs35502878	1		-1	LYPLA1	HGNC	6737	protein_coding	YES	CCDS6157.1	ENSP00000320043	O75608	Q6IAQ1,E5RJ48,B4DJV9	UPI0000072858	NM_001279357.1,NM_006330.3,NM_001279356.1,NM_001279358.1,NM_001279359.1,NM_001279360.1				2/8			0.1664	0.3473		0.7341	0.16	0.5225										MODIFIER	1	deletion														.	CTGG	.	.																					54983790
Unknown	0	.	GRCh37	8	57666986	57666993	+	IGR	DEL	GTGTGTGT	GTGTGTGT	-	rs6150591		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GTGTGTGT	GTGTGTGT																					4	.	4	0	.	0		-				intergenic_variant						rs6150591	1																				0.9402	0.8357		0.9851	0.8509	0.9427										MODIFIER	1	deletion														.	CCGTGTGTGTG	.	.																					57666985
Unknown	0	.	GRCh37	8	61788223	61788224	+	IGR	DEL	GG	GG	-	rs5891781		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GG	GG																					5	.	3	3	.	0		-				intergenic_variant						rs5891781	1																																			MODIFIER	1	deletion														.	TTGGG	.	.																					61788222
NKAIN3	286183	.	GRCh37	8	63317378	63317379	+	Intron	INS	-	-	AGA	rs34922576		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.54+155694_54+155695insAAG			ENST00000523211		5	.	5	0	.	0	NKAIN3,intron_variant,,ENST00000328472,;NKAIN3,intron_variant,,ENST00000523211,NM_173688.2;NKAIN3,intron_variant,,ENST00000524201,;NKAIN3,intron_variant,,ENST00000519049,;NKAIN3,intron_variant,,ENST00000523367,;	AGA	ENSG00000185942	ENST00000523211	Transcript	intron_variant						rs34922576	1		1	NKAIN3	HGNC	26829	protein_coding	YES	CCDS55239.1	ENSP00000429073	Q8N8D7		UPI000006F596	NM_173688.2				1/6			0.1407	0.4395		0.2411	0.5487	0.5307										MODIFIER	1	insertion														.	TCA	.	.																					63317378
NKAIN3	286183	.	GRCh37	8	63737051	63737066	+	Intron	DEL	ACACACACACACACAC	ACACACACACACACAC	-	rs6150612		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACACACACACACAC	ACACACACACACACAC																c.471+77388_471+77403del			ENST00000523211		3	.	3	0	.	0	NKAIN3,intron_variant,,ENST00000328472,;NKAIN3,intron_variant,,ENST00000523211,NM_173688.2;NKAIN3,intron_variant,,ENST00000519049,;NKAIN3,intron_variant,,ENST00000523367,;	-	ENSG00000185942	ENST00000523211	Transcript	intron_variant						rs6150612	1		1	NKAIN3	HGNC	26829	protein_coding	YES	CCDS55239.1	ENSP00000429073	Q8N8D7		UPI000006F596	NM_173688.2				4/6																		MODIFIER	1	deletion														.	CAACACACACACACACACA	.	.																					63737050
PREX2	80243	.	GRCh37	8	68920674	68920676	+	Intron	DEL	AGA	AGA	-	rs5892125		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGA	AGA																c.142-9405_142-9403del			ENST00000288368		3	.	3	0	.	0	PREX2,intron_variant,,ENST00000288368,NM_024870.2,NM_025170.4;PREX2,intron_variant,,ENST00000517617,;PREX2,intron_variant,,ENST00000529398,;	-	ENSG00000046889	ENST00000288368	Transcript	intron_variant						rs5892125	1		1	PREX2	HGNC	22950	protein_coding	YES	CCDS6201.1	ENSP00000288368	Q70Z35	Q56UR8	UPI0000375435	NM_024870.2,NM_025170.4				1/39			0.8782	0.3329		0.1895	0.3042	0.4489										MODIFIER	1	deletion													1	.	AGAGAA	.	.																					68920673
XKR9	389668	.	GRCh37	8	71670512	71670515	+	Intron	DEL	TCTC	TCTC	-	rs80272143		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCTC	TCTC																n.353-31056_353-31053del			ENST00000520273		3	.	3	0	.	0	XKR9,intron_variant,,ENST00000520273,;	-	ENSG00000221947	ENST00000520273	Transcript	intron_variant,non_coding_transcript_variant						rs80272143	1		1	XKR9	HGNC	20937	processed_transcript											2/3			0.0477	0.0461			0.0835	0.0327										MODIFIER	1	deletion														.	GGTCTCT	.	.																					71670511
RP11-758M4.1	0	.	GRCh37	8	75583349	75583350	+	Intron	DEL	GT	GT	-	rs34920389		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																c.74-31243_74-31242del			ENST00000523118		3	.	3	0	.	0	RP11-758M4.1,intron_variant,,ENST00000518190,;RP11-758M4.1,intron_variant,,ENST00000523118,;RP11-758M4.1,intron_variant,,ENST00000523442,;	-	ENSG00000254349	ENST00000523118	Transcript	intron_variant						rs34920389	1		1	RP11-758M4.1	Clone_based_vega_gene		protein_coding	YES		ENSP00000430470		E5RJ19,E5RJ07,E5RIT5	UPI00001405E1					2/5			0.2201	0.2651		0.1131	0.2803	0.2904										MODIFIER	1	deletion														.	ACGTG	.	.																					75583348
HIGD1AP18	0	.	GRCh37	8	77921009	77921010	+	3'Flank	INS	-	-	A	rs11428396		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000520730		3	.	3	0	.	0	HIGD1AP18,downstream_gene_variant,,ENST00000520730,;	A	ENSG00000253952	ENST00000520730	Transcript	downstream_gene_variant						rs11428396	1	4977	-1	HIGD1AP18	HGNC	43013	processed_pseudogene	YES													0.3109	0.5937		0.4802	0.5328	0.5716										MODIFIER	1	insertion														.	GTA	.	.																					77921009
ENSR00001431859	0	.	GRCh37	8	83759093	83759115	+	IGR	DEL	TGATAGTTTAATTTAAGGAAAAA	TGATAGTTTAATTTAAGGAAAAA	-	rs11268160		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGATAGTTTAATTTAAGGAAAAA	TGATAGTTTAATTTAAGGAAAAA																			ENSR00001431859		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001431859,;	-		ENSR00001431859	RegulatoryFeature	regulatory_region_variant						rs11268160	1																				0.3253	0.2695		0.3185	0.2853	0.2321										MODIFIER	1	deletion														.	AGTGATAGTTTAATTTAAGGAAAAAT	.	.																					83759092
RALYL	138046	.	GRCh37	8	85681477	85681478	+	Intron	INS	-	-	T	rs149651525		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.296-5336dup			ENST00000517638		3	.	3	0	.	0	RALYL,intron_variant,,ENST00000517638,NM_001100391.1;RALYL,intron_variant,,ENST00000517988,;RALYL,intron_variant,,ENST00000518566,NM_001287243.1;RALYL,intron_variant,,ENST00000521268,NM_173848.5;RALYL,intron_variant,,ENST00000521376,;RALYL,intron_variant,,ENST00000521695,NM_001100393.1;RALYL,intron_variant,,ENST00000522455,NM_001100392.1;RALYL,intron_variant,,ENST00000523850,NM_001287244.1;	T	ENSG00000184672	ENST00000517638	Transcript	intron_variant						rs149651525	1		1	RALYL	HGNC	27036	protein_coding	YES	CCDS55252.1	ENSP00000430128		G3V129,E5RIX9,E5RG71	UPI00002108E6	NM_001100391.1				2/8			0.1959	0.2161		0.1359	0.2634	0.1605										MODIFIER	1	insertion														.	TCT	.	.																					85681477
CA1	759	.	GRCh37	8	86250862	86250869	+	Intron	DEL	TTTCTTTC	TTTCTTTC	-	rs56255763		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTCTTTC	TTTCTTTC																c.38-191_38-184del			ENST00000523953		10	8	2	21	0	0	CA1,intron_variant,,ENST00000256119,NM_001738.3;CA1,intron_variant,,ENST00000431316,;CA1,intron_variant,,ENST00000432364,NM_001164830.1;CA1,intron_variant,,ENST00000517590,;CA1,intron_variant,,ENST00000517618,;CA1,intron_variant,,ENST00000519129,;CA1,intron_variant,,ENST00000519991,;CA1,intron_variant,,ENST00000520663,;CA1,intron_variant,,ENST00000521846,;CA1,intron_variant,,ENST00000522389,;CA1,intron_variant,,ENST00000522579,;CA1,intron_variant,,ENST00000522662,;CA1,intron_variant,,ENST00000522814,;CA1,intron_variant,,ENST00000523022,NM_001128830.2,NM_001128831.2,NM_001128829.2;CA1,intron_variant,,ENST00000523858,;CA1,intron_variant,,ENST00000523953,;CA1,intron_variant,,ENST00000524324,;CA1,intron_variant,,ENST00000542576,;CA1,upstream_gene_variant,,ENST00000521679,;CA1,intron_variant,,ENST00000518341,;CA1,intron_variant,,ENST00000517429,;CA1,intron_variant,,ENST00000518233,;CA1,intron_variant,,ENST00000520093,;CA1,intron_variant,,ENST00000520990,;CA1,downstream_gene_variant,,ENST00000520692,;CA1,upstream_gene_variant,,ENST00000523712,;	-	ENSG00000133742	ENST00000523953	Transcript	intron_variant						rs56255763	1		-1	CA1	HGNC	1368	protein_coding	YES	CCDS6237.1	ENSP00000430656	P00915	E5RIF9,E5RHS7,E5RHP7,E5RH81,E5RGU8,E5RG43,E5RFL2	UPI000013CEEF					3/8																		MODIFIER	1	deletion														.	TTTTTCTTTCT	.	.																					86250861
AB015752.3	101930237	.	GRCh37	8	91565086	91565087	+	Intron	INS	-	-	A	rs35179051		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.562+1492dup			ENST00000521975		5	.	3	3	.	0	LINC00534,intron_variant,,ENST00000524361,;AB015752.3,intron_variant,,ENST00000521975,;	A	ENSG00000254180	ENST00000521975	Transcript	intron_variant,non_coding_transcript_variant						rs35179051	1		-1	AB015752.3	Clone_based_vega_gene		processed_transcript	YES										4/4																		MODIFIER	1	insertion														.	TGA	.	.																					91565086
LRRC69	100130742	.	GRCh37	8	92188043	92188044	+	Intron	INS	-	-	T	rs11337903		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.652-13695dup			ENST00000448384		3	.	3	0	.	0	LRRC69,intron_variant,,ENST00000343709,;LRRC69,intron_variant,,ENST00000448384,NM_001129890.1;LRRC69,intron_variant,,ENST00000520099,;	T	ENSG00000214954	ENST00000448384	Transcript	intron_variant						rs11337903	1		1	LRRC69	HGNC	34303	protein_coding	YES		ENSP00000400803	Q6ZNQ3	E5RJ66	UPI00006C0DD3	NM_001129890.1				5/7																		MODIFIER	1	insertion														.	AGT	.	.																					92188043
TRIQK	286144	.	GRCh37	8	93971709	93971724	+	Intron	DEL	ACACACACACACACAC	ACACACACACACACAC	-	rs34816958		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACACACACACACAC	ACACACACACACACAC																c.-180-4932_-180-4917del			ENST00000521988		4	.	4	0	.	0	TRIQK,intron_variant,,ENST00000378861,;TRIQK,intron_variant,,ENST00000517751,;TRIQK,intron_variant,,ENST00000517858,NM_001171796.1;TRIQK,intron_variant,,ENST00000518748,NM_001171795.1;TRIQK,intron_variant,,ENST00000519069,;TRIQK,intron_variant,,ENST00000519969,NM_001191036.1;TRIQK,intron_variant,,ENST00000520430,NM_001171798.1;TRIQK,intron_variant,,ENST00000520686,;TRIQK,intron_variant,,ENST00000521617,;TRIQK,intron_variant,,ENST00000521988,NM_001171797.1;TRIQK,intron_variant,,ENST00000522903,;TRIQK,intron_variant,,ENST00000522925,;TRIQK,intron_variant,,ENST00000523580,;TRIQK,intron_variant,,ENST00000524037,;TRIQK,intron_variant,,ENST00000524107,NM_001191035.1;TRIQK,intron_variant,,ENST00000537541,NM_001171799.1;CTD-3239E11.2,intron_variant,,ENST00000523197,;TRIQK,intron_variant,,ENST00000517540,;TRIQK,intron_variant,,ENST00000518400,;TRIQK,intron_variant,,ENST00000520384,;TRIQK,intron_variant,,ENST00000523375,;TRIQK,downstream_gene_variant,,ENST00000519792,;TRIQK,intron_variant,,ENST00000523060,;TRIQK,intron_variant,,ENST00000524260,;	-	ENSG00000205133	ENST00000521988	Transcript	intron_variant						rs34816958	1		-1	TRIQK	HGNC	27828	protein_coding	YES	CCDS55261.1	ENSP00000429517	Q629K1	E5RIT1	UPI0000210300	NM_001171797.1				1/4																		MODIFIER	1	deletion														.	ATACACACACACACACACA	.	.																					93971708
LINC00535	642924	.	GRCh37	8	94336197	94336198	+	Intron	DEL	TA	TA	-	rs3029768		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TA	TA																n.469+16206_469+16207del			ENST00000520096		4	.	3	3	.	0	LINC00535,intron_variant,,ENST00000520096,;	-	ENSG00000246662	ENST00000520096	Transcript	intron_variant,non_coding_transcript_variant						rs3029768	1		-1	LINC00535	HGNC	43644	antisense											4/5			0.3873	0.5043		0.626	0.4692	0.4816										MODIFIER	1	deletion														.	TGTAT	.	.																					94336196
RAD54B	25788	.	GRCh37	8	95396749	95396772	+	Intron	DEL	TTCAGTTTTGTTTGCAAAACTGAA	TTCAGTTTTGTTTGCAAAACTGAA	-	rs11273608		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTCAGTTTTGTTTGCAAAACTGAA	TTCAGTTTTGTTTGCAAAACTGAA																c.1985+2440_1985+2463del			ENST00000336148		3	.	3	0	.	0	RAD54B,intron_variant,,ENST00000336148,NM_012415.3;FSBP,intron_variant,,ENST00000517506,;RAD54B,intron_variant,,ENST00000518358,;	-	ENSG00000197275	ENST00000336148	Transcript	intron_variant						rs11273608	1		-1	RAD54B	HGNC	17228	protein_coding	YES	CCDS6262.1	ENSP00000336606	Q9Y620	E5RHN9	UPI0000070088	NM_012415.3				11/14																		MODIFIER	1	deletion														.	ATTTCAGTTTTGTTTGCAAAACTGAAA	.	.																					95396748
NCALD	83988	.	GRCh37	8	102701457	102701457	+	3'UTR	DEL	A	A	-	rs202125406		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.*80del			ENST00000395923	6/6	3	.	3	0	.	0	NCALD,3_prime_UTR_variant,,ENST00000395923,NM_001040630.1,NM_001040627.1,NM_001040629.1,NM_001040628.1;NCALD,3_prime_UTR_variant,,ENST00000311028,NM_001040626.1,NM_001040624.1;NCALD,3_prime_UTR_variant,,ENST00000220931,NM_032041.2;NCALD,3_prime_UTR_variant,,ENST00000521599,NM_001040625.1;NCALD,3_prime_UTR_variant,,ENST00000519508,;NCALD,intron_variant,,ENST00000522448,;NCALD,intron_variant,,ENST00000522951,;NCALD,downstream_gene_variant,,ENST00000520690,;KB-1107E3.1,downstream_gene_variant,,ENST00000518749,;NCALD,non_coding_transcript_exon_variant,,ENST00000522754,;,regulatory_region_variant,,ENSR00001744927,;	-	ENSG00000104490	ENST00000395923	Transcript	3_prime_UTR_variant	1122/3808					rs202125406	2		-1	NCALD	HGNC	7655	protein_coding	YES	CCDS6292.1	ENSP00000379256	P61601	E5RK89,E5RJT1,E5RJJ6,E5RIZ1,E5RIX3,E5RIG4,E5RI95,E5RI78,E5RHE8,E5RHC8,E5RGZ0,E5RFL9,B2RB70	UPI0000004090	NM_001040630.1,NM_001040627.1,NM_001040629.1,NM_001040628.1			6/6																			MODIFIER	1	sequence_alteration														.	GCAA	.	.																					102701456
ANGPT1	284	.	GRCh37	8	108367303	108367303	+	Intron	DEL	T	T	-	rs75427839		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.298-7978del			ENST00000517746		4	.	4	0	.	0	ANGPT1,intron_variant,,ENST00000297450,;ANGPT1,intron_variant,,ENST00000517746,NM_001199859.1,NM_001146.3;ANGPT1,intron_variant,,ENST00000520033,;	-	ENSG00000154188	ENST00000517746	Transcript	intron_variant						rs75427839	1		-1	ANGPT1	HGNC	484	protein_coding	YES	CCDS6306.1	ENSP00000428340	Q15389	E5RFF4,B4E3G9,B4DTQ9	UPI0000034766	NM_001199859.1,NM_001146.3				1/8			0.1354	0.3501		0.4683	0.4553	0.4571										MODIFIER	1	deletion													1	.	TGTT	.	.																					108367302
PKHD1L1	93035	.	GRCh37	8	110485747	110485748	+	Intron	INS	-	-	A	rs1018548199		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.8606-1588dup			ENST00000378402		3	.	3	0	.	0	PKHD1L1,intron_variant,,ENST00000378402,NM_177531.4;RP11-419L20.2,downstream_gene_variant,,ENST00000518703,;	A	ENSG00000205038	ENST00000378402	Transcript	intron_variant						rs1018548199	1		1	PKHD1L1	HGNC	20313	protein_coding	YES	CCDS47911.1	ENSP00000367655	Q86WI1		UPI0000E5B020	NM_177531.4				50/77																		MODIFIER	1	insertion														.	AGA	.	.																					110485747
Unknown	0	.	GRCh37	8	113190797	113190799	+	IGR	DEL	AAG	AAG	-	rs35311575		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAG	AAG																					4	.	4	0	.	0		-				intergenic_variant						rs35311575	1																				0.1029	0.4179		0.2262	0.4473	0.4233										MODIFIER	1	deletion														.	ACAAGA	.	.																					113190796
Unknown	0	.	GRCh37	8	114497594	114497595	+	IGR	INS	-	-	TGTT	rs34762154		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TGTT				intergenic_variant						rs34762154	1																				0.0794	0.1527		0.0526	0.333	0.136										MODIFIER	1	insertion														.	TCT	.	.																					114497594
TRPS1	7227	.	GRCh37	8	116454682	116454682	+	Intron	DEL	G	G	-	rs34940485		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.2701-24002del			ENST00000395715		3	.	3	0	.	0	TRPS1,intron_variant,,ENST00000220888,;TRPS1,intron_variant,,ENST00000395715,NM_014112.2,NM_001282903.1;TRPS1,intron_variant,,ENST00000518018,;TRPS1,intron_variant,,ENST00000519076,;TRPS1,intron_variant,,ENST00000520276,NM_001282902.1;	-	ENSG00000104447	ENST00000395715	Transcript	intron_variant						rs34940485	1		-1	TRPS1	HGNC	12340	protein_coding	YES	CCDS6318.2	ENSP00000379065	Q9UHF7	F8W8T0,E7EVN4,C9J6L7	UPI00002104B8	NM_014112.2,NM_001282903.1				5/6			0.0219	0.2046		0.3274	0.3181	0.4162										MODIFIER	1	deletion													1	.	TAGG	.	.																					116454681
Unknown	0	.	GRCh37	8	124176961	124176962	+	IGR	INS	-	-	A	rs35531119		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		A				intergenic_variant						rs35531119	1																				0.8729	0.7522		0.8085	0.7505	0.7249										MODIFIER	1	insertion														.	TCA	.	.																					124176961
Unknown	0	.	GRCh37	8	125798040	125798040	+	IGR	DEL	A	A	-	rs34467187		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	4	0	.	0		-				intergenic_variant						rs34467187	1																			0.2031	0.2806	0.1671		0.0903	0.2565	0.1851										MODIFIER	1	deletion														.	TGAT	.	.																					125798039
PCAT1	100750225	.	GRCh37	8	128034515	128034516	+	3'Flank	INS	-	-	A	rs77678109		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000561978		4	.	4	0	.	0	PCAT1,downstream_gene_variant,,ENST00000561978,;	A	ENSG00000253438	ENST00000561978	Transcript	downstream_gene_variant						rs77678109	1	1256	1	PCAT1	HGNC	43022	lincRNA	YES													0.025	0.111		0.0813	0.1988	0.1779										MODIFIER	1	insertion														.	TTA	.	.																					128034515
CASC8	727677	.	GRCh37	8	128488261	128488262	+	Intron	DEL	AT	AT	-	rs200041668		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																n.1041+3066_1041+3067del			ENST00000502082		5	.	5	0	.	0	CASC8,intron_variant,,ENST00000502056,;CASC8,intron_variant,,ENST00000502082,;	-	ENSG00000246228	ENST00000502082	Transcript	intron_variant,non_coding_transcript_variant						rs200041668	1		-1	CASC8	HGNC	45129	antisense	YES										4/5		0.1831	0.0522	0.2406		0.2163	0.2674	0.1984										MODIFIER	1	deletion														.	CCATG	.	.																					128488260
PVT1	5820	.	GRCh37	8	128895428	128895429	+	Intron	INS	-	-	A	rs34330730		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.368-7404dup			ENST00000504719		4	.	4	0	.	0	PVT1,intron_variant,,ENST00000504719,;PVT1,intron_variant,,ENST00000517525,;PVT1,intron_variant,,ENST00000517790,;PVT1,intron_variant,,ENST00000518528,;PVT1,intron_variant,,ENST00000521122,;PVT1,intron_variant,,ENST00000521951,;PVT1,intron_variant,,ENST00000522963,;PVT1,intron_variant,,ENST00000523068,;PVT1,intron_variant,,ENST00000523427,;,regulatory_region_variant,,ENSR00001747505,;	A	ENSG00000249859	ENST00000504719	Transcript	intron_variant,non_coding_transcript_variant						rs34330730	1		1	PVT1	HGNC	9709	lincRNA											2/2			0.146	0.1729		0.0317	0.2535	0.1779										MODIFIER		insertion														.	GCA	.	.																					128895428
ST3GAL1	6482	.	GRCh37	8	134465953	134465955	+	3'Flank	DEL	AAG	AAG	-	rs5895191		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAG	AAG																			ENST00000319914		4	.	4	0	.	0	ST3GAL1,downstream_gene_variant,,ENST00000319914,;ST3GAL1,downstream_gene_variant,,ENST00000399640,;ST3GAL1,downstream_gene_variant,,ENST00000521180,NM_173344.2,NM_003033.3;,regulatory_region_variant,,ENSR00001442000,;,regulatory_region_variant,,ENSR00001748189,;,TF_binding_site_variant,,ENSM00908307411,;	-	ENSG00000008513	ENST00000319914	Transcript	downstream_gene_variant						rs5895191	1	1136	-1	ST3GAL1	HGNC	10862	protein_coding	YES	CCDS6373.1	ENSP00000318445	Q11201	E5RHV6,E5RH34,E5RGL4,E5RGI3,E5RG72	UPI00000015E1								0.2163	0.7824		0.9841	0.7316	0.8344										MODIFIER	1	deletion														.	TAAAGA	.	.																					134465952
ST3GAL1	6482	.	GRCh37	8	134501111	134501112	+	Intron	INS	-	-	G	rs57405580		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-579-12266dup			ENST00000319914		6	.	4	3	.	0	ST3GAL1,intron_variant,,ENST00000319914,;ST3GAL1,intron_variant,,ENST00000517668,;ST3GAL1,intron_variant,,ENST00000519924,;ST3GAL1,intron_variant,,ENST00000521180,NM_173344.2,NM_003033.3;ST3GAL1,intron_variant,,ENST00000522652,;ST3GAL1,intron_variant,,ENST00000523634,;ST3GAL1,intron_variant,,ENST00000523854,;ST3GAL1,intron_variant,,ENST00000523855,;ST3GAL1,intron_variant,,ENST00000518298,;ST3GAL1,intron_variant,,ENST00000519435,;ST3GAL1,intron_variant,,ENST00000520020,;ST3GAL1,intron_variant,,ENST00000521627,;ST3GAL1,intron_variant,,ENST00000522873,;,regulatory_region_variant,,ENSR00000231325,;	G	ENSG00000008513	ENST00000319914	Transcript	intron_variant						rs57405580	1		-1	ST3GAL1	HGNC	10862	protein_coding	YES	CCDS6373.1	ENSP00000318445	Q11201	E5RHV6,E5RH34,E5RGL4,E5RGI3,E5RG72	UPI00000015E1					3/8																		MODIFIER	1	insertion														.	CAG	.	.																					134501111
Unknown	0	.	GRCh37	8	135770568	135770569	+	IGR	INS	-	-	AAAAC	rs71576101		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		AAAAC				intergenic_variant						rs71576101	1																				0.2526	0.2291		0.245	0.3549	0.3548										MODIFIER	1	insertion														.	AAA	.	.																					135770568
RP11-149P24.1	0	.	GRCh37	8	137155699	137155700	+	Intron	INS	-	-	GT	rs3064089		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.331-18997_331-18996dup			ENST00000523150		5	.	5	0	.	0	RP11-149P24.1,intron_variant,,ENST00000502901,;RP11-149P24.1,intron_variant,,ENST00000523150,;	GT	ENSG00000253248	ENST00000523150	Transcript	intron_variant,non_coding_transcript_variant						rs3064089	1		1	RP11-149P24.1	Clone_based_vega_gene		lincRNA	YES										2/4			0.2322	0.4885		0.6508	0.4374	0.5542										MODIFIER	1	insertion														.	TGG	.	.																					137155699
RP11-30J20.1	0	.	GRCh37	8	137786853	137786855	+	Intron	DEL	AGA	AGA	-	rs60909054		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGA	AGA																n.85-15221_85-15219del			ENST00000517345		4	.	4	0	.	0	RP11-30J20.1,intron_variant,,ENST00000517345,;RP11-30J20.1,intron_variant,,ENST00000524346,;	-	ENSG00000254101	ENST00000517345	Transcript	intron_variant,non_coding_transcript_variant						rs60909054	1		1	RP11-30J20.1	Clone_based_vega_gene		lincRNA											1/3			0.1112	0.3573		0.5139	0.4294	0.5409										MODIFIER		deletion														.	ATAGAA	.	.																					137786852
Unknown	0	.	GRCh37	8	138755225	138755230	+	IGR	DEL	TCTATA	TCTATA	-	rs71300304		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCTATA	TCTATA																					3	.	3	0	.	0		-				intergenic_variant						rs71300304	1																				0.1952	0.4914		0.4663	0.5378	0.3855										MODIFIER	1	deletion														.	ACTCTATAT	.	.																					138755224
COL22A1	169044	.	GRCh37	8	139844032	139844033	+	Intron	INS	-	-	C	rs11386378		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.845+1249_845+1250insG			ENST00000303045		6	.	3	5	.	0	COL22A1,intron_variant,,ENST00000303045,NM_152888.1;COL22A1,intron_variant,,ENST00000435777,;COL22A1,upstream_gene_variant,,ENST00000517515,;	C	ENSG00000169436	ENST00000303045	Transcript	intron_variant						rs11386378	1		-1	COL22A1	HGNC	22989	protein_coding	YES	CCDS6376.1	ENSP00000303153	Q8NFW1		UPI00001C1EA1	NM_152888.1				5/64		0.5803	0.4584	0.6297		0.6964	0.6054	0.5644										MODIFIER	1	insertion														.	GGA	.	.																					139844032
Unknown	0	.	GRCh37	8	139993219	139993219	+	IGR	DEL	T	T	-	rs200380191		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	4	0	.	0		-				intergenic_variant						rs200380191	1																																			MODIFIER	1	deletion														.	TCTT	.	.																					139993218
TRAPPC9	83696	.	GRCh37	8	140807568	140807569	+	Intron	DEL	GT	GT	-	rs560198114		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																c.3350-63124_3350-63123del			ENST00000389328		5	.	3	3	.	0	TRAPPC9,intron_variant,,ENST00000389327,;TRAPPC9,intron_variant,,ENST00000389328,NM_031466.5;TRAPPC9,intron_variant,,ENST00000438773,NM_001160372.1;TRAPPC9,intron_variant,,ENST00000520857,;TRAPPC9,intron_variant,,ENST00000519482,;TRAPPC9,intron_variant,,ENST00000521667,;TRAPPC9,intron_variant,,ENST00000521700,;TRAPPC9,intron_variant,,ENST00000522504,;TRAPPC9,intron_variant,,ENST00000523777,;TRAPPC9,intron_variant,,ENST00000524162,;	-	ENSG00000167632	ENST00000389328	Transcript	intron_variant						rs560198114	1		-1	TRAPPC9	HGNC	30832	protein_coding	YES	CCDS34946.1	ENSP00000373979	Q96Q05		UPI0000DBEF2B	NM_031466.5				21/22				0.0029			0.003	0.0102										MODIFIER	1	deletion													1	.	CCGTG	.	.																					140807567
TRAPPC9	83696	.	GRCh37	8	141034499	141034499	+	Intron	DEL	T	T	-	rs35795692		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.2851-323del			ENST00000389328		3	.	3	0	.	0	TRAPPC9,intron_variant,,ENST00000389327,;TRAPPC9,intron_variant,,ENST00000389328,NM_031466.5;TRAPPC9,intron_variant,,ENST00000438773,NM_001160372.1;TRAPPC9,intron_variant,,ENST00000520857,;TRAPPC9,intron_variant,,ENST00000517667,;TRAPPC9,intron_variant,,ENST00000520532,;TRAPPC9,intron_variant,,ENST00000521667,;TRAPPC9,intron_variant,,ENST00000523777,;	-	ENSG00000167632	ENST00000389328	Transcript	intron_variant						rs35795692	1		-1	TRAPPC9	HGNC	30832	protein_coding	YES	CCDS34946.1	ENSP00000373979	Q96Q05		UPI0000DBEF2B	NM_031466.5				17/22																		MODIFIER	1	deletion													1	.	TCTT	.	.																					141034498
Unknown	0	.	GRCh37	8	142936880	142936880	+	IGR	DEL	G	G	-	rs142989694		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					6	.	6	0	.	0		-				intergenic_variant						rs142989694	1																																			MODIFIER	1	deletion														.	GAGG	.	.																					142936879
TSNARE1	203062	.	GRCh37	8	143310945	143310946	+	Splice_Region	DEL	GA	GA	-	rs367749353		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GA	GA																c.1447-6_1447-5del			ENST00000307180		4	.	4	0	.	0	TSNARE1,splice_region_variant,,ENST00000307180,NM_145003.3;TSNARE1,splice_region_variant,,ENST00000520166,;TSNARE1,splice_region_variant,,ENST00000524325,;	-	ENSG00000171045	ENST00000307180	Transcript	splice_region_variant,intron_variant						rs367749353	1		-1	TSNARE1	HGNC	26437	protein_coding	YES	CCDS6384.1	ENSP00000303437	Q96NA8	E5RHW3,A0AVG3	UPI00001AEE5E	NM_145003.3				12/13									0.008208	0.007153								LOW	1	deletion														.	GGGAG	.	.												0.0001365	0.0003172	5.958e-05		5.599e-05	0.0005031	0.0001373			143310944
TOP1MT	116447	.	GRCh37	8	144404538	144404541	+	Intron	DEL	ACAG	ACAG	-	rs1310700892		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACAG	ACAG																c.961-985_961-982del			ENST00000329245		38	31	7	18	0	0	TOP1MT,intron_variant,,ENST00000329245,NM_052963.2;TOP1MT,intron_variant,,ENST00000519139,;TOP1MT,intron_variant,,ENST00000519148,NM_001258447.1;TOP1MT,intron_variant,,ENST00000521193,NM_001258446.1;TOP1MT,intron_variant,,ENST00000523676,;TOP1MT,downstream_gene_variant,,ENST00000518007,;TOP1MT,downstream_gene_variant,,ENST00000518760,;TOP1MT,downstream_gene_variant,,ENST00000519591,;TOP1MT,downstream_gene_variant,,ENST00000520950,;TOP1MT,downstream_gene_variant,,ENST00000522041,;TOP1MT,intron_variant,,ENST00000518951,;TOP1MT,downstream_gene_variant,,ENST00000522121,;TOP1MT,downstream_gene_variant,,ENST00000523417,;	-	ENSG00000184428	ENST00000329245	Transcript	intron_variant						rs1310700892	1		-1	TOP1MT	HGNC	29787	protein_coding	YES	CCDS6400.1	ENSP00000328835	Q969P6	E5KMK7,Q8TBP3,E5RJ95,E5RJ33,E5RFS0	UPI000013716D	NM_052963.2				7/13																		MODIFIER	1	deletion														.	ACACAGG	.	.																					144404537
ZC3H3	23144	.	GRCh37	8	144619845	144619845	+	Intron	DEL	G	G	-	rs10719055		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.1364+328del			ENST00000262577		7	.	7	0	.	0	ZC3H3,intron_variant,,ENST00000262577,NM_015117.2;7SK,upstream_gene_variant,,ENST00000408472,;7SK,upstream_gene_variant,,ENST00000517300,;RP11-661A12.5,downstream_gene_variant,,ENST00000530600,;	-	ENSG00000014164	ENST00000262577	Transcript	intron_variant						rs10719055	1		-1	ZC3H3	HGNC	28972	protein_coding	YES	CCDS6402.1	ENSP00000262577	Q8IXZ2		UPI0000160D96	NM_015117.2				2/11			0.2201	0.2709		0.0804	0.1978	0.2515										MODIFIER	1	deletion														.	CTGG	.	.																					144619844
ZNF707	286075	.	GRCh37	8	144772152	144772152	+	Intron	DEL	G	G	-	rs35228840		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.-52-69del			ENST00000532205		9	.	6	13	.	0	ZNF707,intron_variant,,ENST00000358656,NM_001100598.1,NM_001288808.1,NM_001288806.1;ZNF707,intron_variant,,ENST00000418203,;ZNF707,intron_variant,,ENST00000442058,;ZNF707,intron_variant,,ENST00000454097,NM_001100599.1;ZNF707,intron_variant,,ENST00000526315,;ZNF707,intron_variant,,ENST00000526970,;ZNF707,intron_variant,,ENST00000529833,;ZNF707,intron_variant,,ENST00000530574,;ZNF707,intron_variant,,ENST00000532158,NM_173831.3;ZNF707,intron_variant,,ENST00000532205,NM_001288805.1;ZNF707,intron_variant,,ENST00000534303,;ZNF707,intron_variant,,ENST00000527561,;ZNF707,intron_variant,,ENST00000530341,;ZNF707,intron_variant,,ENST00000531811,;ZNF707,intron_variant,,ENST00000532571,;ZNF707,intron_variant,,ENST00000525185,;ZNF707,intron_variant,,ENST00000525538,;ZNF707,intron_variant,,ENST00000525619,;ZNF707,intron_variant,,ENST00000525862,;ZNF707,intron_variant,,ENST00000527293,;ZNF707,intron_variant,,ENST00000528134,;ZNF707,intron_variant,,ENST00000528456,;ZNF707,intron_variant,,ENST00000531985,;ZNF707,intron_variant,,ENST00000532003,;ZNF707,intron_variant,,ENST00000532486,;ZNF707,intron_variant,,ENST00000533031,;ZNF707,intron_variant,,ENST00000533254,;ZNF707,intron_variant,,ENST00000534589,;ZNF707,upstream_gene_variant,,ENST00000531254,;	-	ENSG00000181135	ENST00000532205	Transcript	intron_variant						rs35228840	1		1	ZNF707	HGNC	27815	protein_coding	YES	CCDS47932.1	ENSP00000436212	Q96C28	E9PS67,E9PQ20,E9PNV7,E9PHZ0	UPI0000160D8F	NM_001288805.1				4/7			0.0318	0.464		0.1081	0.6541	0.3507										MODIFIER	1	deletion														.	GTGG	.	.																					144772151
CCDC166	100130274	.	GRCh37	8	144783901	144783901	+	3'Flank	DEL	C	C	-	rs34813024		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENST00000542437		7	.	4	3	.	0	CCDC166,downstream_gene_variant,,ENST00000542437,NM_001162914.1;RP11-429J17.2,downstream_gene_variant,,ENST00000531565,;ZNF707,intron_variant,,ENST00000527561,;	-	ENSG00000255181	ENST00000542437	Transcript	downstream_gene_variant						rs34813024	1	4963	-1	CCDC166	HGNC	41910	protein_coding	YES	CCDS55280.1	ENSP00000437468	P0CW27		UPI00016623E2	NM_001162914.1						0.3387	0.1831	0.415		0.2054	0.5775	0.3865										MODIFIER	1	deletion														.	GACA	.	.																					144783900
ZNF250	58500	.	GRCh37	8	146105452	146105452	+	3'UTR	DEL	A	A	-	rs61668478		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.*1448del			ENST00000292579	6/6	3	.	3	0	.	0	ZNF250,3_prime_UTR_variant,,ENST00000292579,NM_021061.4,NM_001109689.3;ZNF250,intron_variant,,ENST00000342660,;ZNF250,intron_variant,,ENST00000543949,;ZNF250,downstream_gene_variant,,ENST00000417550,;ZNF250,downstream_gene_variant,,ENST00000525694,;ZNF250,downstream_gene_variant,,ENST00000533221,;ZNF250,downstream_gene_variant,,ENST00000533622,;ZNF250,intron_variant,,ENST00000528258,;ZNF250,intron_variant,,ENST00000529780,;ZNF250,intron_variant,,ENST00000533543,;,regulatory_region_variant,,ENSR00001749307,;	-	ENSG00000196150	ENST00000292579	Transcript	3_prime_UTR_variant	3248/6364					rs61668478	1		-1	ZNF250	HGNC	13044	protein_coding	YES	CCDS34972.1	ENSP00000292579	P15622		UPI0000197F51	NM_021061.4,NM_001109689.3			6/6																			MODIFIER	1	deletion														.	TCAA	.	.																					146105451
CARM1P1	0	.	GRCh37	9	2967657	2967657	+	Intron	DEL	A	A	-	rs61085701		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																n.428-19375del			ENST00000426329		5	.	3	3	.	0	CARM1P1,intron_variant,,ENST00000426329,;,regulatory_region_variant,,ENSR00001749632,;	-	ENSG00000227835	ENST00000426329	Transcript	intron_variant,non_coding_transcript_variant						rs61085701	1		-1	CARM1P1	HGNC	23392	transcribed_unprocessed_pseudogene	YES										4/10																		MODIFIER	1	deletion														.	TTAA	.	.																					2967656
GLDC	2731	.	GRCh37	9	6639395	6639396	+	Intron	INS	-	-	T	rs59912052		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.334+5218_334+5219insA			ENST00000321612		7	.	4	5	.	0	GLDC,intron_variant,,ENST00000321612,NM_000170.2;RP11-106A1.2,non_coding_transcript_exon_variant,,ENST00000332361,;,regulatory_region_variant,,ENSR00001446184,;	T	ENSG00000178445	ENST00000321612	Transcript	intron_variant						rs59912052	1		-1	GLDC	HGNC	4313	protein_coding	YES	CCDS34987.1	ENSP00000370737	P23378		UPI0000684276	NM_000170.2				2/24		0.6979	0.8691	0.7003		0.7044	0.5109	0.6503										MODIFIER	1	insertion													1	.	TCG	.	.																					6639395
PTPRD	5789	.	GRCh37	9	9540260	9540261	+	Intron	INS	-	-	C	rs56080030		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-237+34471_-237+34472insG			ENST00000381196		3	.	3	0	.	0	PTPRD,intron_variant,,ENST00000381196,NM_002839.3;PTPRD,intron_variant,,ENST00000463477,;	C	ENSG00000153707	ENST00000381196	Transcript	intron_variant						rs56080030	1		-1	PTPRD	HGNC	9668	protein_coding	YES	CCDS43786.1	ENSP00000370593	P23468	C9J6E4,B4DK48	UPI0000132990	NM_002839.3				5/42		0.3081	0.4236	0.3242		0.2093	0.3678	0.181										MODIFIER	1	insertion													1	.	CAT	.	.																					9540260
PES1P2	0	.	GRCh37	9	13982327	13982327	+	5'Flank	DEL	T	T	-	rs34015971		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000449745		3	.	3	0	.	0	PES1P2,upstream_gene_variant,,ENST00000449745,;	-	ENSG00000229268	ENST00000449745	Transcript	upstream_gene_variant						rs34015971	1	3847	1	PES1P2	HGNC	44059	processed_pseudogene	YES																												MODIFIER	1	deletion														.	CATT	.	.																					13982326
NFIB	4781	.	GRCh37	9	14185091	14185092	+	Intron	INS	-	-	AATA	rs57241853		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.563-5313_563-5312insTATT			ENST00000380953		5	.	5	0	.	0	NFIB,intron_variant,,ENST00000380934,NM_001190738.1;NFIB,intron_variant,,ENST00000380953,NM_001190737.1;NFIB,intron_variant,,ENST00000380959,NM_005596.3;NFIB,intron_variant,,ENST00000397575,;NFIB,intron_variant,,ENST00000397579,;NFIB,intron_variant,,ENST00000397581,;NFIB,upstream_gene_variant,,ENST00000380924,;NFIB,upstream_gene_variant,,ENST00000543693,NM_001282787.1;	AATA	ENSG00000147862	ENST00000380953	Transcript	intron_variant						rs57241853	1		-1	NFIB	HGNC	7785	protein_coding	YES	CCDS55291.1	ENSP00000370340	O00712		UPI0000211140	NM_001190737.1				2/10			0.6989	0.9813		0.9603	0.996	0.9898										MODIFIER	1	insertion													1	.	AGT	.	.																					14185091
ZDHHC21	340481	.	GRCh37	9	14623644	14623644	+	Intron	DEL	A	A	-	rs71322000		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.622-3964del			ENST00000380916		4	.	4	0	.	0	ZDHHC21,intron_variant,,ENST00000380916,NM_178566.4;	-	ENSG00000175893	ENST00000380916	Transcript	intron_variant						rs71322000	1		-1	ZDHHC21	HGNC	20750	protein_coding	YES	CCDS6475.1	ENSP00000370303	Q8IVQ6		UPI00000745E6	NM_178566.4				8/9			0.5787	0.7248		0.6141	0.6869	0.771										MODIFIER	1	deletion														.	AGAA	.	.																					14623643
CCDC171	203238	.	GRCh37	9	15761881	15761882	+	Intron	DEL	AA	AA	-	rs34656827		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																c.2672-15715_2672-15714del			ENST00000380701		3	.	3	0	.	0	CCDC171,intron_variant,,ENST00000297641,;CCDC171,intron_variant,,ENST00000380701,NM_173550.2;CCDC171,intron_variant,,ENST00000449575,;	-	ENSG00000164989	ENST00000380701	Transcript	intron_variant						rs34656827	1		1	CCDC171	HGNC	29828	protein_coding	YES	CCDS6481.1	ENSP00000370077	Q6TFL3	Q8NCV3	UPI000021C44B	NM_173550.2				18/25			0.0227	0.5807		0.6319	0.495	0.4519										MODIFIER	1	deletion														.	TCAAA	.	.																					15761880
Unknown	0	.	GRCh37	9	16105451	16105451	+	IGR	DEL	C	C	-	rs34392949		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					3	.	3	0	.	0		-				intergenic_variant						rs34392949	1																				0.8079	0.3213		0.1091	0.3936	0.3681										MODIFIER	1	deletion														.	CACC	.	.																					16105450
CNTLN	54875	.	GRCh37	9	17273628	17273629	+	Intron	INS	-	-	AG	rs3840729		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.850-103_850-102insAG			ENST00000380647		9	.	3	12	.	0	CNTLN,intron_variant,,ENST00000262360,;CNTLN,intron_variant,,ENST00000380641,NM_001114395.1;CNTLN,intron_variant,,ENST00000380647,;CNTLN,intron_variant,,ENST00000425824,NM_017738.2;	AG	ENSG00000044459	ENST00000380647	Transcript	intron_variant						rs3840729	1		1	CNTLN	HGNC	23432	protein_coding	YES	CCDS43789.1	ENSP00000370021	Q9NXG0		UPI0000458809					5/25		0.3347	0.3298	0.245		0.3502	0.2853	0.4397										MODIFIER	1	insertion														.	ACT	.	.																					17273628
Unknown	0	.	GRCh37	9	18244086	18244089	+	IGR	DEL	TGTG	TGTG	-	rs5896777		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGTG	TGTG																					3	.	3	0	.	0		-				intergenic_variant						rs5896777	1																																			MODIFIER	1	deletion														.	TTTGTGT	.	.																					18244085
Unknown	0	.	GRCh37	9	22255095	22255095	+	IGR	DEL	T	T	-	rs547632000		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs547632000	1																																			MODIFIER	1	deletion														.	GATT	.	.																					22255094
Unknown	0	.	GRCh37	9	31148859	31148860	+	IGR	INS	-	-	T	rs77643103		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs77643103	1																				0.5719	0.3588		0.4673	0.4483	0.5										MODIFIER	1	insertion														.	ACT	.	.																					31148859
B4GALT1	2683	.	GRCh37	9	33137646	33137650	+	Intron	DEL	TTAGA	TTAGA	-	rs75219428		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTAGA	TTAGA																c.413-2228_413-2224del			ENST00000379731		7	3	4	4	4	0	B4GALT1,intron_variant,,ENST00000379731,NM_001497.3;B4GALT1,intron_variant,,ENST00000535206,;	-	ENSG00000086062	ENST00000379731	Transcript	intron_variant						rs75219428	1		-1	B4GALT1	HGNC	924	protein_coding	YES	CCDS6535.1	ENSP00000369055	P15291	B7ZAH9,B4DMM8	UPI000002D22E	NM_001497.3				1/5																		MODIFIER	1	deletion													1	.	CCTTAGAG	.	.																					33137645
AQP7	364	.	GRCh37	9	33393517	33393518	+	Intron	INS	-	-	C	rs111966548		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.144+1558dup			ENST00000297988		6	3	3	7	0	0	AQP7,intron_variant,,ENST00000297988,NM_001170.1;AQP7,intron_variant,,ENST00000377425,;AQP7,intron_variant,,ENST00000379506,;AQP7,intron_variant,,ENST00000379507,;AQP7,intron_variant,,ENST00000439678,;AQP7,intron_variant,,ENST00000537089,;AQP7,intron_variant,,ENST00000539936,;AQP7,intron_variant,,ENST00000541274,;AQP7,upstream_gene_variant,,ENST00000379503,;,regulatory_region_variant,,ENSR00001751849,;	C	ENSG00000165269	ENST00000297988	Transcript	intron_variant						rs111966548	1		-1	AQP7	HGNC	640	protein_coding	YES	CCDS6541.1	ENSP00000297988	O14520	Q5T5L3	UPI0000125D23	NM_001170.1				3/7																		MODIFIER	1	insertion													1	.	AGC	.	.																					33393517
RP11-133O22.6	0	.	GRCh37	9	33807034	33807035	+	Intron	DEL	GT	GT	-	rs113439098		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																n.170-7124_170-7123del			ENST00000454429		3	.	3	0	.	0	RP11-133O22.6,intron_variant,,ENST00000454429,;	-	ENSG00000235481	ENST00000454429	Transcript	intron_variant,non_coding_transcript_variant						rs113439098	1		-1	RP11-133O22.6	Clone_based_vega_gene		antisense	YES										1/3																		MODIFIER	1	deletion														.	CAGTG	.	.																					33807033
UBAP2	55833	.	GRCh37	9	33989202	33989203	+	Intron	DEL	TT	TT	-	rs34957423		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																c.289-79_289-78del			ENST00000379238		7	.	7	0	.	0	UBAP2,intron_variant,,ENST00000360802,NM_018449.2;UBAP2,intron_variant,,ENST00000379238,;UBAP2,intron_variant,,ENST00000379239,NM_001282529.1;UBAP2,intron_variant,,ENST00000412543,;UBAP2,intron_variant,,ENST00000418786,;UBAP2,intron_variant,,ENST00000449054,;UBAP2,intron_variant,,ENST00000539807,;UBAP2,upstream_gene_variant,,ENST00000421278,;	-	ENSG00000137073	ENST00000379238	Transcript	intron_variant						rs34957423	1		-1	UBAP2	HGNC	14185	protein_coding	YES	CCDS6547.1	ENSP00000368540	Q5T6F2	Q5JV03	UPI0000140784					4/28																		MODIFIER	1	deletion														.	TCTTT	.	.																					33989201
PIGO	84720	.	GRCh37	9	35099416	35099419	+	5'Flank	DEL	CTGT	CTGT	-	rs56091834		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTGT	CTGT																			ENST00000378617		6	.	3	3	.	0	PIGO,upstream_gene_variant,,ENST00000298004,NM_001201484.1;FAM214B,downstream_gene_variant,,ENST00000322813,NM_025182.2;PIGO,upstream_gene_variant,,ENST00000341666,;STOML2,downstream_gene_variant,,ENST00000356493,NM_013442.1,NM_001287032.1;PIGO,upstream_gene_variant,,ENST00000361778,NM_152850.3;FAM214B,downstream_gene_variant,,ENST00000378554,;FAM214B,downstream_gene_variant,,ENST00000378557,;FAM214B,downstream_gene_variant,,ENST00000378561,;FAM214B,downstream_gene_variant,,ENST00000378566,;PIGO,upstream_gene_variant,,ENST00000378617,NM_032634.3;STOML2,downstream_gene_variant,,ENST00000452248,NM_001287031.1;FAM214B,downstream_gene_variant,,ENST00000488109,;FAM214B,downstream_gene_variant,,ENST00000603301,;FAM214B,downstream_gene_variant,,ENST00000605244,;RP11-182N22.8,downstream_gene_variant,,ENST00000431804,;PIGO,upstream_gene_variant,,ENST00000472208,;STOML2,downstream_gene_variant,,ENST00000487490,;PIGO,upstream_gene_variant,,ENST00000492770,;PIGO,upstream_gene_variant,,ENST00000465745,;PIGO,upstream_gene_variant,,ENST00000474436,;STOML2,downstream_gene_variant,,ENST00000488050,;	-	ENSG00000165282	ENST00000378617	Transcript	upstream_gene_variant						rs56091834	1	2871	-1	PIGO	HGNC	23215	protein_coding	YES	CCDS6575.1	ENSP00000367880	Q8TEQ8		UPI0000048EF6	NM_032634.3							0.1884	0.2017		0.0714	0.2068	0.3037										MODIFIER	1	deletion													1	.	TCCTGTC	.	.																					35099415
FAM214B	80256	.	GRCh37	9	35110490	35110491	+	5'UTR	INS	-	T	T	rs5897594		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-1976dup			ENST00000378561	1/8	6	.	0	3	.	3	FAM214B,5_prime_UTR_variant,,ENST00000378561,;FAM214B,intron_variant,,ENST00000322813,NM_025182.2;FAM214B,intron_variant,,ENST00000378554,;FAM214B,intron_variant,,ENST00000378557,;FAM214B,intron_variant,,ENST00000378566,;FAM214B,intron_variant,,ENST00000488109,;FAM214B,intron_variant,,ENST00000603301,;FAM214B,intron_variant,,ENST00000605244,;FAM214B,intron_variant,,ENST00000605104,;FAM214B,intron_variant,,ENST00000605392,;,regulatory_region_variant,,ENSR00000418574,;	T	ENSG00000005238	ENST00000378561	Transcript	5_prime_UTR_variant	1081-1082/5771					rs5897594	1		-1	FAM214B	HGNC	25666	protein_coding	YES	CCDS6578.1	ENSP00000367823	Q7L5A3		UPI0000169E3E				1/8				0.3949	0.5836		0.5694	0.493	0.4387										MODIFIER	1	insertion														.	TCT	.	.																					35110490
RP11-262H14.1	100996870	.	GRCh37	9	66464673	66464674	+	Intron	DEL	TG	TG	-	rs113415960		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																n.225-918_225-917del			ENST00000424345		6	4	2	11	11	0	RP11-262H14.1,intron_variant,,ENST00000424345,;RP11-262H14.1,intron_variant,,ENST00000427509,;RP11-262H14.1,downstream_gene_variant,,ENST00000452184,;	-	ENSG00000238113	ENST00000424345	Transcript	intron_variant,non_coding_transcript_variant						rs113415960	1		1	RP11-262H14.1	Clone_based_vega_gene		lincRNA	YES										2/4																		MODIFIER	1	deletion														.	ACTGT	.	.																					66464672
AQP7P1	0	.	GRCh37	9	67282933	67282933	+	Intron	DEL	T	T	-	rs5898015		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																n.361-1102del			ENST00000334576		6	4	2	4	4	0	AQP7P1,intron_variant,,ENST00000334576,;AQP7P1,intron_variant,,ENST00000412626,;RP11-236F9.2,upstream_gene_variant,,ENST00000444603,;	-	ENSG00000186466	ENST00000334576	Transcript	intron_variant,non_coding_transcript_variant						rs5898015	1		-1	AQP7P1	HGNC	32048	unprocessed_pseudogene	YES										2/8		0.2698	0.2133	0.2522		0.3304	0.2485	0.318										MODIFIER	1	deletion														.	CATG	.	.																					67282932
RP11-764K9.1	0	.	GRCh37	9	68401175	68401176	+	RNA	INS	-	-	T	rs113540596		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.644dup			ENST00000417843	3/5	4	.	4	0	.	0	RP11-764K9.1,non_coding_transcript_exon_variant,,ENST00000417843,;	T	ENSG00000225411	ENST00000417843	Transcript	non_coding_transcript_exon_variant	644-645/2878					rs113540596	1		-1	RP11-764K9.1	Clone_based_vega_gene		lincRNA	YES									3/5				0.2073	0.049		0.372	0.0427	0.1043										MODIFIER	1	insertion														.	ACT	.	.																					68401175
RP11-764K9.1	0	.	GRCh37	9	68407616	68407616	+	Intron	DEL	A	A	-	rs138037746		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																n.68-235del			ENST00000417843		6	4	2	7	7	0	RP11-764K9.1,intron_variant,,ENST00000417843,;RNA5SP284,upstream_gene_variant,,ENST00000384547,;,regulatory_region_variant,,ENSR00001753230,;,TF_binding_site_variant,,ENSM00527702866,;	-	ENSG00000225411	ENST00000417843	Transcript	intron_variant,non_coding_transcript_variant						rs138037746	1		-1	RP11-764K9.1	Clone_based_vega_gene		lincRNA	YES										1/4																		MODIFIER	1	deletion														.	GCAG	.	.																					68407615
RP11-764K9.4	0	.	GRCh37	9	68430022	68430025	+	Intron	DEL	CAAA	CAAA	-	rs112735354		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAAA	CAAA																n.787+145_787+148del			ENST00000376334		38	.	3	40	.	0	RP11-764K9.4,intron_variant,,ENST00000376334,;	-	ENSG00000215548	ENST00000376334	Transcript	intron_variant,non_coding_transcript_variant						rs112735354	1		-1	RP11-764K9.4	Clone_based_vega_gene		unprocessed_pseudogene	YES										7/8																		MODIFIER	1	deletion														.	CTCAAAC	.	.																					68430021
RP11-764K9.4	0	.	GRCh37	9	68438314	68438314	+	Intron	DEL	T	T	-	rs1235743462		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																n.412+244del			ENST00000376334		6	4	2	7	7	0	RP11-764K9.4,intron_variant,,ENST00000376334,;	-	ENSG00000215548	ENST00000376334	Transcript	intron_variant,non_coding_transcript_variant						rs1235743462	1		-1	RP11-764K9.4	Clone_based_vega_gene		unprocessed_pseudogene	YES										3/8																		MODIFIER	1	deletion														.	TATT	.	.																					68438313
RP11-764K9.4	0	.	GRCh37	9	68439545	68439545	+	Intron	DEL	C	C	-	rs1267075856		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																n.287-862del			ENST00000376334		3	.	3	0	.	0	RP11-764K9.4,intron_variant,,ENST00000376334,;	-	ENSG00000215548	ENST00000376334	Transcript	intron_variant,non_coding_transcript_variant						rs1267075856	1		-1	RP11-764K9.4	Clone_based_vega_gene		unprocessed_pseudogene	YES										2/8																		MODIFIER	1	deletion														.	GTCT	.	.																					68439544
RP11-460N11.2	0	.	GRCh37	9	69837149	69837153	+	Intron	DEL	ATTAA	ATTAA	-	rs140843738		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATTAA	ATTAA																n.258+2395_258+2399del			ENST00000455242		4	.	4	0	.	0	RP11-460N11.2,intron_variant,,ENST00000455242,;	-	ENSG00000197550	ENST00000455242	Transcript	intron_variant,non_coding_transcript_variant						rs140843738	1		1	RP11-460N11.2	Clone_based_vega_gene		unprocessed_pseudogene	YES										3/4																		MODIFIER	1	deletion														.	AGATTAAA	.	.																					69837148
APBA1	320	.	GRCh37	9	72177297	72177297	+	Intron	DEL	T	T	-	rs11393335		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.-69-45102del			ENST00000265381		3	.	3	0	.	0	APBA1,intron_variant,,ENST00000265381,NM_001163.3;	-	ENSG00000107282	ENST00000265381	Transcript	intron_variant						rs11393335	1		-1	APBA1	HGNC	578	protein_coding	YES	CCDS6630.1	ENSP00000265381	Q02410		UPI000013D611	NM_001163.3				1/12																		MODIFIER	1	deletion														.	TCTT	.	.																					72177296
MAMDC2	256691	.	GRCh37	9	72786253	72786254	+	Intron	INS	-	-	T	rs11376987		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1651+716dup			ENST00000377182		3	.	3	0	.	0	MAMDC2,intron_variant,,ENST00000377182,NM_153267.4;MAMDC2-AS1,intron_variant,,ENST00000377178,;MAMDC2-AS1,intron_variant,,ENST00000448377,;MAMDC2-AS1,intron_variant,,ENST00000535188,;MAMDC2-AS1,intron_variant,,ENST00000591368,;MAMDC2-AS1,downstream_gene_variant,,ENST00000420573,;MAMDC2,downstream_gene_variant,,ENST00000460688,;	T	ENSG00000165072	ENST00000377182	Transcript	intron_variant						rs11376987	1		1	MAMDC2	HGNC	23673	protein_coding	YES	CCDS6631.1	ENSP00000366387	Q7Z304		UPI000013E44F	NM_153267.4				11/13			0.7239	0.7925		0.7222	0.7495	0.6401										MODIFIER	1	insertion														.	AAT	.	.																					72786253
TRPM3	80036	.	GRCh37	9	73913011	73913011	+	Intron	DEL	A	A	-	rs11288806		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.183+148558del			ENST00000357533		3	.	3	0	.	0	TRPM3,intron_variant,,ENST00000357533,;TRPM3,intron_variant,,ENST00000423814,;TRPM3,intron_variant,,ENST00000354500,;	-	ENSG00000083067	ENST00000357533	Transcript	intron_variant						rs11288806	1		-1	TRPM3	HGNC	17992	protein_coding			ENSP00000350140		H7BYP1,A2A3F7	UPI000066DA55					1/24			0.1059	0.3242		0.255	0.174	0.1421										MODIFIER		deletion													1	.	AGAA	.	.																					73913010
ENSR00001753830	0	.	GRCh37	9	74905012	74905013	+	IGR	INS	-	-	C	rs144246432		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001753830		4	.	4	0	.	0	,regulatory_region_variant,,ENSR00001753830,;	C		ENSR00001753830	RegulatoryFeature	regulatory_region_variant						rs144246432	1																				0.7799	0.5735		0.244	0.6471	0.4376										MODIFIER	1	insertion														.	TGC	.	.																					74905012
ZFAND5	7763	.	GRCh37	9	74971755	74971755	+	Intron	DEL	A	A	-	rs1291969582		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.493+92del			ENST00000237937		4	.	4	0	.	0	ZFAND5,intron_variant,,ENST00000237937,NM_006007.3,NM_001102421.2,NM_001278244.1;ZFAND5,intron_variant,,ENST00000343431,NM_001278245.1,NM_001278243.1;ZFAND5,intron_variant,,ENST00000376960,;ZFAND5,intron_variant,,ENST00000376962,NM_001102420.2;ZFAND5,downstream_gene_variant,,ENST00000376956,;ZFAND5,intron_variant,,ENST00000471197,;ZFAND5,intron_variant,,ENST00000488164,;ZFAND5,downstream_gene_variant,,ENST00000487330,;,regulatory_region_variant,,ENSR00001753843,;	-	ENSG00000107372	ENST00000237937	Transcript	intron_variant						rs1291969582,COSV52988528	1		-1	ZFAND5	HGNC	13008	protein_coding	YES	CCDS6642.1	ENSP00000237937	O76080		UPI000013C322	NM_006007.3,NM_001102421.2,NM_001278244.1				5/5												0,1						MODIFIER	1	deletion			0,1											.	TTAT	.	.																					74971754
TMC1	117531	.	GRCh37	9	75270658	75270658	+	Intron	DEL	A	A	-	rs34249073		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.16+7089del			ENST00000297784		8	.	4	8	.	0	TMC1,intron_variant,,ENST00000297784,NM_138691.2;TMC1,intron_variant,,ENST00000340019,;TMC1,intron_variant,,ENST00000396237,;TMC1,downstream_gene_variant,,ENST00000492418,;RPS20P24,downstream_gene_variant,,ENST00000457473,;	-	ENSG00000165091	ENST00000297784	Transcript	intron_variant						rs34249073	1		1	TMC1	HGNC	16513	protein_coding	YES	CCDS6643.1	ENSP00000297784	Q8TDI8		UPI0000161FA9	NM_138691.2				5/23			0.7821	0.4712		0.4425	0.4294	0.4387										MODIFIER	1	deletion													1	.	TCAA	.	.																					75270657
ANXA1	301	.	GRCh37	9	75783796	75783797	+	Intron	INS	-	-	GTGTGTGTGT	rs3832643		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.862-129_862-120dup			ENST00000376911		6	.	3	26	.	0	ANXA1,intron_variant,,ENST00000257497,NM_000700.1;ANXA1,intron_variant,,ENST00000376911,;ANXA1,non_coding_transcript_exon_variant,,ENST00000491192,;ANXA1,downstream_gene_variant,,ENST00000489109,;ANXA1,downstream_gene_variant,,ENST00000495713,;	GTGTGTGTGT	ENSG00000135046	ENST00000376911	Transcript	intron_variant						rs3832643	1		1	ANXA1	HGNC	533	protein_coding	YES	CCDS6645.1	ENSP00000366109	P04083	Q5TZZ9,Q5T3N0,Q05BR2	UPI0000001C4C					10/11																		MODIFIER	1	insertion														.	AGG	.	.																					75783796
Unknown	0	.	GRCh37	9	83592756	83592757	+	IGR	INS	-	-	T	rs35794446		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs35794446	1																																			MODIFIER	1	insertion														.	TCT	.	.																					83592756
TLE1	7088	.	GRCh37	9	84248213	84248214	+	Intron	INS	-	-	GT	rs56327119		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.594+59_594+60insAC			ENST00000376499		29	.	6	26	.	0	TLE1,intron_variant,,ENST00000376472,;TLE1,intron_variant,,ENST00000376499,NM_005077.3;TLE1,intron_variant,,ENST00000418319,;TLE1,downstream_gene_variant,,ENST00000376463,;	GTGTGTGTGTGT	ENSG00000196781	ENST00000376499	Transcript	intron_variant						rs56327119	2		-1	TLE1	HGNC	11837	protein_coding	YES	CCDS6661.1	ENSP00000365682	Q04724		UPI0000137034	NM_005077.3				8/19																		MODIFIER	1	sequence_alteration														.	CCGTGTGTGTGTG	.	.																					84248203
RP11-15B24.5	0	.	GRCh37	9	85090719	85090722	+	Intron	DEL	CTGC	CTGC	-	rs36142154		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTGC	CTGC																n.279-16141_279-16138del			ENST00000586399		4	.	4	0	.	0	RP11-15B24.5,intron_variant,,ENST00000586399,;RP11-15B24.5,intron_variant,,ENST00000590298,;RP11-15B24.5,intron_variant,,ENST00000590791,;RP11-15B24.5,intron_variant,,ENST00000591257,;	-	ENSG00000228430	ENST00000586399	Transcript	intron_variant,non_coding_transcript_variant						rs36142154	1		1	RP11-15B24.5	Clone_based_vega_gene		lincRNA											3/5			0.4312	0.3588		0.5427	0.2644	0.2791										MODIFIER	1	deletion														.	GTCTGCC	.	.																					85090718
Unknown	0	.	GRCh37	9	87082268	87082269	+	IGR	INS	-	-	T	rs1282114510		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	4	2	6	6	0		T				intergenic_variant						rs1282114510	1																																			MODIFIER	1	insertion														.	TGG	.	.																					87082268
Unknown	0	.	GRCh37	9	87941019	87941019	+	IGR	DEL	A	A	-	rs34258384		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					6	.	3	3	.	0		-				intergenic_variant						rs34258384	1																				0.4871	0.6513		0.8581	0.7594	0.7863										MODIFIER	1	deletion														.	AGAA	.	.																					87941018
Unknown	0	.	GRCh37	9	88072615	88072616	+	IGR	INS	-	-	G	rs11408340		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		G				intergenic_variant						rs11408340	1																																			MODIFIER	1	insertion														.	ACG	.	.																					88072615
DAPK1	1612	.	GRCh37	9	90167246	90167247	+	Intron	INS	-	-	GAAGGGATATCTGCAGCTGGAA	rs6151066		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.63-52622_63-52621insAAGGGATATCTGCAGCTGGAAG			ENST00000408954		3	.	3	0	.	0	DAPK1,intron_variant,,ENST00000358077,NM_001288731.1;DAPK1,intron_variant,,ENST00000408954,NM_004938.2;DAPK1,intron_variant,,ENST00000469640,;DAPK1,intron_variant,,ENST00000472284,NM_001288729.1,NM_001288730.1;DAPK1,intron_variant,,ENST00000491893,;DAPK1-IT1,upstream_gene_variant,,ENST00000431813,;DAPK1,intron_variant,,ENST00000472344,;DAPK1,intron_variant,,ENST00000496522,;DAPK1,intron_variant,,ENST00000469067,;DAPK1,intron_variant,,ENST00000489291,;,regulatory_region_variant,,ENSR00001755309,;	GAAGGGATATCTGCAGCTGGAA	ENSG00000196730	ENST00000408954	Transcript	intron_variant						rs6151066	1		1	DAPK1	HGNC	2674	protein_coding	YES	CCDS43842.1	ENSP00000386135	P53355		UPI0000210C2F	NM_004938.2				2/25			0.1445	0.1513		0.0456	0.3002	0.1145										MODIFIER	1	insertion														.	AGG	.	.																					90167246
DAPK1	1612	.	GRCh37	9	90327963	90327964	+	3'Flank	DEL	TG	TG	-	rs72407569		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																			ENST00000408954		7	3	4	5	5	0	DAPK1,downstream_gene_variant,,ENST00000358077,NM_001288731.1;DAPK1,downstream_gene_variant,,ENST00000408954,NM_004938.2;DAPK1,downstream_gene_variant,,ENST00000469640,;DAPK1,downstream_gene_variant,,ENST00000472284,NM_001288729.1,NM_001288730.1;,regulatory_region_variant,,ENSR00001755335,;	-	ENSG00000196730	ENST00000408954	Transcript	downstream_gene_variant						rs72407569	1	4420	1	DAPK1	HGNC	2674	protein_coding	YES	CCDS43842.1	ENSP00000386135	P53355		UPI0000210C2F	NM_004938.2																						MODIFIER	1	deletion														.	TTTGT	.	.																					90327962
ENSR00001755402	0	.	GRCh37	9	90851862	90851863	+	IGR	INS	-	-	T	rs138567735		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001755402		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001755402,;	T		ENSR00001755402	RegulatoryFeature	regulatory_region_variant						rs138567735	1																			0.0717	0.0507	0.0519		0.0784	0.1213	0.0562										MODIFIER	1	insertion														.	CCG	.	.																					90851862
NXNL2	158046	.	GRCh37	9	91181910	91181911	+	Intron	INS	-	-	CTATCTATCTATCTAC	rs34244217		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.303-4077_303-4076insCCTATCTATCTATCTA			ENST00000375855		3	.	3	0	.	0	NXNL2,intron_variant,,ENST00000375855,NM_145283.2;NXNL2,intron_variant,,ENST00000478686,;	CTATCTATCTATCTAC	ENSG00000130045	ENST00000375855	Transcript	intron_variant						rs34244217	1		1	NXNL2	HGNC	30482	protein_coding		CCDS6679.1	ENSP00000365015	Q5VZ03		UPI000013CD57	NM_145283.2				1/2																		MODIFIER	1	insertion														.	ATC	.	.																					91181910
Unknown	0	.	GRCh37	9	97243128	97243130	+	IGR	DEL	TTG	TTG	-	rs74396308		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTG	TTG																					3	.	3	0	.	0		-				intergenic_variant						rs74396308	1																				0.2625	0.5029		0.3403	0.3171	0.2781										MODIFIER	1	deletion														.	TTTTGT	.	.																					97243127
Unknown	0	.	GRCh37	9	100523095	100523096	+	IGR	INS	-	-	C	rs139767705		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		C				intergenic_variant						rs139767705	1																				0.115	0.1037		0.2034	0.0686	0.0613										MODIFIER	1	insertion														.	CTC	.	.																					100523095
GABBR2	9568	.	GRCh37	9	101267705	101267706	+	Intron	INS	-	-	GT	rs59702034		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.631-8911_631-8910dup			ENST00000259455		6	3	3	4	4	0	GABBR2,intron_variant,,ENST00000259455,NM_005458.7;GABBR2,intron_variant,,ENST00000477471,;	GT	ENSG00000136928	ENST00000259455	Transcript	intron_variant						rs59702034	1		-1	GABBR2	HGNC	4507	protein_coding	YES	CCDS6736.1	ENSP00000259455	O75899	H9NIL8	UPI0000035832	NM_005458.7				3/18																		MODIFIER	1	insertion													1	.	AGG	.	.																					101267705
Unknown	0	.	GRCh37	9	104835094	104835095	+	IGR	INS	-	-	CCTGTCTACAG	rs57319360		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		CCTGTCTACAG				intergenic_variant						rs57319360	1																				0.0877	0.1787		0.0794	0.3479	0.2526										MODIFIER	1	insertion														.	TTC	.	.																					104835094
Unknown	0	.	GRCh37	9	107712928	107712931	+	IGR	DEL	CTCA	CTCA	-	rs58000150		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTCA	CTCA																					3	.	3	0	.	0		-				intergenic_variant						rs58000150	1																				0.4138	0.1412		0.002	0.1451	0.1268										MODIFIER	1	deletion														.	GTCTCAC	.	.																					107712927
RP11-308N19.4	100996590	.	GRCh37	9	109393806	109393807	+	Intron	INS	-	-	TATTTTTGGTAAATAATGGTTTTCCATGGTTTGTGTATGTTTGGGTACTTTGATATTTTATGTACAGTATATAATACA	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.260-6628_260-6627insTGGTAAATAATGGTTTTCCATGGTTTGTGTATGTTTGGGTACTTTGATATTTTATGTACAGTATATAATACATATTTT			ENST00000444985		3	.	3	0	.	0	RP11-308N19.4,intron_variant,,ENST00000444985,;	TATTTTTGGTAAATAATGGTTTTCCATGGTTTGTGTATGTTTGGGTACTTTGATATTTTATGTACAGTATATAATACA	ENSG00000234229	ENST00000444985	Transcript	intron_variant,non_coding_transcript_variant							1		1	RP11-308N19.4	Clone_based_vega_gene		lincRNA	YES										1/6																		MODIFIER	1	insertion														.	GGT	.	.																					109393806
Unknown	0	.	GRCh37	9	116511364	116511365	+	IGR	INS	-	-	TG	rs34948305		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		TG				intergenic_variant						rs34948305	1																				0.882	0.8256		0.9643	0.7445	0.8098										MODIFIER	1	insertion														.	ACT	.	.																					116511364
DFNB31	25861	.	GRCh37	9	117242761	117242762	+	Intron	INS	-	-	AGAG	rs57662659		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.619-1714_619-1711dup			ENST00000362057		5	.	3	3	.	0	DFNB31,intron_variant,,ENST00000265134,NM_001083885.2;DFNB31,intron_variant,,ENST00000362057,NM_001173425.1,NM_015404.3;DFNB31,intron_variant,,ENST00000374057,;,regulatory_region_variant,,ENSR00001463062,;	AGAG	ENSG00000095397	ENST00000362057	Transcript	intron_variant						rs57662659	1		-1	DFNB31	HGNC	16361	protein_coding	YES	CCDS6806.1	ENSP00000354623	Q9P202		UPI00001C1EA6	NM_001173425.1,NM_015404.3				1/11			0.8048	0.5865		0.4206	0.4811	0.455										MODIFIER	1	insertion													1	.	GAA	.	.																					117242761
TNC	3371	.	GRCh37	9	117849978	117849979	+	Intron	DEL	TT	TT	-	rs752435283		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																c.458-427_458-426del			ENST00000350763		3	.	3	0	.	0	TNC,intron_variant,,ENST00000340094,;TNC,intron_variant,,ENST00000341037,;TNC,intron_variant,,ENST00000345230,;TNC,intron_variant,,ENST00000346706,;TNC,intron_variant,,ENST00000350763,NM_002160.3;TNC,intron_variant,,ENST00000423613,;TNC,intron_variant,,ENST00000535648,;TNC,intron_variant,,ENST00000537320,;TNC,intron_variant,,ENST00000542877,;TNC,downstream_gene_variant,,ENST00000534839,;,regulatory_region_variant,,ENSR00001758471,;,regulatory_region_variant,,ENSR00001758472,;	-	ENSG00000041982	ENST00000350763	Transcript	intron_variant						rs752435283	1		-1	TNC	HGNC	5318	protein_coding	YES	CCDS6811.1	ENSP00000265131	P24821	F5H5D6	UPI000013D5BD	NM_002160.3				2/27																		MODIFIER	1	deletion													1	.	TCTTT	.	.																					117849977
ASTN2	23245	.	GRCh37	9	119214111	119214112	+	Intron	INS	-	-	TCTG	rs34661668		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.3345-9283_3345-9280dup			ENST00000361209		3	.	3	0	.	0	ASTN2,intron_variant,,ENST00000288520,NM_198186.3;ASTN2,intron_variant,,ENST00000313400,;ASTN2,intron_variant,,ENST00000341734,NM_198187.3,NM_198188.2,NM_001184734.1;ASTN2,intron_variant,,ENST00000361209,NM_014010.4;ASTN2,intron_variant,,ENST00000361477,;ASTN2,intron_variant,,ENST00000373986,;ASTN2,intron_variant,,ENST00000373996,;,regulatory_region_variant,,ENSR00001463532,;	TCTG	ENSG00000148219	ENST00000361209	Transcript	intron_variant						rs34661668	1		-1	ASTN2	HGNC	17021	protein_coding	YES	CCDS6815.1	ENSP00000354504	O75129	B7ZKP3,B2RCB6	UPI00002116D7	NM_014010.4				19/21			0.8858	0.7522		0.7917	0.665	0.7873										MODIFIER	1	insertion														.	GAT	.	.																					119214111
ASTN2	23245	.	GRCh37	9	119909717	119909718	+	Intron	INS	-	-	AC	rs35703147		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1016-51289_1016-51288dup			ENST00000361209		3	.	3	0	.	0	ASTN2,intron_variant,,ENST00000313400,;ASTN2,intron_variant,,ENST00000361209,NM_014010.4;ASTN2,intron_variant,,ENST00000361477,;ASTN2,intron_variant,,ENST00000373986,;ASTN2,intron_variant,,ENST00000373996,;	AC	ENSG00000148219	ENST00000361209	Transcript	intron_variant						rs35703147	1		-1	ASTN2	HGNC	17021	protein_coding	YES	CCDS6815.1	ENSP00000354504	O75129	B7ZKP3,B2RCB6	UPI00002116D7	NM_014010.4				3/21																		MODIFIER	1	insertion														.	AAA	.	.																					119909717
Unknown	0	.	GRCh37	9	121293330	121293330	+	IGR	DEL	A	A	-	rs59188768		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs59188768	1																				0.3654	0.3415		0.2063	0.4274	0.4847										MODIFIER	1	deletion														.	CTAA	.	.																					121293329
TRAF1	7185	.	GRCh37	9	123677491	123677491	+	Intron	DEL	G	G	-	rs11331426		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.229-913del			ENST00000373887		3	.	3	2	.	0	TRAF1,intron_variant,,ENST00000373887,NM_005658.4;TRAF1,intron_variant,,ENST00000540010,NM_001190945.1;TRAF1,upstream_gene_variant,,ENST00000546084,NM_001190947.1;,regulatory_region_variant,,ENSR00001464283,;	-	ENSG00000056558	ENST00000373887	Transcript	intron_variant						rs11331426,COSV65869014	1		-1	TRAF1	HGNC	12031	protein_coding	YES	CCDS6825.1	ENSP00000362994	Q13077		UPI0000001079	NM_005658.4				3/7		0.4537	0.112	0.5634		0.502	0.5636	0.6748				0,1						MODIFIER	1	deletion			0,1											.	ATGT	.	.																					123677490
RP11-343J18.2	0	.	GRCh37	9	128920807	128920810	+	Intron	DEL	GCGT	GCGT	-	rs55678398		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GCGT	GCGT																n.236-1002_236-999del			ENST00000441473		4	.	4	0	.	0	RP11-343J18.2,intron_variant,,ENST00000441473,;	-	ENSG00000232413	ENST00000441473	Transcript	intron_variant,non_coding_transcript_variant						rs55678398	1		1	RP11-343J18.2	Clone_based_vega_gene		lincRNA	YES										1/1																		MODIFIER	1	deletion														.	GCGCGTG	.	.																					128920806
LMX1B	4010	.	GRCh37	9	129431521	129431523	+	Intron	DEL	GAG	GAG	-	rs35558800		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAG	GAG																c.327-21590_327-21588del			ENST00000355497		4	.	4	0	.	0	LMX1B,intron_variant,,ENST00000355497,NM_001174146.1;LMX1B,intron_variant,,ENST00000373474,;LMX1B,intron_variant,,ENST00000425646,NM_001174147.1,NM_002316.3;LMX1B,intron_variant,,ENST00000526117,;LMX1B,intron_variant,,ENST00000561065,;	-	ENSG00000136944	ENST00000355497	Transcript	intron_variant						rs35558800	1		1	LMX1B	HGNC	6654	protein_coding	YES	CCDS55343.1	ENSP00000347684	O60663	Q9UE66,B7ZLH2	UPI0001CE94D0	NM_001174146.1				2/7			0.5582	0.4078		0.5466	0.4523	0.4274										MODIFIER	1	deletion													1	.	GCGAGG	.	.																					129431520
FNBP1	23048	.	GRCh37	9	132685991	132685991	+	Intron	DEL	T	T	-	rs11290705		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1170+132del			ENST00000446176		4	.	4	0	.	0	FNBP1,intron_variant,,ENST00000355681,;FNBP1,intron_variant,,ENST00000420781,;FNBP1,intron_variant,,ENST00000446176,NM_015033.2;FNBP1,intron_variant,,ENST00000449089,;FNBP1,upstream_gene_variant,,ENST00000443566,;FNBP1,intron_variant,,ENST00000478129,;FNBP1,intron_variant,,ENST00000482107,;	-	ENSG00000187239	ENST00000446176	Transcript	intron_variant						rs11290705	1		-1	FNBP1	HGNC	17069	protein_coding	YES	CCDS48040.1	ENSP00000413625	Q96RU3	B7ZL12	UPI000022408C	NM_015033.2				10/16																		MODIFIER	1	deletion													1	.	TGTT	.	.																					132685990
GTF3C5	9328	.	GRCh37	9	135906038	135906038	+	5'Flank	DEL	A	A	-	rs8193015		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000372108		3	.	3	0	.	0	GTF3C5,upstream_gene_variant,,ENST00000342018,;GTF3C5,upstream_gene_variant,,ENST00000372095,;GTF3C5,upstream_gene_variant,,ENST00000372097,NM_012087.3;GTF3C5,upstream_gene_variant,,ENST00000372099,;GTF3C5,upstream_gene_variant,,ENST00000372108,NM_001122823.1;GTF3C5,upstream_gene_variant,,ENST00000439697,;GTF3C5,upstream_gene_variant,,ENST00000440319,;GTF3C5,upstream_gene_variant,,ENST00000485692,;,regulatory_region_variant,,ENSR00000242528,;	-	ENSG00000148308	ENST00000372108	Transcript	upstream_gene_variant						rs8193015	1	353	1	GTF3C5	HGNC	4668	protein_coding	YES	CCDS48050.1	ENSP00000361180	Q9Y5Q8	Q5T7U0	UPI000046FE5A	NM_001122823.1							0.3336	0.3228		0.2361	0.3648	0.1912										MODIFIER	1	deletion														.	TCAA	.	.																					135906037
VAV2	7410	.	GRCh37	9	136839020	136839024	+	Intron	DEL	CAGAA	CAGAA	-	rs150760277		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAGAA	CAGAA																c.204+18173_204+18177del			ENST00000371850		4	.	4	0	.	0	VAV2,intron_variant,,ENST00000371850,NM_001134398.1;VAV2,intron_variant,,ENST00000371851,;VAV2,intron_variant,,ENST00000406606,NM_003371.3;VAV2,intron_variant,,ENST00000486113,;,regulatory_region_variant,,ENSR00001760776,;	-	ENSG00000160293	ENST00000371850	Transcript	intron_variant						rs150760277	1		-1	VAV2	HGNC	12658	protein_coding	YES	CCDS48053.1	ENSP00000360916	P52735		UPI000013E06E	NM_001134398.1				1/29																		MODIFIER	1	deletion														.	GGCAGAAA	.	.																					136839019
ENSR00001760824	0	.	GRCh37	9	137168340	137168349	+	IGR	DEL	GCCGGCCCCA	GCCGGCCCCA	-	rs76142093		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GCCGGCCCCA	GCCGGCCCCA																			ENSR00001760824		5	.	5	0	.	0	,regulatory_region_variant,,ENSR00001760824,;	-		ENSR00001760824	RegulatoryFeature	regulatory_region_variant						rs76142093	1																				0.0053	0.0562			0.0815	0.0307										MODIFIER	1	deletion														.	CTGCCGGCCCCAG	.	.																					137168339
COL5A1	1289	.	GRCh37	9	137577787	137577790	+	Intron	DEL	CCAT	CCAT	-	rs146827064		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCAT	CCAT																c.110-4956_110-4953del			ENST00000371817		7	4	3	4	4	0	COL5A1,intron_variant,,ENST00000371817,NM_001278074.1,NM_000093.4;COL5A1,intron_variant,,ENST00000464187,;	-	ENSG00000130635	ENST00000371817	Transcript	intron_variant						rs146827064	1		1	COL5A1	HGNC	2209	protein_coding	YES	CCDS6982.1	ENSP00000360882	P20908	Q9UML4,Q96HC0,Q59EE7	UPI0000210EE3	NM_001278074.1,NM_000093.4				1/65			0.0688	0.1729		0.0873	0.1879	0.1401										MODIFIER	1	deletion													1	.	CACCATC	.	.																					137577786
Unknown	0	.	GRCh37	9	138091218	138091238	+	IGR	DEL	ACTGGGAGAAAGGAAGCCAGC	ACTGGGAGAAAGGAAGCCAGC	-	rs151143420		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACTGGGAGAAAGGAAGCCAGC	ACTGGGAGAAAGGAAGCCAGC																					3	.	3	0	.	0		-				intergenic_variant						rs151143420	1																			0.1733	0.3101	0.1095		0.0427	0.2187	0.1217										MODIFIER	1	deletion														.	TAACTGGGAGAAAGGAAGCCAGCC	.	.																					138091217
Unknown	0	.	GRCh37	9	138195904	138195905	+	IGR	INS	-	-	TGGA	rs56107667		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					7	4	3	4	4	0		TGGA				intergenic_variant						rs56107667	1																				0.354	0.2176		0.2153	0.2962	0.2239										MODIFIER	1	insertion														.	GGT	.	.																					138195904
NELFB	25920	.	GRCh37	9	140161636	140161642	+	Intron	DEL	GGCTGAG	GGCTGAG	AG	rs544060553		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GGCTGAG	GGCTGAG																c.1239-56_1239-52del			ENST00000343053		23	.	12	8	.	8	NELFB,intron_variant,,ENST00000343053,NM_015456.3;	GTGGAG	ENSG00000188986	ENST00000343053	Transcript	intron_variant						rs544060553	2		1	NELFB	HGNC	24324	protein_coding	YES	CCDS7040.1	ENSP00000339495	Q8WX92		UPI0000070699	NM_015456.3				9/12			0.5113	0.7421		0.4772	0.7097	0.6708										MODIFIER	1	sequence_alteration														.	GTGTGGGGCTGAGG	.	.																					140161631
ADARB2	105	.	GRCh37	10	1737815	1737816	+	Intron	DEL	GA	GA	-	rs5782591		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GA	GA																c.100+41429_100+41430del			ENST00000381312		6	.	4	7	.	0	ADARB2,intron_variant,,ENST00000381312,NM_018702.3;	-	ENSG00000185736	ENST00000381312	Transcript	intron_variant						rs5782591	1		-1	ADARB2	HGNC	227	protein_coding	YES	CCDS7058.1	ENSP00000370713	Q9NS39	Q5VW43	UPI0000071776	NM_018702.3				1/9			0.2587	0.6902		0.6567	0.5517	0.7178										MODIFIER	1	deletion														.	GTGAG	.	.																					1737814
ADARB2	105	.	GRCh37	10	1739166	1739166	+	Intron	DEL	T	T	-	rs11404553		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.100+40079del			ENST00000381312		3	.	3	0	.	0	ADARB2,intron_variant,,ENST00000381312,NM_018702.3;	-	ENSG00000185736	ENST00000381312	Transcript	intron_variant						rs11404553	1		-1	ADARB2	HGNC	227	protein_coding	YES	CCDS7058.1	ENSP00000370713	Q9NS39	Q5VW43	UPI0000071776	NM_018702.3				1/9			0.1747	0.0922		0.2083	0.173	0.1166										MODIFIER	1	deletion														.	GATT	.	.																					1739165
Unknown	0	.	GRCh37	10	2400704	2400705	+	IGR	INS	-	-	GGCCA	rs138186582		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		GGCCA				intergenic_variant						rs138186582	1																																			MODIFIER	1	insertion														.	GCG	.	.																					2400704
Unknown	0	.	GRCh37	10	3062325	3062325	+	IGR	DEL	T	T	-	rs10707891		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					5	.	3	5	.	0		-				intergenic_variant						rs10707891	1																			0.2660	0.6339	0.1614		0.0615	0.1302	0.1933										MODIFIER	1	deletion														.	TATC	.	.																					3062324
RP11-464C19.2	0	.	GRCh37	10	3872814	3872815	+	5'Flank	INS	-	-	A	rs200974512		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000413339		6	.	3	3	.	0	RP11-464C19.2,upstream_gene_variant,,ENST00000413339,;	A	ENSG00000230573	ENST00000413339	Transcript	upstream_gene_variant						rs200974512	1	3327	1	RP11-464C19.2	Clone_based_vega_gene		lincRNA	YES													0.0008	0.0029		0.0129	0.005											MODIFIER	1	insertion														.	CCA	.	.																					3872814
ENSR00001516736	0	.	GRCh37	10	3993299	3993300	+	IGR	INS	-	-	A	rs71392421		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001516736		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001516736,;	A		ENSR00001516736	RegulatoryFeature	regulatory_region_variant						rs71392421	1																			0.6034	0.2655	0.7608		0.8085	0.6441	0.6953										MODIFIER	1	insertion														.	GGG	.	.																					3993299
Unknown	0	.	GRCh37	10	4610613	4610614	+	IGR	INS	-	-	CA	rs34142498		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	1	.	0		CA				intergenic_variant						rs34142498	1																				0.4501	0.647		0.6111	0.5149	0.5266										MODIFIER	1	insertion														.	AGC	.	.																					4610613
PROSER2	254427	.	GRCh37	10	11896619	11896619	+	Intron	DEL	T	T	-	rs11342646		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.138+2419del			ENST00000277570		3	.	3	0	.	0	PROSER2,intron_variant,,ENST00000277570,NM_153256.3;PROSER2,intron_variant,,ENST00000444604,;PROSER2-AS1,intron_variant,,ENST00000445498,;PROSER2-AS1,downstream_gene_variant,,ENST00000453242,;PROSER2,intron_variant,,ENST00000474155,;	-	ENSG00000148426	ENST00000277570	Transcript	intron_variant						rs11342646	1		1	PROSER2	HGNC	23728	protein_coding	YES	CCDS7085.1	ENSP00000277570	Q86WR7	D3DRR9	UPI00001F8B49	NM_153256.3				2/3																		MODIFIER	1	deletion														.	AGTT	.	.																					11896618
CCDC3	83643	.	GRCh37	10	12944829	12944830	+	Intron	INS	-	-	C	rs11369051		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.550-4151_550-4150insG			ENST00000378825		6	.	6	0	.	0	CCDC3,intron_variant,,ENST00000378825,NM_031455.3;CCDC3,intron_variant,,ENST00000378839,NM_001282658.1;,regulatory_region_variant,,ENSR00000969869,;,regulatory_region_variant,,ENSR00001517808,;	C	ENSG00000151468	ENST00000378825	Transcript	intron_variant						rs11369051	1		-1	CCDC3	HGNC	23813	protein_coding	YES	CCDS7093.1	ENSP00000368102	Q9BQI4	Q5VYV9	UPI000006E69C	NM_031455.3				2/2			0.7095	0.8919		0.7232	0.9314	0.8231										MODIFIER	1	insertion														.	TAG	.	.																					12944829
UCMA	221044	.	GRCh37	10	13261885	13261897	+	3'Flank	DEL	AAAACCCTGAAGT	AAAACCCTGAAGT	-	rs36009252		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAACCCTGAAGT	AAAACCCTGAAGT																			ENST00000378681		3	.	3	0	.	0	UCMA,downstream_gene_variant,,ENST00000378681,NM_145314.1;UCMA,downstream_gene_variant,,ENST00000463405,;RNU6-6P,downstream_gene_variant,,ENST00000606623,NR_002752.2;,regulatory_region_variant,,ENSR00000258238,;,regulatory_region_variant,,ENSR00001517844,;,TF_binding_site_variant,,ENSM00528839352,;,TF_binding_site_variant,,ENSM00529043564,;,TF_binding_site_variant,,ENSM00528710440,;,TF_binding_site_variant,,ENSM00529167900,;,TF_binding_site_variant,,ENSM00529341041,;,TF_binding_site_variant,,ENSM00528282441,;,TF_binding_site_variant,,ENSM00529153827,;	-	ENSG00000165623	ENST00000378681	Transcript	downstream_gene_variant						rs36009252	1	1870	-1	UCMA	HGNC	25205	protein_coding	YES	CCDS31147.1	ENSP00000367952	Q8WVF2		UPI000015F8FB	NM_145314.1							0.1589	0.183		0.3234	0.1183	0.138										MODIFIER	1	deletion														.	TGAAAACCCTGAAGTA	.	.																					13261884
HSPA14	51182	.	GRCh37	10	14882040	14882041	+	Intron	INS	-	-	AT	rs140243251		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.139-17_139-16dup			ENST00000378372		17	.	3	13	.	0	HSPA14,intron_variant,,ENST00000378372,NM_016299.3;HSPA14,intron_variant,,ENST00000437161,NM_001278205.1;HSPA14,intron_variant,,ENST00000441647,;CDNF,upstream_gene_variant,,ENST00000378442,;CDNF,upstream_gene_variant,,ENST00000465530,NM_001029954.2;HSPA14,intron_variant,,ENST00000493178,;HSPA14,intron_variant,,ENST00000493863,;CDNF,upstream_gene_variant,,ENST00000378441,;CDNF,upstream_gene_variant,,ENST00000466269,;	AT	ENSG00000187522	ENST00000378372	Transcript	intron_variant						rs140243251	1		1	HSPA14	HGNC	29526	protein_coding	YES	CCDS7103.1	ENSP00000367623	Q0VDF9	B4DYI5	UPI000013D6A8	NM_016299.3				2/13																		MODIFIER	1	insertion														.	TAA	.	.												0.002654	0.0002206	0.0008445	0.004697	0.0007185	0.002746	0.003712	0.002122	0.00288	14882040
FAM171A1	221061	.	GRCh37	10	15309884	15309885	+	Intron	INS	-	-	ACTAAGA	rs11281586		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.418+7969_418+7970insTCTTAGT			ENST00000378116		3	.	3	0	.	0	FAM171A1,intron_variant,,ENST00000378116,NM_001010924.1;FAM171A1,intron_variant,,ENST00000455654,;	ACTAAGA	ENSG00000148468	ENST00000378116	Transcript	intron_variant						rs11281586	1		-1	FAM171A1	HGNC	23522	protein_coding	YES	CCDS31154.1	ENSP00000367356	Q5VUB5		UPI00001414CA	NM_001010924.1				3/7			0.8956	0.9885		0.999	0.998	0.999										MODIFIER	1	insertion														.	TCA	.	.																					15309884
Unknown	0	.	GRCh37	10	16005417	16005417	+	IGR	DEL	A	A	-	rs61269546		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs61269546	1																				0.2814	0.2291		0.1815	0.2575	0.2505										MODIFIER	1	deletion														.	TGAA	.	.																					16005416
CUBN	8029	.	GRCh37	10	16868293	16868294	+	Intron	INS	-	-	CATATTTACATG	rs1554778713		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.10765-1213_10765-1212insCATGTAAATATG			ENST00000377833		4	.	4	0	.	0	CUBN,intron_variant,,ENST00000377833,NM_001081.3;	CATATTTACATG	ENSG00000107611	ENST00000377833	Transcript	intron_variant						rs1554778713	1		-1	CUBN	HGNC	2548	protein_coding	YES	CCDS7113.1	ENSP00000367064	O60494	B3KQA6	UPI00001AE8F4	NM_001081.3				66/66			0.4062	0.2911		0.2857	0.16	0.137										MODIFIER	1	insertion													1	.	AAC	.	.																					16868293
CUBN	8029	.	GRCh37	10	17110578	17110578	+	Intron	DEL	A	A	-	rs746874227		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.2791+26del			ENST00000377833		16	.	3	15	.	0	CUBN,intron_variant,,ENST00000377833,NM_001081.3;	-	ENSG00000107611	ENST00000377833	Transcript	intron_variant						rs746874227	1		-1	CUBN	HGNC	2548	protein_coding	YES	CCDS7113.1	ENSP00000367064	O60494	B3KQA6	UPI00001AE8F4	NM_001081.3				20/66																		MODIFIER	1	deletion													1	.	GGAA	.	.												0.006593	0.003922	0.009023	0.008349	0.006181	0.0022	0.006595	0.009358	0.008275	17110577
PTPLA	9200	.	GRCh37	10	17630198	17630199	+	3'Flank	INS	-	-	A	rs5783555		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000361271		3	.	3	0	.	0	PTPLA,downstream_gene_variant,,ENST00000361271,NM_014241.3;PTPLA,downstream_gene_variant,,ENST00000498812,;	A	ENSG00000165996	ENST00000361271	Transcript	downstream_gene_variant						rs5783555	1	1759	-1	PTPLA	HGNC	9639	protein_coding	YES	CCDS7121.1	ENSP00000355308	B0YJ81	J3KT94	UPI000036666A	NM_014241.3							1	0.9986		1	1	1										MODIFIER	1	insertion													1	.	TCA	.	.																					17630198
SVILP1	645954	.	GRCh37	10	31005791	31005792	+	Intron	DEL	AA	AA	-	rs377628660		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																n.2353-55_2353-54del			ENST00000422642		5	.	5	0	.	0	SVILP1,intron_variant,,ENST00000422642,;SVILP1,intron_variant,,ENST00000429171,;	-	ENSG00000234814	ENST00000422642	Transcript	intron_variant,non_coding_transcript_variant						rs377628660	1		1	SVILP1	HGNC	44959	transcribed_unprocessed_pseudogene	YES										16/17																		MODIFIER	1	deletion														.	TCAAA	.	.																					31005790
PARD3	56288	.	GRCh37	10	34726009	34726010	+	Intron	INS	-	-	AAAA	rs35137394		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.714+13235_714+13236insTTTT			ENST00000374789		3	.	3	0	.	0	PARD3,intron_variant,,ENST00000340077,NM_001184792.1;PARD3,intron_variant,,ENST00000346874,NM_001184787.1;PARD3,intron_variant,,ENST00000350537,NM_001184788.1,NM_001184789.1;PARD3,intron_variant,,ENST00000374773,NM_001184793.1;PARD3,intron_variant,,ENST00000374776,NM_001184794.1;PARD3,intron_variant,,ENST00000374788,NM_001184785.1;PARD3,intron_variant,,ENST00000374789,NM_019619.3;PARD3,intron_variant,,ENST00000374790,;PARD3,intron_variant,,ENST00000374794,NM_001184791.1;PARD3,intron_variant,,ENST00000545260,NM_001184790.1;PARD3,intron_variant,,ENST00000545693,NM_001184786.1;	AAAA	ENSG00000148498	ENST00000374789	Transcript	intron_variant						rs35137394	1		-1	PARD3	HGNC	16051	protein_coding	YES	CCDS7178.1	ENSP00000363921	Q8TEW0		UPI0000073A9F	NM_019619.3				5/24			0.3888	0.6412		0.5605	0.6799	0.5992										MODIFIER	1	insertion														.	TTA	.	.																					34726009
Unknown	0	.	GRCh37	10	42361335	42361336	+	IGR	INS	-	-	AC	rs370644911		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	4	2	5	5	0		AC				intergenic_variant						rs370644911	1																																			MODIFIER	1	insertion														.	GTA	.	.																					42361335
Unknown	0	.	GRCh37	10	42399094	42399095	+	IGR	INS	-	-	TT	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					24	21	3	31	0	0		TT				intergenic_variant							1																																			MODIFIER	1	insertion														.	TCT	.	.																					42399094
Unknown	0	.	GRCh37	10	42399681	42399682	+	IGR	INS	-	-	C	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					18	13	5	23	0	0		C				intergenic_variant							1																																			MODIFIER	1	insertion														.	CTT	.	.																					42399681
Unknown	0	.	GRCh37	10	42527766	42527767	+	IGR	INS	-	-	CC	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					74	63	11	58	0	0		CC				intergenic_variant							1																																			MODIFIER	1	insertion														.	AAA	.	.																					42527766
Unknown	0	.	GRCh37	10	42527767	42527768	+	IGR	INS	-	-	CT	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					102	65	37	61	0	0		CT				intergenic_variant							1																																			MODIFIER	1	insertion														.	AAC	.	.																					42527767
Unknown	0	.	GRCh37	10	42527811	42527812	+	IGR	INS	-	-	AA	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					36	31	5	60	0	0		AA				intergenic_variant							1																																			MODIFIER	1	insertion														.	ACA	.	.																					42527811
Unknown	0	.	GRCh37	10	42529101	42529101	+	IGR	DEL	G	G	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					151	124	27	140	0	0		-				intergenic_variant							1																																			MODIFIER	1	deletion														.	CAGA	.	.																					42529100
Unknown	0	.	GRCh37	10	42529122	42529122	+	IGR	DEL	A	A	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					201	154	47	152	0	0		-				intergenic_variant							1																																			MODIFIER	1	deletion														.	TTAC	.	.																					42529121
Unknown	0	.	GRCh37	10	42529124	42529124	+	IGR	DEL	A	A	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					188	153	35	156	0	0		-				intergenic_variant							1																																			MODIFIER	1	deletion														.	ACAA	.	.																					42529123
Unknown	0	.	GRCh37	10	42529126	42529127	+	IGR	INS	-	-	T	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					124	112	12	165	0	0		T				intergenic_variant							1																																			MODIFIER	1	insertion														.	AAC	.	.																					42529126
Unknown	0	.	GRCh37	10	42534904	42534905	+	IGR	INS	-	-	GA	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					87	54	32	71	71	0		GA				intergenic_variant							1																																			MODIFIER	1	insertion														.	CTA	.	.																					42534904
KSR1P1	0	.	GRCh37	10	42641878	42641879	+	3'Flank	INS	-	-	ATT	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000446298		6	4	2	4	4	0	KSR1P1,downstream_gene_variant,,ENST00000446298,;	ATT	ENSG00000229485	ENST00000446298	Transcript	downstream_gene_variant							1	2879	-1	KSR1P1	HGNC	44977	processed_pseudogene	YES																												MODIFIER	1	insertion														.	TCT	.	.																					42641878
Unknown	0	.	GRCh37	10	43394732	43394733	+	IGR	INS	-	-	ACTTCAGA	rs56864780		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		ACTTCAGA				intergenic_variant						rs56864780	1																				0.1944	0.1628		0.0397	0.3002	0.0787										MODIFIER	1	insertion														.	AGA	.	.																					43394732
Unknown	0	.	GRCh37	10	43774132	43774133	+	IGR	INS	-	-	G	rs57778074		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		G				intergenic_variant						rs57778074	1																				0.7224	0.9697		1	0.999	1										MODIFIER	1	insertion														.	TTG	.	.																					43774132
CEP164P1	0	.	GRCh37	10	45546611	45546612	+	Intron	INS	-	-	T	rs869158529		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.411+14363dup			ENST00000456938		3	.	3	0	.	0	CEP164P1,intron_variant,,ENST00000456938,;CEP164P1,intron_variant,,ENST00000598522,;CEP164P1,intron_variant,,ENST00000599308,;CEP164P1,intron_variant,,ENST00000602156,;DUXAP4,upstream_gene_variant,,ENST00000603046,;	T	ENSG00000226937	ENST00000456938	Transcript	intron_variant,non_coding_transcript_variant						rs869158529	1		-1	CEP164P1	HGNC	44988	processed_transcript	YES										5/6																		MODIFIER	1	insertion														.	ACT	.	.																					45546611
SGMS1	259230	.	GRCh37	10	52288605	52288607	+	Intron	DEL	AGA	AGA	-	rs10549824		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGA	AGA																c.-588-8926_-588-8924del			ENST00000361781		3	.	3	0	.	0	SGMS1,intron_variant,,ENST00000361781,NM_147156.3;SGMS1,intron_variant,,ENST00000429490,;SGMS1,intron_variant,,ENST00000608287,;SGMS1,intron_variant,,ENST00000609445,;	-	ENSG00000198964	ENST00000361781	Transcript	intron_variant						rs10549824	1		-1	SGMS1	HGNC	29799	protein_coding	YES	CCDS7240.1	ENSP00000354829		R4GNI5,D3DWC4,E6ZCI7	UPI000000D9FC	NM_147156.3				2/10			0.4009	0.1974		0.1081	0.2286	0.1074										MODIFIER	1	deletion														.	AGAGAA	.	.																					52288604
Unknown	0	.	GRCh37	10	57459545	57459545	+	IGR	DEL	A	A	-	rs11316730		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					8	.	8	0	.	0		-				intergenic_variant						rs11316730	1																				0.3389	0.3617		0.4187	0.5139	0.3712										MODIFIER	1	deletion														.	TGAA	.	.																					57459544
Unknown	0	.	GRCh37	10	58985278	58985279	+	IGR	INS	-	-	TAAG	rs35353871		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TAAG				intergenic_variant						rs35353871	1																				0.6188	0.3156		0.1895	0.3817	0.3885										MODIFIER	1	insertion														.	AAT	.	.																					58985278
Unknown	0	.	GRCh37	10	59003045	59003046	+	IGR	INS	-	-	CATTAAAT	rs71020969		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		CATTAAAT				intergenic_variant						rs71020969	1																				0.4463	0.1888		0.1885	0.1491	0.1871										MODIFIER	1	insertion														.	AAC	.	.																					59003045
Unknown	0	.	GRCh37	10	59409237	59409238	+	IGR	INS	-	-	AAC	rs71023769		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AAC				intergenic_variant						rs71023769	1																				0.1263	0.1311		0.0942	0.2386	0.1851										MODIFIER	1	insertion														.	CAA	.	.																					59409237
ARID5B	84159	.	GRCh37	10	63662433	63662434	+	Intron	DEL	TG	TG	-	rs59459790		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																c.276+288_276+289del			ENST00000279873		3	.	3	0	.	0	ARID5B,intron_variant,,ENST00000279873,NM_032199.2;,regulatory_region_variant,,ENSR00000979015,;,TF_binding_site_variant,,ENSM00641569828,;	-	ENSG00000150347	ENST00000279873	Transcript	intron_variant						rs59459790	1		1	ARID5B	HGNC	17362	protein_coding	YES	CCDS31208.1	ENSP00000279873	Q14865		UPI00001606F0	NM_032199.2				2/9			0.3623	0.3934		0.2411	0.4264	0.319										MODIFIER	1	deletion													1	.	GATGT	.	.																					63662432
ANXA2P3	0	.	GRCh37	10	66588809	66588810	+	3'Flank	INS	-	-	T	rs5785659		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000404883		4	.	4	0	.	0	ANXA2P3,downstream_gene_variant,,ENST00000404883,;	T	ENSG00000216740	ENST00000404883	Transcript	downstream_gene_variant						rs5785659	1	2473	1	ANXA2P3	HGNC	540	processed_pseudogene	YES													0.9743	0.8458		0.8284	0.83	0.8967										MODIFIER	1	insertion														.	TGT	.	.																					66588809
Unknown	0	.	GRCh37	10	67082034	67082035	+	IGR	DEL	AG	AG	-	rs138369397		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																					4	.	4	0	.	0		-				intergenic_variant						rs138369397	1																			0.1120	0.0091	0.2421		0.1319	0.171	0.0777										MODIFIER	1	deletion														.	ACAGG	.	.																					67082033
Unknown	0	.	GRCh37	10	67544956	67544957	+	IGR	DEL	GA	GA	-	rs10567763		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GA	GA																					5	.	3	4	.	0		-				intergenic_variant						rs10567763	1																																			MODIFIER	1	deletion														.	GCGAG	.	.																					67544955
CTNNA3	29119	.	GRCh37	10	67917250	67917265	+	Intron	DEL	TAGATAGATAGATAGA	TAGATAGATAGATAGA	-	rs34507083		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAGATAGATAGATAGA	TAGATAGATAGATAGA																c.1885-54258_1885-54243del			ENST00000433211		4	.	4	0	.	0	CTNNA3,intron_variant,,ENST00000373744,NM_001127384.1;CTNNA3,intron_variant,,ENST00000433211,NM_013266.2;	-	ENSG00000183230	ENST00000433211	Transcript	intron_variant						rs34507083	1		-1	CTNNA3	HGNC	2511	protein_coding	YES	CCDS7269.1	ENSP00000389714	Q9UI47	Q5SW23,A6NKP0	UPI000004A0E6	NM_013266.2				13/17																		MODIFIER	1	deletion													1	.	TGTAGATAGATAGATAGAT	.	.																					67917249
MYPN	84665	.	GRCh37	10	69919449	69919449	+	Intron	DEL	A	A	-	rs36077235		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1459+1065del			ENST00000358913		3	.	3	0	.	0	MYPN,intron_variant,,ENST00000354393,;MYPN,intron_variant,,ENST00000358913,NM_032578.3,NM_001256267.1;MYPN,intron_variant,,ENST00000373675,;MYPN,intron_variant,,ENST00000540630,;RN7SKP202,downstream_gene_variant,,ENST00000410439,;	-	ENSG00000138347	ENST00000358913	Transcript	intron_variant						rs36077235	1		1	MYPN	HGNC	23246	protein_coding	YES	CCDS7275.1	ENSP00000351790	Q86TC9	A5PKT7	UPI00002288CF	NM_032578.3,NM_001256267.1				7/19		0.5653	0.5371	0.719		0.3155	0.7008	0.6125										MODIFIER	1	deletion													1	.	TCAT	.	.																					69919448
SLC25A16	8034	.	GRCh37	10	70252644	70252644	+	Intron	DEL	G	-	-	rs201774649		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.610+245del			ENST00000609923		9	5	4	4	0	0	SLC25A16,intron_variant,,ENST00000539557,;SLC25A16,intron_variant,,ENST00000609923,NM_152707.3;SLC25A16,upstream_gene_variant,,ENST00000608053,;SLC25A16,intron_variant,,ENST00000265870,;SLC25A16,intron_variant,,ENST00000493963,;SLC25A16,downstream_gene_variant,,ENST00000474927,;,regulatory_region_variant,,ENSR00000980053,;	-	ENSG00000122912	ENST00000609923	Transcript	intron_variant						rs201774649	1		-1	SLC25A16	HGNC	10986	protein_coding	YES	CCDS7280.1	ENSP00000476815	P16260	B4DPV4	UPI00000704FB	NM_152707.3				6/8		0.0288	0.0045	0.036			0.0586	0.0552										MODIFIER	1	deletion														.	ACGT	.	.																					70252643
Unknown	0	.	GRCh37	10	72784203	72784204	+	IGR	INS	-	-	AAG	rs56345708		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AAG				intergenic_variant						rs56345708	1																				0.6785	0.7795		0.8552	0.7763	0.7362										MODIFIER	1	insertion														.	AAA	.	.																					72784203
PSAP	5660	.	GRCh37	10	73585325	73585338	+	Intron	DEL	GGCTGGCCTGAACG	GGCTGGCCTGAACG	-	rs145386313		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GGCTGGCCTGAACG	GGCTGGCCTGAACG																c.777+256_777+269del			ENST00000394936		4	.	4	0	.	0	PSAP,intron_variant,,ENST00000394934,NM_001042466.1,NM_001042465.1,NM_002778.2;PSAP,intron_variant,,ENST00000394936,;PSAP,upstream_gene_variant,,ENST00000493143,;,regulatory_region_variant,,ENSR00001523578,;	-	ENSG00000197746	ENST00000394936	Transcript	intron_variant						rs145386313	1		-1	PSAP	HGNC	9498	protein_coding	YES	CCDS7311.1	ENSP00000378394	P07602		UPI0000000DBF					7/13			0.0053	0.0159			0.0527	0.002										MODIFIER	1	deletion													1	.	ATGGCTGGCCTGAACGG	.	.																					73585324
ADK	132	.	GRCh37	10	76425495	76425504	+	Intron	DEL	GAGAGAGAGA	GAGAGAGAGA	-	rs59620474		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAGAGAGAGA	GAGAGAGAGA																c.878-4410_878-4401del			ENST00000286621		3	.	3	0	.	0	ADK,intron_variant,,ENST00000286621,NM_006721.3;ADK,intron_variant,,ENST00000372734,NM_001123.3,NM_001202449.1;ADK,intron_variant,,ENST00000539909,NM_001202450.1;ADK,intron_variant,,ENST00000541550,;	-	ENSG00000156110	ENST00000286621	Transcript	intron_variant						rs59620474	1		1	ADK	HGNC	257	protein_coding	YES	CCDS7343.1	ENSP00000286621	P55263	Q9HB33	UPI00001255EA	NM_006721.3				9/10			0.6543	0.7176		0.9058	0.5596	0.8384										MODIFIER	1	deletion													1	.	TTGAGAGAGAGAG	.	.																					76425494
Unknown	0	.	GRCh37	10	78570867	78570868	+	IGR	INS	-	-	GT	rs56773029		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		GT				intergenic_variant						rs56773029	1																																			MODIFIER	1	insertion														.	AAG	.	.																					78570867
KCNMA1	3778	.	GRCh37	10	79201352	79201352	+	Intron	DEL	T	T	-	rs35124298		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.379-37571del			ENST00000404857		6	.	6	0	.	0	KCNMA1,intron_variant,,ENST00000286627,NM_002247.3,NM_001271519.1;KCNMA1,intron_variant,,ENST00000286628,NM_001161352.1;KCNMA1,intron_variant,,ENST00000354353,;KCNMA1,intron_variant,,ENST00000372403,;KCNMA1,intron_variant,,ENST00000372408,;KCNMA1,intron_variant,,ENST00000372421,;KCNMA1,intron_variant,,ENST00000372437,;KCNMA1,intron_variant,,ENST00000372440,;KCNMA1,intron_variant,,ENST00000372443,;KCNMA1,intron_variant,,ENST00000404771,;KCNMA1,intron_variant,,ENST00000404857,NM_001161353.1;KCNMA1,intron_variant,,ENST00000406533,;KCNMA1,intron_variant,,ENST00000457953,;,regulatory_region_variant,,ENSR00000982352,;	-	ENSG00000156113	ENST00000404857	Transcript	intron_variant						rs35124298	1		-1	KCNMA1	HGNC	6284	protein_coding	YES	CCDS53545.1	ENSP00000385806	Q12791		UPI00003519E8	NM_001161353.1				1/27			0.0219	0.072		0.1548	0.1074	0.1677										MODIFIER	1	deletion													1	.	AATT	.	.																					79201351
Unknown	0	.	GRCh37	10	85261732	85261733	+	IGR	INS	-	-	T	rs5786607		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs5786607	1																				0.2542	0.5317		0.5208	0.66	0.6247										MODIFIER	1	insertion														.	ACT	.	.																					85261732
GRID1	2894	.	GRCh37	10	88058954	88058955	+	Intron	INS	-	-	TT	rs58078110		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.235+64742_235+64743dup			ENST00000327946		3	.	3	0	.	0	GRID1,intron_variant,,ENST00000327946,NM_017551.2;AL732479.1,downstream_gene_variant,,ENST00000459197,;GRID1,intron_variant,,ENST00000464741,;	TT	ENSG00000182771	ENST00000327946	Transcript	intron_variant						rs58078110	1		-1	GRID1	HGNC	4575	protein_coding	YES	CCDS31236.1	ENSP00000330148	Q9ULK0	B7Z7L0	UPI00001D8051	NM_017551.2				2/15																		MODIFIER	1	insertion														.	TCT	.	.																					88058954
Unknown	0	.	GRCh37	10	89780355	89780356	+	IGR	INS	-	-	A	rs5786799		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		A				intergenic_variant						rs5786799	1																				0.5514	0.6254		0.4216	0.666	0.8517										MODIFIER	1	insertion														.	CTA	.	.																					89780355
MYOF	26509	.	GRCh37	10	95063303	95063329	+	3'Flank	DEL	TTTTTTTTTTTTTTTTTTTTTTTTTTT	TTTTTTTTTTTTTTTTTTTTTTTTTTT	-	rs71028898		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTTTTTTTTTTTTTTTTTTTTTTTTT	TTTTTTTTTTTTTTTTTTTTTTTTTTT																			ENST00000359263		3	.	3	0	.	0	MYOF,downstream_gene_variant,,ENST00000358334,NM_133337.2;MYOF,downstream_gene_variant,,ENST00000359263,NM_013451.3;MYOF,downstream_gene_variant,,ENST00000371501,;MYOF,downstream_gene_variant,,ENST00000371502,;MYOF,downstream_gene_variant,,ENST00000463743,;,regulatory_region_variant,,ENSR00001525973,;	-	ENSG00000138119	ENST00000359263	Transcript	downstream_gene_variant						rs71028898	1	2858	-1	MYOF	HGNC	3656	protein_coding	YES	CCDS41551.1	ENSP00000352208	Q9NZM1		UPI000012FBA1	NM_013451.3																						MODIFIER	1	deletion														.	CCTTTTTTTTTTTTTTTTTTTTTTTTTTTT	.	.																					95063302
NOC3L	64318	.	GRCh37	10	96116875	96116877	+	Intron	DEL	ATG	ATG	-	rs1193357441		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATG	ATG																c.508+54_508+56del			ENST00000371361		54	.	30	60	.	60	NOC3L,intron_variant,,ENST00000371350,;NOC3L,intron_variant,,ENST00000371361,NM_022451.9;NOC3L,upstream_gene_variant,,ENST00000543788,;NOC3L,intron_variant,,ENST00000463649,;NOC3L,downstream_gene_variant,,ENST00000461562,;	-	ENSG00000173145	ENST00000371361	Transcript	intron_variant						rs1193357441	1		-1	NOC3L	HGNC	24034	protein_coding	YES	CCDS7433.1	ENSP00000360412	Q8WTT2		UPI000006DE09	NM_022451.9				4/20																		MODIFIER	1	deletion														.	ACATGA	.	.																					96116874
Unknown	0	.	GRCh37	10	96138234	96138235	+	IGR	INS	-	-	A	rs34139539		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		A				intergenic_variant						rs34139539	1																				0.1929	0.1628		0.3542	0.2396	0.3896										MODIFIER	1	insertion														.	TTA	.	.																					96138234
LINC00263	0	.	GRCh37	10	102147671	102147672	+	3'Flank	INS	-	-	T	rs113566154		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000454935		3	.	3	0	.	0	LINC00263,downstream_gene_variant,,ENST00000454935,;	T	ENSG00000235823	ENST00000454935	Transcript	downstream_gene_variant						rs113566154	1	4546	1	LINC00263	HGNC	28060	processed_transcript	YES												0.2991	0.4546	0.1686		0.246	0.1779	0.3609										MODIFIER	1	insertion														.	CCA	.	.																					102147671
SORCS3	22986	.	GRCh37	10	106846204	106846205	+	Intron	INS	-	-	GC	rs72505158		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1029-3328_1029-3327insCG			ENST00000369701		3	.	3	0	.	0	SORCS3,intron_variant,,ENST00000369701,NM_014978.1;	GC	ENSG00000156395	ENST00000369701	Transcript	intron_variant						rs72505158	1		1	SORCS3	HGNC	16699	protein_coding	YES	CCDS7558.1	ENSP00000358715	Q9UPU3	B7Z891	UPI0000135CE1	NM_014978.1				5/26			0.2315	0.3991		0.1716	0.2266	0.2515										MODIFIER	1	insertion														.	TGG	.	.																					106846204
ENSR00001527414	0	.	GRCh37	10	108184252	108184252	+	IGR	DEL	A	A	-	rs5787666		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENSR00001527414		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001527414,;	-		ENSR00001527414	RegulatoryFeature	regulatory_region_variant						rs5787666	1																				0.4607	0.1383		0.1726	0.0736	0.1616										MODIFIER	1	deletion														.	GCAA	.	.																					108184251
RP11-215N21.1	0	.	GRCh37	10	109657749	109657750	+	Intron	DEL	AT	AT	-	rs36002998		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																n.545-26239_545-26238del			ENST00000425050		4	.	4	0	.	0	RP11-215N21.1,intron_variant,,ENST00000425050,;RP11-215N21.1,intron_variant,,ENST00000593666,;RP11-215N21.1,intron_variant,,ENST00000594427,;RP11-215N21.1,intron_variant,,ENST00000594566,;RP11-215N21.1,intron_variant,,ENST00000596263,;RP11-215N21.1,intron_variant,,ENST00000597243,;RP11-215N21.1,intron_variant,,ENST00000598903,;RP11-215N21.1,intron_variant,,ENST00000601410,;	-	ENSG00000229981	ENST00000425050	Transcript	intron_variant,non_coding_transcript_variant						rs36002998	1		-1	RP11-215N21.1	Clone_based_vega_gene		lincRNA											4/4			0.1316	0.0893		0.0615	0.2018	0.1452										MODIFIER		deletion														.	AGATA	.	.																					109657748
RP11-381K7.1	0	.	GRCh37	10	113105359	113105360	+	3'Flank	INS	-	-	AAA	rs59405757		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000421597		4	.	4	0	.	0	RP11-381K7.1,downstream_gene_variant,,ENST00000421597,;	AAA	ENSG00000227851	ENST00000421597	Transcript	downstream_gene_variant						rs59405757	1	4337	-1	RP11-381K7.1	Clone_based_vega_gene		lincRNA	YES													0.9183	0.9438		0.8313	0.8837	0.7658										MODIFIER	1	insertion														.	AGA	.	.																					113105359
TCF7L2	6934	.	GRCh37	10	114724572	114724572	+	Intron	DEL	G	G	-	rs374001468		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.450+197del			ENST00000543371		3	.	3	0	.	0	TCF7L2,intron_variant,,ENST00000346198,;TCF7L2,intron_variant,,ENST00000349937,;TCF7L2,intron_variant,,ENST00000352065,;TCF7L2,intron_variant,,ENST00000355717,NM_001146286.1,NM_001198530.1,NM_001146283.1;TCF7L2,intron_variant,,ENST00000355995,;TCF7L2,intron_variant,,ENST00000369395,;TCF7L2,intron_variant,,ENST00000369397,NM_030756.4,NM_001198528.1,NM_001198527.1,NM_001198525.1;TCF7L2,intron_variant,,ENST00000534894,;TCF7L2,intron_variant,,ENST00000536810,NM_001146285.1;TCF7L2,intron_variant,,ENST00000538897,NM_001146284.1,NM_001198529.1;TCF7L2,intron_variant,,ENST00000542695,;TCF7L2,intron_variant,,ENST00000543371,NM_001198531.1,NM_001198526.1,NM_001146274.1;TCF7L2,intron_variant,,ENST00000545257,;,regulatory_region_variant,,ENSR00001527964,;,TF_binding_site_variant,,ENSM00528386935,;	-	ENSG00000148737	ENST00000543371	Transcript	intron_variant						rs374001468	1		1	TCF7L2	HGNC	11641	protein_coding	YES	CCDS53577.1	ENSP00000444972	Q9NQB0	E2GH26,C6ZRJ8	UPI000002B4A6	NM_001198531.1,NM_001198526.1,NM_001146274.1				4/13																		MODIFIER	1	deletion													1	.	GTGG	.	.																					114724571
ABLIM1	3983	.	GRCh37	10	116439914	116439915	+	Intron	INS	-	-	T	rs34297577		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.64+4134dup			ENST00000369252		4	.	4	0	.	0	ABLIM1,intron_variant,,ENST00000369252,NM_001003408.1,NM_001003407.1;ABLIM1,intron_variant,,ENST00000533213,;ABLIM1,intron_variant,,ENST00000369256,;ABLIM1,intron_variant,,ENST00000392955,;	T	ENSG00000099204	ENST00000369252	Transcript	intron_variant						rs34297577	1		-1	ABLIM1	HGNC	78	protein_coding		CCDS31288.1	ENSP00000358256	O14639		UPI0000418D07	NM_001003408.1,NM_001003407.1				1/22			0.1581	0.4784		0.4395	0.504	0.5971										MODIFIER	1	insertion														.	TCT	.	.																					116439914
PNLIP	5406	.	GRCh37	10	118319788	118319789	+	Intron	INS	-	-	AC	rs71301597		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1061-108_1061-107dup			ENST00000369221		18	.	5	18	.	0	PNLIP,intron_variant,,ENST00000369221,NM_000936.2;	AC	ENSG00000175535	ENST00000369221	Transcript	intron_variant						rs71301597	1		1	PNLIP	HGNC	9155	protein_coding	YES	CCDS7594.1	ENSP00000358223	P16233		UPI000004F1A0	NM_000936.2				10/12																		MODIFIER	1	insertion														.	TTA	.	.																					118319788
RAD1P1	0	.	GRCh37	10	121377920	121377931	+	5'Flank	DEL	ACACACACACAC	ACACACACACAC	-	rs10526903		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACACACACAC	ACACACACACAC																			ENST00000231383		3	.	3	0	.	0	RAD1P1,upstream_gene_variant,,ENST00000231383,;,regulatory_region_variant,,ENSR00000991129,;	-	ENSG00000234569	ENST00000231383	Transcript	upstream_gene_variant						rs10526903	1	2649	1	RAD1P1	HGNC	49479	processed_pseudogene	YES																												MODIFIER	1	deletion														.	ATACACACACACACA	.	.																					121377919
Unknown	0	.	GRCh37	10	122179541	122179544	+	IGR	DEL	GAGG	GAGG	-	rs72411133		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAGG	GAGG																					4	.	4	0	.	0		-				intergenic_variant						rs72411133	1																				0.8169	0.3026		0.501	0.2455	0.4703										MODIFIER	1	deletion														.	GTGAGGG	.	.																					122179540
WDR11	55717	.	GRCh37	10	122650629	122650630	+	Intron	INS	-	-	TT	rs10668494		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2515+233_2515+234dup			ENST00000263461		5	.	3	9	.	0	WDR11,intron_variant,,ENST00000263461,NM_018117.11;WDR11,intron_variant,,ENST00000478567,;WDR11,intron_variant,,ENST00000604509,;WDR11,downstream_gene_variant,,ENST00000605376,;WDR11,intron_variant,,ENST00000497136,;WDR11,intron_variant,,ENST00000605543,;	TT	ENSG00000120008	ENST00000263461	Transcript	intron_variant						rs10668494	1		1	WDR11	HGNC	13831	protein_coding	YES	CCDS7619.1	ENSP00000263461	Q9BZH6	S4R3Z0,Q9NWV7,Q659C9	UPI0000138ED1	NM_018117.11				19/28			0.4297	0.4366		0.4177	0.334	0.3609										MODIFIER	1	insertion													1	.	CCT	.	.																					122650629
WDR11	55717	.	GRCh37	10	122667788	122667789	+	Intron	INS	-	-	TGGGAGAATC	rs59747906		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.3518-274_3518-273insAATCTGGGAG			ENST00000263461		4	.	4	0	.	0	WDR11,intron_variant,,ENST00000263461,NM_018117.11;WDR11,non_coding_transcript_exon_variant,,ENST00000604714,;WDR11,intron_variant,,ENST00000604509,;WDR11,downstream_gene_variant,,ENST00000605659,;WDR11,intron_variant,,ENST00000497136,;WDR11,intron_variant,,ENST00000605543,;WDR11,downstream_gene_variant,,ENST00000603658,;	TGGGAGAATC	ENSG00000120008	ENST00000263461	Transcript	intron_variant						rs59747906	1		1	WDR11	HGNC	13831	protein_coding	YES	CCDS7619.1	ENSP00000263461	Q9BZH6	S4R3Z0,Q9NWV7,Q659C9	UPI0000138ED1	NM_018117.11				28/28			0.8427	0.634		0.5179	0.5865	0.5941										MODIFIER	1	insertion													1	.	TAT	.	.																					122667788
Unknown	0	.	GRCh37	10	125385966	125385968	+	IGR	DEL	TAG	TAG	-	rs10606439		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAG	TAG																					4	.	4	0	.	0		-				intergenic_variant						rs10606439	1																				0.0741	0.3069		0.5893	0.1809	0.3405										MODIFIER	1	deletion			1											.	TATAGT	.	.																					125385965
CPXM2	119587	.	GRCh37	10	125531772	125531792	+	Intron	DEL	GTTGTGGTTCTCACCTTCACT	GTTGTGGTTCTCACCTTCACT	-	rs11269827		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GTTGTGGTTCTCACCTTCACT	GTTGTGGTTCTCACCTTCACT																c.979-1237_979-1217del			ENST00000241305		3	.	3	0	.	0	CPXM2,intron_variant,,ENST00000241305,NM_198148.2;RP11-391M7.3,upstream_gene_variant,,ENST00000446888,;CPXM2,intron_variant,,ENST00000368854,;	-	ENSG00000121898	ENST00000241305	Transcript	intron_variant						rs11269827	1		-1	CPXM2	HGNC	26977	protein_coding	YES	CCDS7637.1	ENSP00000241305	Q8N436		UPI00001AE6BE	NM_198148.2				7/13			0.8835	0.866		0.9167	0.9364	0.8487										MODIFIER	1	deletion														.	TGGTTGTGGTTCTCACCTTCACTG	.	.																					125531771
LHPP	64077	.	GRCh37	10	126173240	126173241	+	Intron	DEL	AG	AG	-	rs5788664		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																c.313+370_313+371del			ENST00000368842		3	.	3	0	.	0	LHPP,intron_variant,,ENST00000368839,NM_001167880.1;LHPP,intron_variant,,ENST00000368842,NM_022126.3;LHPP,intron_variant,,ENST00000392757,;LHPP,upstream_gene_variant,,ENST00000481452,;LHPP,upstream_gene_variant,,ENST00000487190,;	-	ENSG00000107902	ENST00000368842	Transcript	intron_variant						rs5788664	1		1	LHPP	HGNC	30042	protein_coding	YES	CCDS7640.1	ENSP00000357835	Q9H008		UPI00001402EE	NM_022126.3				2/6																		MODIFIER	1	deletion														.	ACAGA	.	.																					126173239
LHPP	64077	.	GRCh37	10	126232803	126232804	+	Intron	INS	-	AG	AG	rs10648044		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.716+26964_716+26965dup			ENST00000368842		6	.	0	3	.	3	LHPP,intron_variant,,ENST00000368839,NM_001167880.1;LHPP,intron_variant,,ENST00000368842,NM_022126.3;LHPP,upstream_gene_variant,,ENST00000482963,;LHPP,upstream_gene_variant,,ENST00000493240,;,regulatory_region_variant,,ENSR00001529344,;	AG	ENSG00000107902	ENST00000368842	Transcript	intron_variant						rs10648044	1		1	LHPP	HGNC	30042	protein_coding	YES	CCDS7640.1	ENSP00000357835	Q9H008		UPI00001402EE	NM_022126.3				6/6			0.6044	0.8847		0.9018	0.827	0.7771										MODIFIER	1	insertion														.	GCA	.	.																					126232803
EDRF1	26098	.	GRCh37	10	127437817	127437817	+	Intron	DEL	A	A	-	rs372652076		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.3124-152del			ENST00000356792		17	.	6	19	.	0	EDRF1,intron_variant,,ENST00000337623,NM_015608.2;EDRF1,intron_variant,,ENST00000356792,NM_001202438.1;EDRF1-AS1,splice_region_variant,,ENST00000601363,;EDRF1-AS1,intron_variant,,ENST00000449436,;EDRF1-AS1,intron_variant,,ENST00000593871,;EDRF1-AS1,intron_variant,,ENST00000594025,;EDRF1-AS1,intron_variant,,ENST00000600784,;EDRF1-AS1,intron_variant,,ENST00000602030,;EDRF1,intron_variant,,ENST00000368815,;EDRF1,intron_variant,,ENST00000419769,;EDRF1,intron_variant,,ENST00000469725,;EDRF1,intron_variant,,ENST00000481600,;EDRF1,intron_variant,,ENST00000525524,;EDRF1,upstream_gene_variant,,ENST00000368812,;EDRF1,downstream_gene_variant,,ENST00000525091,;EDRF1,upstream_gene_variant,,ENST00000525358,;EDRF1,upstream_gene_variant,,ENST00000527655,;	-	ENSG00000107938	ENST00000356792	Transcript	intron_variant						rs372652076	1		1	EDRF1	HGNC	24640	protein_coding	YES	CCDS55733.1	ENSP00000349244	Q3B7T1		UPI00005CA2E3	NM_001202438.1				21/24																		MODIFIER	1	deletion														.	TCAA	.	.																					127437816
FANK1	92565	.	GRCh37	10	127583153	127583154	+	5'Flank	DEL	AA	AA	-	rs71901413		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																			ENST00000368693		3	.	3	0	.	0	DHX32,intron_variant,,ENST00000415732,;FANK1,upstream_gene_variant,,ENST00000368693,;FANK1,upstream_gene_variant,,ENST00000368695,NM_145235.3;FANK1,upstream_gene_variant,,ENST00000449042,;RNU2-42P,upstream_gene_variant,,ENST00000410697,;,regulatory_region_variant,,ENSR00000034960,;,regulatory_region_variant,,ENSR00001529492,;	-	ENSG00000203780	ENST00000368693	Transcript	upstream_gene_variant						rs71901413	1	1954	1	FANK1	HGNC	23527	protein_coding	YES	CCDS31309.1	ENSP00000357682	Q8TC84	C9JD80,A6NH44	UPI000046FFD6																							MODIFIER	1	deletion														.	ACAAA	.	.																					127583152
Unknown	0	.	GRCh37	10	130051105	130051105	+	IGR	DEL	T	T	-	rs11290261		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs11290261	1																				0.6362	0.2061		0.0238	0.2117	0.2025										MODIFIER	1	deletion														.	TGTT	.	.																					130051104
Unknown	0	.	GRCh37	10	130244217	130244218	+	IGR	INS	-	-	T	rs34674880		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs34674880	1																																			MODIFIER	1	insertion														.	TAT	.	.																					130244217
Unknown	0	.	GRCh37	10	131839152	131839153	+	IGR	INS	-	-	A	rs55873890		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		A				intergenic_variant						rs55873890	1																			0.0962	0.0083	0.1988		0.0347	0.1869	0.1125										MODIFIER	1	insertion														.	GGG	.	.																					131839152
Unknown	0	.	GRCh37	10	133878947	133878949	+	IGR	DEL	TAT	TAT	-	rs10544133		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAT	TAT																					4	.	4	2	.	0		-				intergenic_variant						rs10544133	1																				0.7254	0.8026		0.871	0.6302	0.7914										MODIFIER	1	deletion														.	CCTATT	.	.																					133878946
TRIM68	55128	.	GRCh37	11	4629951	4629955	+	5'Flank	DEL	AAACA	AAACA	-	rs60933459		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAACA	AAACA																			ENST00000300747		4	.	4	0	.	0	TRIM68,upstream_gene_variant,,ENST00000300747,NM_018073.6;TRIM68,upstream_gene_variant,,ENST00000526337,;TRIM68,upstream_gene_variant,,ENST00000533021,;TRIM68,upstream_gene_variant,,ENST00000531101,;TRIM68,upstream_gene_variant,,ENST00000531644,;TRIM68,upstream_gene_variant,,ENST00000532108,;,regulatory_region_variant,,ENSR00000036187,;	-	ENSG00000167333	ENST00000300747	Transcript	upstream_gene_variant						rs60933459	1	462	-1	TRIM68	HGNC	21161	protein_coding	YES	CCDS31356.1	ENSP00000300747	Q6AZZ1	E9PP83	UPI00001D6F26	NM_018073.6																						MODIFIER	1	deletion														.	TTAAACAA	.	.																					4629950
TRIM6-TRIM34	53840	.	GRCh37	11	5655697	5655698	+	Intron	INS	-	-	AT	rs35894966		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1582-154_1582-153dup			ENST00000354852		5	.	1	6	.	5	TRIM6-TRIM34,intron_variant,,ENST00000354852,NM_001003819.3;HBG2,intron_variant,,ENST00000380259,;TRIM34,intron_variant,,ENST00000429814,NM_021616.5;TRIM6-TRIM34,intron_variant,,ENST00000457787,;TRIM34,intron_variant,,ENST00000514226,NM_001003827.1;TRIM34,upstream_gene_variant,,ENST00000495668,;TRIM34,intron_variant,,ENST00000491385,;	AT	ENSG00000258588	ENST00000354852	Transcript	intron_variant						rs35894966	1		1	TRIM6-TRIM34	HGNC	33440	protein_coding	YES	CCDS31388.1	ENSP00000346916		C9JNQ0,B2RNG4	UPI000041A254	NM_001003819.3				9/13			0.0499	0.2392		0.0675	0.3459	0.1626										MODIFIER	1	insertion														.	AAA	.	.																					5655697
PPFIBP2	8495	.	GRCh37	11	7625710	7625711	+	Intron	INS	-	-	A	rs71059113		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.487-5812_487-5811insA			ENST00000299492		6	.	3	3	.	0	PPFIBP2,intron_variant,,ENST00000299492,NM_003621.3;PPFIBP2,intron_variant,,ENST00000525597,;PPFIBP2,intron_variant,,ENST00000527790,;PPFIBP2,intron_variant,,ENST00000528883,NM_001256568.1;PPFIBP2,intron_variant,,ENST00000529575,;PPFIBP2,intron_variant,,ENST00000533792,;PPFIBP2,upstream_gene_variant,,ENST00000530181,NM_001256569.1;PPFIBP2,intron_variant,,ENST00000529021,;PPFIBP2,intron_variant,,ENST00000532926,;PPFIBP2,intron_variant,,ENST00000530189,;,regulatory_region_variant,,ENSR00001531163,;,TF_binding_site_variant,,ENSM00910491058,;,TF_binding_site_variant,,ENSM00632533902,;,TF_binding_site_variant,,ENSM00777697870,;	A	ENSG00000166387	ENST00000299492	Transcript	intron_variant						rs71059113	1		1	PPFIBP2	HGNC	9250	protein_coding	YES	CCDS31419.1	ENSP00000299492	Q8ND30	E9PP16,E9PMN3,E9PMH3,E9PK17,E9PJA0,E9PIK8,B3KM46	UPI00001C1EF8	NM_003621.3				5/23		0.1330	0.3449	0.0821		0.006	0.1074	0.0399										MODIFIER	1	insertion														.	ACC	.	.																					7625710
ENSR00000997441	0	.	GRCh37	11	13163020	13163021	+	IGR	DEL	AG	AG	-	rs3046372		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																			ENSR00000997441		6	.	3	4	.	0	,regulatory_region_variant,,ENSR00000997441,;	-		ENSR00000997441	RegulatoryFeature	regulatory_region_variant						rs3046372	1																				0.1248	0.5		0.38	0.5308	0.363										MODIFIER	1	deletion														.	TCAGA	.	.																					13163019
RP11-452G18.1	0	.	GRCh37	11	17212122	17212122	+	5'Flank	DEL	A	A	-	rs35193747		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000496042		4	.	4	0	.	0	PIK3C2A,intron_variant,,ENST00000532035,;PIK3C2A,intron_variant,,ENST00000540361,;PIK3C2A,intron_variant,,ENST00000531428,;PIK3C2A,downstream_gene_variant,,ENST00000503729,;PIK3C2A,intron_variant,,ENST00000533645,;RP11-452G18.1,upstream_gene_variant,,ENST00000496042,;	-	ENSG00000213779	ENST00000496042	Transcript	upstream_gene_variant						rs35193747	1	2914	1	RP11-452G18.1	Clone_based_vega_gene		processed_pseudogene	YES													0.5991	0.5937		0.8065	0.494	0.5961										MODIFIER	1	deletion														.	TCAA	.	.																					17212121
UEVLD	55293	.	GRCh37	11	18591716	18591716	+	Intron	DEL	A	A	-	rs11445836		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.357+45del			ENST00000396197		31	.	4	25	.	0	UEVLD,intron_variant,,ENST00000300038,;UEVLD,intron_variant,,ENST00000320750,NM_001261383.1;UEVLD,intron_variant,,ENST00000379387,NM_001261382.1;UEVLD,intron_variant,,ENST00000396197,NM_001040697.2,NM_001261384.1;UEVLD,intron_variant,,ENST00000535484,NM_001261385.1;UEVLD,intron_variant,,ENST00000541984,NM_001261386.1;UEVLD,intron_variant,,ENST00000543987,NM_018314.4;UEVLD,intron_variant,,ENST00000540666,;UEVLD,intron_variant,,ENST00000540917,;UEVLD,downstream_gene_variant,,ENST00000490736,;UEVLD,non_coding_transcript_exon_variant,,ENST00000535340,;UEVLD,intron_variant,,ENST00000396196,;	-	ENSG00000151116	ENST00000396197	Transcript	intron_variant						rs11445836	1		-1	UEVLD	HGNC	30866	protein_coding	YES	CCDS41624.1	ENSP00000379500	Q8IX04	B4DWH4,B4DIA9	UPI00001AF2D2	NM_001040697.2,NM_001261384.1				4/11									0.1809	0.1766								MODIFIER	1	deletion														.	TTAA	.	.												0.224	0.2569	0.1765	0.2399	0.1566	0.2011	0.2507	0.2353	0.2025	18591715
NAV2	89797	.	GRCh37	11	19575057	19575058	+	Intron	DEL	CA	CA	-	rs112504639		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CA	CA																c.75+202494_75+202495del			ENST00000360655		4	.	4	0	.	0	NAV2,intron_variant,,ENST00000360655,NM_001111018.1;,regulatory_region_variant,,ENSR00000263150,;,regulatory_region_variant,,ENSR00001532658,;	-	ENSG00000166833	ENST00000360655	Transcript	intron_variant						rs112504639	1		1	NAV2	HGNC	15997	protein_coding		CCDS53612.1	ENSP00000353871	Q8IVL1		UPI0000228C68	NM_001111018.1				1/37																		MODIFIER	1	deletion														.	ACCAC	.	.																					19575056
Unknown	0	.	GRCh37	11	21860089	21860091	+	IGR	DEL	GAG	GAG	-	rs72002959		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAG	GAG																					3	.	3	0	.	0		-				intergenic_variant						rs72002959	1																				0.1127	0.0346		0.0972	0.0567	0.1104										MODIFIER	1	deletion														.	ATGAGG	.	.																					21860088
Unknown	0	.	GRCh37	11	23464907	23464908	+	IGR	INS	-	-	GAAAG	rs60301774		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		GAAAG				intergenic_variant						rs60301774	1																				0.6445	0.7622		0.9792	0.8569	0.8845										MODIFIER	1	insertion														.	TTG	.	.																					23464907
Unknown	0	.	GRCh37	11	24297899	24297900	+	IGR	INS	-	-	T	rs76237719		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs76237719	1																				0.2874	0.1888		0.2976	0.1282	0.2597										MODIFIER	1	insertion														.	TGT	.	.																					24297899
BDNF-AS	497258	.	GRCh37	11	27601981	27601981	+	Intron	DEL	T	T	-	rs36094812		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																n.145-3826del			ENST00000499008		3	.	3	0	.	0	BDNF-AS,intron_variant,,ENST00000499008,;BDNF-AS,intron_variant,,ENST00000499568,;BDNF-AS,intron_variant,,ENST00000500662,;BDNF-AS,intron_variant,,ENST00000501176,;BDNF-AS,intron_variant,,ENST00000502161,;BDNF-AS,intron_variant,,ENST00000530686,;BDNF-AS,intron_variant,,ENST00000532965,;RP11-587D21.1,upstream_gene_variant,,ENST00000476147,;RP11-587D21.1,upstream_gene_variant,,ENST00000540179,;	-	ENSG00000245573	ENST00000499008	Transcript	intron_variant,non_coding_transcript_variant						rs36094812	1		1	BDNF-AS	HGNC	20608	antisense	YES										2/7			0.5832	0.6859		0.746	0.7505	0.7055										MODIFIER	1	deletion														.	AATT	.	.																					27601980
RP1-65P5.5	0	.	GRCh37	11	32155325	32155326	+	Intron	INS	-	-	T	rs55974678		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.88+1004dup			ENST00000525133		3	.	3	0	.	0	RP1-65P5.5,intron_variant,,ENST00000525133,;RP1-65P5.1,intron_variant,,ENST00000419556,;	T	ENSG00000255375	ENST00000525133	Transcript	intron_variant,non_coding_transcript_variant						rs55974678	1		1	RP1-65P5.5	Clone_based_vega_gene		lincRNA	YES										1/2			0.5303	0.5692		0.7907	0.6064	0.6452										MODIFIER	1	insertion														.	GGT	.	.																					32155325
TCP11L1	55346	.	GRCh37	11	33087035	33087036	+	Intron	INS	-	-	T	rs142020533		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.973-340dup			ENST00000334274		5	.	5	0	.	0	TCP11L1,intron_variant,,ENST00000324357,;TCP11L1,intron_variant,,ENST00000334274,NM_018393.3;TCP11L1,intron_variant,,ENST00000432887,NM_001145541.1;TCP11L1,intron_variant,,ENST00000531632,;TCP11L1,upstream_gene_variant,,ENST00000528962,;TCP11L1,intron_variant,,ENST00000527661,;TCP11L1,intron_variant,,ENST00000528107,;,regulatory_region_variant,,ENSR00001000915,;,regulatory_region_variant,,ENSR00001533558,;,TF_binding_site_variant,,ENSM00527253127,;,TF_binding_site_variant,,ENSM00527566849,;,TF_binding_site_variant,,ENSM00527471145,;,TF_binding_site_variant,,ENSM00527528047,;	T	ENSG00000176148	ENST00000334274	Transcript	intron_variant						rs142020533	1		1	TCP11L1	HGNC	25655	protein_coding	YES	CCDS7882.1	ENSP00000335595	Q9NUJ3	R4GNF5,E9PS88,E9PP52	UPI0000071A1F	NM_018393.3				7/9			0.1044	0.0908		0.3393	0.1471	0.2955										MODIFIER	1	insertion														.	CCT	.	.																					33087035
PDHX	8050	.	GRCh37	11	35007869	35007870	+	Intron	INS	-	-	G	rs5791025		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1182+1594_1182+1595insG			ENST00000227868		4	.	4	0	.	0	PDHX,intron_variant,,ENST00000227868,;PDHX,intron_variant,,ENST00000430469,NM_001166158.1;PDHX,intron_variant,,ENST00000448838,NM_001135024.1,NM_003477.2;PDHX,intron_variant,,ENST00000526309,;PDHX,intron_variant,,ENST00000477173,;PDHX,downstream_gene_variant,,ENST00000532159,;	G	ENSG00000110435	ENST00000227868	Transcript	intron_variant						rs5791025	1		1	PDHX	HGNC	21350	protein_coding	YES	CCDS7896.1	ENSP00000227868	O00330	E9PLU0	UPI0000130C34					9/10			0.621	0.6556		0.8036	0.7922	0.7495										MODIFIER	1	insertion													1	.	AAA	.	.																					35007869
SLC1A2	6506	.	GRCh37	11	35331263	35331264	+	Intron	DEL	TC	TC	-	rs5791047		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TC	TC																c.561+2481_561+2482del			ENST00000278379		5	.	3	3	.	0	SLC1A2,intron_variant,,ENST00000278379,NM_004171.3;SLC1A2,intron_variant,,ENST00000395750,NM_001195728.2;SLC1A2,intron_variant,,ENST00000395753,NM_001252652.1;SLC1A2,intron_variant,,ENST00000449068,;SLC1A2,intron_variant,,ENST00000606205,;,regulatory_region_variant,,ENSR00001533883,;	-	ENSG00000110436	ENST00000278379	Transcript	intron_variant						rs5791047	1		-1	SLC1A2	HGNC	10940	protein_coding	YES	CCDS31459.1	ENSP00000278379	P43004	A2A2U1	UPI0000129B12	NM_004171.3				4/10			0.0613	0.2421		0.1915	0.2604	0.093										MODIFIER	1	deletion													1	.	TGTCT	.	.																					35331262
Unknown	0	.	GRCh37	11	36888545	36888545	+	IGR	DEL	C	C	-	rs11315192		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					4	.	4	0	.	0		-				intergenic_variant						rs11315192	1																				1	1		1	1	1										MODIFIER	1	deletion														.	ATCC	.	.																					36888544
Unknown	0	.	GRCh37	11	37545064	37545065	+	IGR	INS	-	-	GT	rs57164737		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		GT				intergenic_variant						rs57164737	1																				0.4531	0.1772		0.1637	0.2048	0.2147										MODIFIER	1	insertion														.	GGG	.	.																					37545064
Unknown	0	.	GRCh37	11	38418199	38418200	+	IGR	INS	-	-	TA	rs34988235		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TA				intergenic_variant						rs34988235	1																				0.1536	0.4597		0.4881	0.4175	0.3436										MODIFIER	1	insertion														.	TCT	.	.																					38418199
RP11-613D13.4	0	.	GRCh37	11	43991511	43991511	+	Intron	DEL	A	A	-	rs35875561		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																n.154-1482del			ENST00000526408		4	.	4	0	.	0	RP11-613D13.4,intron_variant,,ENST00000526408,;	-	ENSG00000254409	ENST00000526408	Transcript	intron_variant,non_coding_transcript_variant						rs35875561	1		1	RP11-613D13.4	Clone_based_vega_gene		sense_overlapping	YES										2/6		0.2907	0.3064	0.1787		0.4365	0.2813	0.2086										MODIFIER	1	deletion														.	ATAG	.	.																					43991510
PRDM11	56981	.	GRCh37	11	45124245	45124246	+	Intron	DEL	AC	-	-	rs141348440		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																c.96+6799_96+6800del			ENST00000263765		5	.	0	5	.	5	PRDM11,intron_variant,,ENST00000263765,;PRDM11,intron_variant,,ENST00000530656,;,regulatory_region_variant,,ENSR00000263848,;,regulatory_region_variant,,ENSR00001534599,;,TF_binding_site_variant,,ENSM00526995153,;	-	ENSG00000019485	ENST00000263765	Transcript	intron_variant						rs141348440	1		1	PRDM11	HGNC	13996	protein_coding			ENSP00000263765	Q9NQV5	E9PJ09	UPI000013D45B					2/7			0.1248	0.085		0.002	0.165	0.0695										MODIFIER	1	deletion														.	TGACA	.	.																					45124244
PHF21A	51317	.	GRCh37	11	45952824	45952825	+	3'Flank	INS	-	-	AG	rs3833430		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000418153		3	.	3	0	.	0	PHF21A,3_prime_UTR_variant,,ENST00000257821,NM_001101802.1;PHF21A,downstream_gene_variant,,ENST00000323180,NM_016621.3;GYLTL1B,downstream_gene_variant,,ENST00000325468,;GYLTL1B,downstream_gene_variant,,ENST00000389968,;GYLTL1B,downstream_gene_variant,,ENST00000401752,;PHF21A,downstream_gene_variant,,ENST00000418153,;PHF21A,downstream_gene_variant,,ENST00000525676,;GYLTL1B,downstream_gene_variant,,ENST00000529052,;GYLTL1B,downstream_gene_variant,,ENST00000531526,NM_152312.3;GYLTL1B,downstream_gene_variant,,ENST00000531847,;PHF21A,downstream_gene_variant,,ENST00000532028,;GYLTL1B,downstream_gene_variant,,ENST00000534410,;GYLTL1B,downstream_gene_variant,,ENST00000536139,;PHF21A,non_coding_transcript_exon_variant,,ENST00000527401,;GYLTL1B,downstream_gene_variant,,ENST00000414027,;GYLTL1B,downstream_gene_variant,,ENST00000525609,;GYLTL1B,downstream_gene_variant,,ENST00000528236,;GYLTL1B,downstream_gene_variant,,ENST00000530437,;PHF21A,downstream_gene_variant,,ENST00000530587,;PHF21A,downstream_gene_variant,,ENST00000534724,;,regulatory_region_variant,,ENSR00001534715,;	AG	ENSG00000135365	ENST00000418153	Transcript	downstream_gene_variant						rs3833430	1	2207	-1	PHF21A	HGNC	24156	protein_coding	YES	CCDS44578.1	ENSP00000398824	Q96BD5	E9PR02,E9PQM3,E9PNW9,E9PLV4	UPI000006E1CB								0.5166	0.5562		0.2738	0.6551	0.6196										MODIFIER		insertion													1	.	TTA	.	.																					45952824
OR4X2	119764	.	GRCh37	11	48265421	48265432	+	5'Flank	DEL	TGTGTGTGTGTG	TGTGTGTGTGTG	-	rs66807185		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGTGTGTGTGTG	TGTGTGTGTGTG																			ENST00000302329		3	.	3	0	.	0	OR4X2,upstream_gene_variant,,ENST00000302329,NM_001004727.1;	-	ENSG00000172208	ENST00000302329	Transcript	upstream_gene_variant						rs66807185	1	1176	1	OR4X2	HGNC	15184	protein_coding	YES	CCDS31486.1	ENSP00000307751	Q8NGF9		UPI0000041BE3	NM_001004727.1																						MODIFIER	1	deletion														.	GATGTGTGTGTGTGT	.	.																					48265420
OR4C4P	0	.	GRCh37	11	48378670	48378670	+	5'Flank	DEL	G	G	-	rs33983257		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																			ENST00000415304		10	.	8	3	.	0	OR4C4P,upstream_gene_variant,,ENST00000415304,;OR4C4P,upstream_gene_variant,,ENST00000551663,;	-	ENSG00000197161	ENST00000415304	Transcript	upstream_gene_variant						rs33983257	1	4671	-1	OR4C4P	HGNC	14700	unprocessed_pseudogene	YES																												MODIFIER	1	deletion														.	AAGG	.	.																					48378669
Unknown	0	.	GRCh37	11	48818108	48818108	+	IGR	DEL	C	-	-	rs375026179		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					8	4	4	6	0	0		-				intergenic_variant						rs375026179	1																																			MODIFIER	1	deletion														.	AACA	.	.																					48818107
TRIM51CP	0	.	GRCh37	11	48971019	48971020	+	Intron	INS	-	-	AAAT	rs59694598		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.761+230_761+233dup			ENST00000505076		6	3	3	8	8	0	TRIM51CP,intron_variant,,ENST00000505076,;TRIM51CP,downstream_gene_variant,,ENST00000544390,;	AAAT	ENSG00000249910	ENST00000505076	Transcript	intron_variant,non_coding_transcript_variant						rs59694598	1		1	TRIM51CP	HGNC	43968	unprocessed_pseudogene	YES										4/5																		MODIFIER	1	insertion														.	CCA	.	.																					48971019
Unknown	0	.	GRCh37	11	59769463	59769464	+	IGR	INS	-	-	ATA	rs5792166		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		ATA				intergenic_variant						rs5792166	1																				0.7088	0.6081		0.7183	0.328	0.498										MODIFIER	1	insertion														.	TTA	.	.																					59769463
Unknown	0	.	GRCh37	11	60017921	60017923	+	IGR	DEL	CTC	CTC	-	rs142165292		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTC	CTC																					3	.	3	0	.	0		-				intergenic_variant						rs142165292	1																				0.326	0.4611		0.4206	0.3877	0.2566										MODIFIER	1	deletion														.	TTCTCC	.	.																					60017920
LINC00301	283197	.	GRCh37	11	60450644	60450645	+	Intron	INS	-	-	AAACA	rs56414083		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.613-3736_613-3735insCAAAA			ENST00000320202		3	.	3	0	.	0	LINC00301,intron_variant,,ENST00000320202,;LINC00301,intron_variant,,ENST00000412599,;LINC00301,intron_variant,,ENST00000527161,;LINC00301,intron_variant,,ENST00000532591,;	AAACA	ENSG00000181995	ENST00000320202	Transcript	intron_variant,non_coding_transcript_variant						rs56414083	1		1	LINC00301	HGNC	28603	lincRNA	YES										6/6			0.8631	0.8919		0.8581	0.8926	0.8027										MODIFIER	1	insertion														.	ATA	.	.																					60450644
OVOL1	5017	.	GRCh37	11	65568666	65568667	+	3'Flank	INS	-	-	CT	rs34016202		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000335987		5	.	5	0	.	0	OVOL1,downstream_gene_variant,,ENST00000335987,NM_004561.3;RP11-770G2.5,upstream_gene_variant,,ENST00000531155,;	CT	ENSG00000172818	ENST00000335987	Transcript	downstream_gene_variant						rs34016202	1	3976	1	OVOL1	HGNC	8525	protein_coding	YES	CCDS8112.1	ENSP00000337862	O14753	G3V1B0	UPI00001D70C0	NM_004561.3							0.0885	0.487		0.1845	0.328	0.5992										MODIFIER	1	insertion														.	GAC	.	.																					65568666
PC	5091	.	GRCh37	11	66729435	66729435	+	5'Flank	DEL	T	T	-	rs763693462		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000393960		4	.	4	0	.	0	PC,upstream_gene_variant,,ENST00000355677,;PC,upstream_gene_variant,,ENST00000393958,NM_000920.3;PC,upstream_gene_variant,,ENST00000393960,NM_001040716.1;PC,upstream_gene_variant,,ENST00000524491,;PC,upstream_gene_variant,,ENST00000528403,;PC,upstream_gene_variant,,ENST00000531614,;PC,upstream_gene_variant,,ENST00000534194,;,regulatory_region_variant,,ENSR00001536372,;	-	ENSG00000173599	ENST00000393960	Transcript	upstream_gene_variant						rs763693462	1	3588	-1	PC	HGNC	8636	protein_coding	YES	CCDS8152.1	ENSP00000377532	P11498	E9PS68	UPI0000132BC4	NM_001040716.1																						MODIFIER	1	deletion													1	.	TCTT	.	.																					66729434
PITPNM1	9600	.	GRCh37	11	67267028	67267031	+	Intron	DEL	CCAC	CCAC	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCAC	CCAC																c.1171+163_1171+166del			ENST00000356404		6	3	3	8	8	0	PITPNM1,intron_variant,,ENST00000356404,NM_001130848.1,NM_004910.2;PITPNM1,intron_variant,,ENST00000436757,;PITPNM1,intron_variant,,ENST00000534749,;PITPNM1,downstream_gene_variant,,ENST00000524901,;PITPNM1,downstream_gene_variant,,ENST00000528559,;PITPNM1,downstream_gene_variant,,ENST00000532703,;PITPNM1,downstream_gene_variant,,ENST00000533391,;PITPNM1,downstream_gene_variant,,ENST00000525521,;PITPNM1,upstream_gene_variant,,ENST00000525568,;PITPNM1,upstream_gene_variant,,ENST00000526450,;PITPNM1,upstream_gene_variant,,ENST00000526602,;PITPNM1,downstream_gene_variant,,ENST00000527103,;PITPNM1,downstream_gene_variant,,ENST00000527527,;PITPNM1,downstream_gene_variant,,ENST00000529203,;PITPNM1,downstream_gene_variant,,ENST00000530381,;PITPNM1,upstream_gene_variant,,ENST00000527370,;	-	ENSG00000110697	ENST00000356404	Transcript	intron_variant							1		-1	PITPNM1	HGNC	9003	protein_coding	YES	CCDS31620.1	ENSP00000348772	O00562	E9PSD1,E9PNU6,E9PMZ6,E9PMS0	UPI00001FAD31	NM_001130848.1,NM_004910.2				8/23																		MODIFIER	1	deletion														.	ATCCACC	.	.																					67267027
Unknown	0	.	GRCh37	11	67639969	67639970	+	IGR	DEL	TT	TT	-	rs146388511		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																					3	.	3	0	.	0		-				intergenic_variant						rs146388511	1																																			MODIFIER	1	deletion														.	TATTT	.	.																					67639968
TCIRG1	10312	.	GRCh37	11	67819684	67819685	+	3'Flank	INS	-	-	GGGCCA	rs145359220		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000265686		5	.	3	4	.	0	TCIRG1,downstream_gene_variant,,ENST00000265686,NM_006019.3;CHKA,downstream_gene_variant,,ENST00000265689,NM_001277.2;CHKA,downstream_gene_variant,,ENST00000356135,NM_212469.1;TCIRG1,downstream_gene_variant,,ENST00000529364,;TCIRG1,downstream_gene_variant,,ENST00000530063,;TCIRG1,downstream_gene_variant,,ENST00000532635,NM_006053.3;RP11-802E16.3,non_coding_transcript_exon_variant,,ENST00000526897,;RP11-802E16.3,intron_variant,,ENST00000529934,;RP11-802E16.3,upstream_gene_variant,,ENST00000534517,;TCIRG1,downstream_gene_variant,,ENST00000530802,;CHKA,downstream_gene_variant,,ENST00000533728,;TCIRG1,downstream_gene_variant,,ENST00000524870,;CHKA,downstream_gene_variant,,ENST00000525155,;TCIRG1,downstream_gene_variant,,ENST00000525516,;TCIRG1,downstream_gene_variant,,ENST00000525724,;TCIRG1,downstream_gene_variant,,ENST00000528981,;TCIRG1,downstream_gene_variant,,ENST00000530449,;TCIRG1,downstream_gene_variant,,ENST00000533005,;	GGGCCA	ENSG00000110719	ENST00000265686	Transcript	downstream_gene_variant						rs145359220	1	1322	1	TCIRG1	HGNC	11647	protein_coding	YES	CCDS8177.1	ENSP00000265686	Q13488	Q6QBN6,E9PM12	UPI000006EC9A	NM_006019.3							0.2988	0.1974		0.3343	0.2217	0.1677										MODIFIER	1	insertion													1	.	ATG	.	.																					67819684
CPT1A	1374	.	GRCh37	11	68569899	68569900	+	Intron	DEL	AA	AA	-	rs71043451		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																c.555+1568_555+1569del			ENST00000265641		3	.	3	0	.	0	CPT1A,intron_variant,,ENST00000265641,NM_001876.3;CPT1A,intron_variant,,ENST00000376618,NM_001031847.2;CPT1A,intron_variant,,ENST00000539743,;CPT1A,intron_variant,,ENST00000540367,;CPT1A,upstream_gene_variant,,ENST00000538994,;	-	ENSG00000110090	ENST00000265641	Transcript	intron_variant						rs71043451	1		-1	CPT1A	HGNC	2328	protein_coding	YES	CCDS8185.1	ENSP00000265641	P50416	Q8WZ48,H3BUV7,H3BUJ0,H3BP22	UPI000013D658	NM_001876.3				5/18			0.8215	0.9841		0.9901	0.9642	0.9969										MODIFIER	1	deletion													1	.	GGAAA	.	.																					68569898
ENSR00001007084	0	.	GRCh37	11	68718534	68718535	+	IGR	INS	-	-	A	rs34737478		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001007084		7	.	3	4	.	0	,regulatory_region_variant,,ENSR00001007084,;	A		ENSR00001007084	RegulatoryFeature	regulatory_region_variant						rs34737478	1																				0.146	0.1902		0.0208	0.2644	0.0511										MODIFIER	1	insertion														.	ACA	.	.																					68718534
Unknown	0	.	GRCh37	11	68962113	68962114	+	IGR	INS	-	-	ATGATG	rs111805683		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		ATGATG				intergenic_variant						rs111805683	1																																			MODIFIER	1	insertion														.	TCA	.	.																					68962113
Unknown	0	.	GRCh37	11	69685119	69685119	+	IGR	DEL	A	A	-	rs35685773		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs35685773	1																																			MODIFIER	1	deletion														.	AGAA	.	.																					69685118
ARHGEF17	9828	.	GRCh37	11	73020375	73020376	+	In_Frame_Ins	INS	-	-	CTC	rs113363731		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.703_705dup	p.Ser235dup	p.S235dup	ENST00000263674	1/21	12	.	8	6	.	0	ARHGEF17,inframe_insertion,p.Ser235dup,ENST00000263674,NM_014786.3;ARHGEF17,upstream_gene_variant,,ENST00000544519,;RP11-800A3.7,non_coding_transcript_exon_variant,,ENST00000546324,;,regulatory_region_variant,,ENSR00001008382,;,TF_binding_site_variant,,ENSM00529864108,;	CTC	ENSG00000110237	ENST00000263674	Transcript	inframe_insertion	1042-1043/7853	692-693/6192	231/2063	C/CS	tgc/tgCTCc	rs113363731	1		1	ARHGEF17	HGNC	21726	protein_coding	YES	CCDS8221.1	ENSP00000263674	Q96PE2		UPI000004980B	NM_014786.3			1/21		Low_complexity_(Seg):seg		0.7489	0.1671		0.0466	0.2068	0.1391	0.6086	0.201								MODERATE	1	insertion		13												.	TGC	.	.												0.2083	0.6389	0.1344	0.171	0.03434	0.2896	0.2109	0.2001	0.1402	73020375
UCP3	7352	.	GRCh37	11	73712708	73712709	+	Intron	INS	-	-	TC	rs3837411		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.825-139_825-138dup			ENST00000314032		11	.	5	10	.	2	UCP3,intron_variant,,ENST00000314032,NM_003356.3;UCP3,intron_variant,,ENST00000348534,;UCP3,downstream_gene_variant,,ENST00000426995,NM_022803.2;UCP3,downstream_gene_variant,,ENST00000544614,;UCP3,intron_variant,,ENST00000545271,;,regulatory_region_variant,,ENSR00001537370,;	TC	ENSG00000175564	ENST00000314032	Transcript	intron_variant						rs3837411	1		-1	UCP3	HGNC	12519	protein_coding	YES	CCDS8229.1	ENSP00000323740	P55916	F5H3N5	UPI000003021D	NM_003356.3				6/6																		MODIFIER	1	insertion													1	.	AGT	.	.																					73712708
UVRAG	7405	.	GRCh37	11	75786980	75786982	+	Intron	DEL	TTT	TTT	-	rs56391807		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTT	TTT																c.1305+10153_1305+10155del			ENST00000356136		5	.	5	0	.	0	UVRAG,intron_variant,,ENST00000356136,NM_003369.3;UVRAG,intron_variant,,ENST00000528420,;UVRAG,intron_variant,,ENST00000531818,;UVRAG,intron_variant,,ENST00000532130,;UVRAG,intron_variant,,ENST00000533454,;UVRAG,intron_variant,,ENST00000539288,;,regulatory_region_variant,,ENSR00001537678,;	-	ENSG00000198382	ENST00000356136	Transcript	intron_variant						rs56391807	1		1	UVRAG	HGNC	12640	protein_coding	YES	CCDS8241.1	ENSP00000348455	Q9P2Y5	E9PR71,E9PK00,B3KTC1	UPI0000137F03	NM_003369.3				13/14			0.0719	0.3559		0.12	0.495	0.3211										MODIFIER	1	deletion														.	AATTTT	.	.																					75786979
Unknown	0	.	GRCh37	11	75946784	75946785	+	IGR	INS	-	-	T	rs11403686		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		T				intergenic_variant						rs11403686	1																				1	1		1	1	1										MODIFIER	1	insertion														.	AAT	.	.																					75946784
ACER3	55331	.	GRCh37	11	76740052	76740053	+	3'Flank	INS	-	-	A	rs11376883		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000532485		3	.	3	0	.	0	ACER3,downstream_gene_variant,,ENST00000532485,NM_018367.5;	A	ENSG00000078124	ENST00000532485	Transcript	downstream_gene_variant						rs11376883	1	2211	1	ACER3	HGNC	16066	protein_coding	YES	CCDS8247.1	ENSP00000434480	Q9NUN7	F5GYA0,E9PIN9,B7Z2V2	UPI000013DB7C	NM_018367.5							0.6407	0.5346		0.619	0.7306	0.681										MODIFIER	1	insertion													1	.	CTA	.	.																					76740052
Unknown	0	.	GRCh37	11	81375609	81375626	+	IGR	DEL	CACACACACAAACACACA	CACACACACAAACACACA	-	rs143896216		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CACACACACAAACACACA	CACACACACAAACACACA																					3	.	3	0	.	0		-				intergenic_variant						rs143896216	1																																			MODIFIER	1	deletion														.	CTCACACACACAAACACACAC	.	.																					81375608
C11orf73	51501	.	GRCh37	11	86030671	86030672	+	Intron	DEL	TA	TA	-	rs34557821		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TA	TA																c.268+13148_268+13149del			ENST00000278483		6	.	6	0	.	0	C11orf73,intron_variant,,ENST00000278483,NM_016401.3;C11orf73,intron_variant,,ENST00000533986,;RN7SL225P,downstream_gene_variant,,ENST00000464648,;C11orf73,intron_variant,,ENST00000530208,;C11orf73,intron_variant,,ENST00000531485,;C11orf73,intron_variant,,ENST00000532270,;C11orf73,intron_variant,,ENST00000528004,;	-	ENSG00000149196	ENST00000278483	Transcript	intron_variant						rs34557821	1		1	C11orf73	HGNC	26938	protein_coding	YES	CCDS8275.1	ENSP00000278483	Q53FT3		UPI000006CF46	NM_016401.3				2/4			0.4327	0.6758		0.7659	0.5835	0.7219										MODIFIER	1	deletion													1	.	TTTAT	.	.																					86030670
Unknown	0	.	GRCh37	11	87435474	87435475	+	IGR	INS	-	-	ATT	rs34623925		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		ATT				intergenic_variant						rs34623925	1																				0.6657	0.2723		0.6002	0.2515	0.3661										MODIFIER	1	insertion														.	TCA	.	.																					87435474
GRM5	2915	.	GRCh37	11	88694531	88694531	+	Intron	DEL	T	T	-	rs5793371		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.661+85849del			ENST00000418177		3	.	3	0	.	0	GRM5,intron_variant,,ENST00000305432,;GRM5,intron_variant,,ENST00000305447,NM_001143831.2;GRM5,intron_variant,,ENST00000393297,;GRM5,intron_variant,,ENST00000418177,;GRM5,intron_variant,,ENST00000449371,;GRM5,intron_variant,,ENST00000455756,NM_000842.3;	-	ENSG00000168959	ENST00000418177	Transcript	intron_variant						rs5793371	1		-1	GRM5	HGNC	4597	protein_coding	YES	CCDS44694.1	ENSP00000402912	P41594		UPI000012F081					2/9			0.3918	0.4539		0.4187	0.4841	0.316										MODIFIER	1	deletion														.	CATT	.	.																					88694530
GRM5	2915	.	GRCh37	11	88710027	88710028	+	Intron	INS	-	-	A	rs57784199		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.661+70352dup			ENST00000418177		3	.	3	0	.	0	GRM5,intron_variant,,ENST00000305432,;GRM5,intron_variant,,ENST00000305447,NM_001143831.2;GRM5,intron_variant,,ENST00000393297,;GRM5,intron_variant,,ENST00000418177,;GRM5,intron_variant,,ENST00000449371,;GRM5,intron_variant,,ENST00000455756,NM_000842.3;	A	ENSG00000168959	ENST00000418177	Transcript	intron_variant						rs57784199	1		-1	GRM5	HGNC	4597	protein_coding	YES	CCDS44694.1	ENSP00000402912	P41594		UPI000012F081					2/9			0.1944	0.4755		0.5188	0.495	0.6012										MODIFIER	1	insertion														.	ACA	.	.																					88710027
RP11-358N4.3	0	.	GRCh37	11	89520051	89520052	+	RNA	INS	-	-	T	rs200566449		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.500dup			ENST00000532228	2/2	3	.	3	0	.	0	RP11-358N4.3,non_coding_transcript_exon_variant,,ENST00000532228,;TRIM64DP,downstream_gene_variant,,ENST00000529289,;RP11-358N4.5,downstream_gene_variant,,ENST00000531893,;	T	ENSG00000255162	ENST00000532228	Transcript	non_coding_transcript_exon_variant	499-500/1454					rs200566449	1		1	RP11-358N4.3	Clone_based_vega_gene		unprocessed_pseudogene	YES									2/2																			MODIFIER	1	insertion														.	TGT	.	.																					89520051
NAALAD2	10003	.	GRCh37	11	89877909	89877910	+	Intron	DEL	AA	AA	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																c.195-2576_195-2575del			ENST00000534061		4	.	4	0	.	0	NAALAD2,intron_variant,,ENST00000321955,;NAALAD2,intron_variant,,ENST00000375944,;NAALAD2,intron_variant,,ENST00000525171,;NAALAD2,intron_variant,,ENST00000525497,;NAALAD2,intron_variant,,ENST00000526637,;NAALAD2,intron_variant,,ENST00000534061,NM_005467.3;NAALAD2,intron_variant,,ENST00000524501,;NAALAD2,intron_variant,,ENST00000527493,;NAALAD2,intron_variant,,ENST00000529090,;	-	ENSG00000077616	ENST00000534061	Transcript	intron_variant							1		1	NAALAD2	HGNC	14526	protein_coding	YES	CCDS8288.1	ENSP00000432481	Q9Y3Q0	E9PJ53,E9PII2	UPI0000031A85	NM_005467.3				2/18																		MODIFIER	1	deletion														.	TTAAA	.	.																					89877908
DISC1FP1	101929222	.	GRCh37	11	90095449	90095451	+	Intron	DEL	TTC	TTC	-	rs56143030		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTC	TTC																n.33+110968_33+110970del			ENST00000561596		5	.	4	4	.	0	DISC1FP1,intron_variant,,ENST00000561596,;DISC1FP1,intron_variant,,ENST00000562245,;,regulatory_region_variant,,ENSR00001011853,;	-	ENSG00000261645	ENST00000561596	Transcript	intron_variant,non_coding_transcript_variant						rs56143030	1		1	DISC1FP1	HGNC	33625	lincRNA											1/6			0.4289	0.2867		0.2163	0.336	0.4458										MODIFIER		deletion														.	TGTTCT	.	.																					90095448
Unknown	0	.	GRCh37	11	93939360	93939361	+	IGR	INS	-	-	AGATT	rs139281095		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		AGATT				intergenic_variant						rs139281095	1																				0.3313	0.415		0.3909	0.3936	0.2157										MODIFIER	1	insertion														.	AGA	.	.																					93939360
Unknown	0	.	GRCh37	11	94665258	94665259	+	IGR	INS	-	-	TGTG	rs3995595		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		TGTG				intergenic_variant						rs3995595	1																				0.1452	0.3401		0.3968	0.1869	0.2618										MODIFIER	1	insertion														.	TCT	.	.																					94665258
Unknown	0	.	GRCh37	11	96671198	96671198	+	IGR	DEL	C	C	-	rs35622249		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					5	.	5	0	.	0		-				intergenic_variant						rs35622249	1																				0.646	0.5058		0.3194	0.6531	0.7372										MODIFIER	1	deletion														.	TTCC	.	.																					96671197
Unknown	0	.	GRCh37	11	96834100	96834100	+	IGR	DEL	T	T	-	rs1005372643		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs1005372643	1																																			MODIFIER	1	deletion														.	GATT	.	.																					96834099
DYNC2H1	79659	.	GRCh37	11	103280142	103280143	+	Intron	INS	-	-	TAGT	rs112255466		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.12387+9545_12387+9546insTTAG			ENST00000398093		3	.	3	0	.	0	DYNC2H1,intron_variant,,ENST00000334267,;DYNC2H1,intron_variant,,ENST00000375735,NM_001080463.1,NM_001377.2;DYNC2H1,intron_variant,,ENST00000398093,;DYNC2H1,intron_variant,,ENST00000533197,;DYNC2H1,intron_variant,,ENST00000528670,;MTND1P36,upstream_gene_variant,,ENST00000522384,;MTND2P26,upstream_gene_variant,,ENST00000528255,;RP11-37O16.8,downstream_gene_variant,,ENST00000528866,;RP11-37O16.3,upstream_gene_variant,,ENST00000529569,;	TAGT	ENSG00000187240	ENST00000398093	Transcript	intron_variant						rs112255466	1		1	DYNC2H1	HGNC	2962	protein_coding	YES	CCDS44717.1	ENSP00000381167	Q8NCM8		UPI0000481AC7					85/89			0.6165	0.4971		0.5198	0.4304	0.5706										MODIFIER	1	insertion													1	.	AAT	.	.																					103280142
SLC35F2	54733	.	GRCh37	11	107706960	107706963	+	Intron	DEL	TTTT	TTTT	-	rs34704393		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTT	TTTT																c.111-20272_111-20269del			ENST00000525815		3	.	3	0	.	0	SLC35F2,intron_variant,,ENST00000265836,;SLC35F2,intron_variant,,ENST00000375682,;SLC35F2,intron_variant,,ENST00000429869,;SLC35F2,intron_variant,,ENST00000525071,;SLC35F2,intron_variant,,ENST00000525815,NM_017515.4;SLC35F2,intron_variant,,ENST00000524991,;SLC35F2,intron_variant,,ENST00000532513,;SLC35F2,intron_variant,,ENST00000533664,;	-	ENSG00000110660	ENST00000525815	Transcript	intron_variant						rs34704393	1		-1	SLC35F2	HGNC	23615	protein_coding	YES	CCDS41709.1	ENSP00000436785	Q8IXU6	E9PKZ2,B4DUB9	UPI0000074335	NM_017515.4				1/7			0.7496	0.3991		0.496	0.4304	0.5603										MODIFIER	1	deletion														.	TCTTTTT	.	.																					107706959
Unknown	0	.	GRCh37	11	108494398	108494399	+	IGR	INS	-	-	T	rs11454136		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs11454136	1																				0.9576	0.9986		1	0.999	1										MODIFIER	1	insertion														.	TAT	.	.																					108494398
NCAM1	4684	.	GRCh37	11	113149495	113149498	+	3'Flank	DEL	AGTT	AGTT	-	rs36166841		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGTT	AGTT																			ENST00000524665		4	.	4	0	.	0	NCAM1,downstream_gene_variant,,ENST00000316851,NM_181351.4,NM_001242607.1;NCAM1,downstream_gene_variant,,ENST00000524665,NM_000615.6;RP11-839D17.3,intron_variant,,ENST00000526487,;RP11-839D17.3,intron_variant,,ENST00000529416,;NCAM1-AS1,upstream_gene_variant,,ENST00000526229,;RP11-839D17.3,downstream_gene_variant,,ENST00000533504,;NCAM1-AS1,upstream_gene_variant,,ENST00000533638,;NCAM1,downstream_gene_variant,,ENST00000397957,;NCAM1,downstream_gene_variant,,ENST00000528158,;NCAM1,downstream_gene_variant,,ENST00000528590,;NCAM1,downstream_gene_variant,,ENST00000531044,;NCAM1,downstream_gene_variant,,ENST00000531915,;NCAM1,downstream_gene_variant,,ENST00000533073,;NCAM1,downstream_gene_variant,,ENST00000533226,;	-	ENSG00000149294	ENST00000524665	Transcript	downstream_gene_variant						rs36166841	1	3284	1	NCAM1	HGNC	7656	protein_coding	YES		ENSP00000474028		S4R389	UPI000333505F	NM_000615.6							0.7731	0.4308		0.0873	0.6044	0.6871										MODIFIER	1	deletion														.	AGAGTTA	.	.																					113149494
Unknown	0	.	GRCh37	11	113483149	113483149	+	IGR	DEL	A	A	-	rs34964425		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs34964425	1																				0.6626	0.8343		0.8879	0.8131	0.7618										MODIFIER	1	deletion														.	TCAA	.	.																					113483148
USP28	57646	.	GRCh37	11	113697928	113697928	+	Intron	DEL	A	A	-	rs370867434		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1187+27del			ENST00000003302		61	.	7	58	.	0	USP28,intron_variant,,ENST00000003302,NM_020886.2;USP28,intron_variant,,ENST00000260188,;USP28,intron_variant,,ENST00000537706,;USP28,intron_variant,,ENST00000538475,;USP28,intron_variant,,ENST00000544967,;USP28,intron_variant,,ENST00000545540,;USP28,downstream_gene_variant,,ENST00000537642,;RP11-667M19.10,downstream_gene_variant,,ENST00000399123,;USP28,downstream_gene_variant,,ENST00000542033,;USP28,intron_variant,,ENST00000535607,;USP28,intron_variant,,ENST00000537490,;USP28,intron_variant,,ENST00000540438,;USP28,intron_variant,,ENST00000545608,;	-	ENSG00000048028	ENST00000003302	Transcript	intron_variant						rs370867434	1		-1	USP28	HGNC	12625	protein_coding	YES	CCDS31680.1	ENSP00000003302	Q96RU2	Q96SV4	UPI0000137A00	NM_020886.2				11/24									0.06426	0.06433								MODIFIER	1	deletion														.	GGAA	.	.												0.09042	0.06811	0.1181	0.178	0.09628	0.05441	0.07745	0.1139	0.1442	113697927
KMT2A	4297	.	GRCh37	11	118390113	118390113	+	Intron	DEL	T	T	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.11147-215del			ENST00000534358		10	.	4	12	.	0	KMT2A,intron_variant,,ENST00000354520,;KMT2A,intron_variant,,ENST00000389506,;KMT2A,intron_variant,,ENST00000534358,NM_005933.3,NM_001197104.1;RP11-770J1.3,non_coding_transcript_exon_variant,,ENST00000525992,;RP11-770J1.3,intron_variant,,ENST00000532597,;RP11-770J1.3,downstream_gene_variant,,ENST00000528578,;RP11-770J1.3,downstream_gene_variant,,ENST00000554407,;RP11-770J1.3,downstream_gene_variant,,ENST00000556583,;KMT2A,upstream_gene_variant,,ENST00000525408,;KMT2A,upstream_gene_variant,,ENST00000527839,;	-	ENSG00000118058	ENST00000534358	Transcript	intron_variant							1		1	KMT2A	HGNC	7132	protein_coding	YES	CCDS55791.1	ENSP00000436786	Q03164	Q9UPD0,Q9UM91,Q9HBJ4,B4DIJ7	UPI0001E5E732	NM_005933.3,NM_001197104.1				31/35																		MODIFIER	1	deletion													1	.	GCTT	.	.																					118390112
OAF	220323	.	GRCh37	11	120101693	120101693	+	3'Flank	DEL	G	G	-	rs36071585		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																			ENST00000328965		5	.	5	2	.	0	OAF,downstream_gene_variant,,ENST00000328965,NM_178507.2;OAF,downstream_gene_variant,,ENST00000531220,;	-	ENSG00000184232	ENST00000328965	Transcript	downstream_gene_variant						rs36071585	1	652	1	OAF	HGNC	28752	protein_coding	YES	CCDS8430.1	ENSP00000332613	Q86UD1	E9PJ29	UPI000000DC44	NM_178507.2						0.3251	0.2655	0.4337		0.005	0.7068	0.2658										MODIFIER	1	deletion														.	CTGT	.	.																					120101692
POU2F3	25833	.	GRCh37	11	120175328	120175329	+	Intron	INS	-	-	A	rs76200914		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.451-404dup			ENST00000260264		4	.	4	0	.	0	POU2F3,intron_variant,,ENST00000260264,NM_001244682.1;POU2F3,intron_variant,,ENST00000543440,NM_014352.3;POU2F3,upstream_gene_variant,,ENST00000532663,;POU2F3,intron_variant,,ENST00000533620,;POU2F3,upstream_gene_variant,,ENST00000532638,;POU2F3,downstream_gene_variant,,ENST00000606153,;,regulatory_region_variant,,ENSR00001017810,;,TF_binding_site_variant,,ENSM00524713440,;	A	ENSG00000137709	ENST00000260264	Transcript	intron_variant						rs76200914	1		1	POU2F3	HGNC	19864	protein_coding	YES	CCDS58190.1	ENSP00000260264	Q9UKI9		UPI0002064EE0	NM_001244682.1				6/12			0.056	0.1182		0.0446	0.0765	0.1401										MODIFIER	1	insertion														.	ACA	.	.																					120175328
Unknown	0	.	GRCh37	11	125948554	125948554	+	IGR	DEL	T	T	-	rs780841320		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs780841320	1																																			MODIFIER	1	deletion														.	GCTT	.	.																					125948553
FOXRED1	55572	.	GRCh37	11	126141134	126141135	+	Intron	INS	-	AAGG	AAGG	rs56266376		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.86-198_86-197insAAGG			ENST00000263578		2	.	1	5	.	5	FOXRED1,intron_variant,,ENST00000263578,NM_017547.3;FOXRED1,intron_variant,,ENST00000442061,;FOXRED1,intron_variant,,ENST00000532125,;SRPR,upstream_gene_variant,,ENST00000332118,NM_003139.3;SRPR,upstream_gene_variant,,ENST00000532259,NM_001177842.1;FOXRED1,intron_variant,,ENST00000526366,;FOXRED1,intron_variant,,ENST00000533839,;FOXRED1,intron_variant,,ENST00000534011,;SRPR,upstream_gene_variant,,ENST00000530680,;FOXRED1,non_coding_transcript_exon_variant,,ENST00000534315,;FOXRED1,non_coding_transcript_exon_variant,,ENST00000532101,;FOXRED1,intron_variant,,ENST00000524751,;FOXRED1,intron_variant,,ENST00000525083,;FOXRED1,intron_variant,,ENST00000525770,;FOXRED1,intron_variant,,ENST00000526525,;FOXRED1,intron_variant,,ENST00000527004,;FOXRED1,intron_variant,,ENST00000529802,;SRPR,upstream_gene_variant,,ENST00000527817,;FOXRED1,upstream_gene_variant,,ENST00000527875,;SRPR,upstream_gene_variant,,ENST00000528744,;FOXRED1,upstream_gene_variant,,ENST00000530642,;FOXRED1,upstream_gene_variant,,ENST00000531257,;FOXRED1,upstream_gene_variant,,ENST00000533395,;	AAGG	ENSG00000110074	ENST00000263578	Transcript	intron_variant						rs56266376	1		1	FOXRED1	HGNC	26927	protein_coding	YES	CCDS8471.1	ENSP00000263578	Q96CU9	B4DXM1,B4DQI0	UPI0000037C04	NM_017547.3				1/10		0.9135	0.9675	0.8631		0.998	0.7773	0.9294										MODIFIER	1	insertion													1	.	AAG	.	.																					126141134
Unknown	0	.	GRCh37	11	129671452	129671452	+	IGR	DEL	A	A	-	rs550203714		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs550203714	1																				0.3623	0.2061		0.1399	0.2087	0.3395										MODIFIER	1	deletion														.	TCAA	.	.																					129671451
ADAMTS8	11095	.	GRCh37	11	130281654	130281662	+	Intron	DEL	TGGCCTGCA	TGGCCTGCA	-	rs3837395		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGGCCTGCA	TGGCCTGCA																c.1567-167_1567-159del			ENST00000257359		3	.	3	0	.	0	ADAMTS8,intron_variant,,ENST00000257359,NM_007037.4;ADAMTS8,non_coding_transcript_exon_variant,,ENST00000531752,;	-	ENSG00000134917	ENST00000257359	Transcript	intron_variant						rs3837395	1		-1	ADAMTS8	HGNC	224	protein_coding	YES	CCDS41732.1	ENSP00000257359	Q9UP79		UPI000013CF5D	NM_007037.4				5/8			0.2133	0.085		0.245	0.0895	0.1462										MODIFIER	1	deletion														.	TGTGGCCTGCAT	.	.																					130281653
ADAMTS15	170689	.	GRCh37	11	130335769	130335769	+	Intron	DEL	T	T	-	rs71061391		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1542+3108del			ENST00000299164		4	.	4	0	.	0	ADAMTS15,intron_variant,,ENST00000299164,NM_139055.2;	-	ENSG00000166106	ENST00000299164	Transcript	intron_variant						rs71061391	1		1	ADAMTS15	HGNC	16305	protein_coding	YES	CCDS8488.1	ENSP00000299164	Q8TE58		UPI000004F277	NM_139055.2				4/7																		MODIFIER	1	deletion														.	TCTT	.	.																					130335768
NTM	50863	.	GRCh37	11	131272292	131272292	+	Intron	DEL	A	A	-	rs56370339		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.82+31521del			ENST00000374791		3	.	3	0	.	0	NTM,intron_variant,,ENST00000374791,NM_001048209.1;NTM,intron_variant,,ENST00000436745,;NTM,intron_variant,,ENST00000539799,;NTM,intron_variant,,ENST00000477098,;,regulatory_region_variant,,ENSR00001543278,;	-	ENSG00000182667	ENST00000374791	Transcript	intron_variant						rs56370339	1		1	NTM	HGNC	17941	protein_coding		CCDS41733.1	ENSP00000363923	Q9P121		UPI0000047814	NM_001048209.1				1/7																		MODIFIER	1	deletion														.	ATAA	.	.																					131272291
NTM	50863	.	GRCh37	11	131812840	131812842	+	Intron	DEL	AAA	AAA	-	rs5795748		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAA	AAA																c.167+31310_167+31312del			ENST00000425719		4	.	4	0	.	0	NTM,intron_variant,,ENST00000374784,NM_001144059.1;NTM,intron_variant,,ENST00000374786,NM_001144058.1,NM_016522.2;NTM,intron_variant,,ENST00000374791,NM_001048209.1;NTM,intron_variant,,ENST00000425719,;NTM,intron_variant,,ENST00000427481,;NTM,intron_variant,,ENST00000539799,;NTM,intron_variant,,ENST00000550167,;NTM,intron_variant,,ENST00000498764,;NTM,intron_variant,,ENST00000479431,;	-	ENSG00000182667	ENST00000425719	Transcript	intron_variant						rs5795748	1		1	NTM	HGNC	17941	protein_coding	YES	CCDS44777.1	ENSP00000396722	Q9P121		UPI00001A58B9					1/7																		MODIFIER	1	deletion														.	TCAAAA	.	.																					131812839
OPCML	4978	.	GRCh37	11	133051360	133051360	+	Intron	DEL	A	A	-	rs35710142		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.62-238455del			ENST00000524381		4	.	3	3	.	0	OPCML,intron_variant,,ENST00000524381,NM_001012393.1;OPCML,intron_variant,,ENST00000529038,;	-	ENSG00000183715	ENST00000524381	Transcript	intron_variant						rs35710142	1		-1	OPCML	HGNC	8143	protein_coding		CCDS31722.1	ENSP00000434750	Q14982	B2CZX3	UPI00001A9955	NM_001012393.1				1/7			0.3041	0.2565		0.0308	0.325	0.1881										MODIFIER	1	deletion													1	.	TTAA	.	.																					133051359
IGSF9B	22997	.	GRCh37	11	133789014	133789014	+	Intron	DEL	G	G	-	rs59914981		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.3983+623del			ENST00000533871		18	.	5	14	.	0	IGSF9B,intron_variant,,ENST00000321016,;IGSF9B,intron_variant,,ENST00000533871,NM_001277285.1;IGSF9B,downstream_gene_variant,,ENST00000527648,;	-	ENSG00000080854	ENST00000533871	Transcript	intron_variant						rs59914981	1		-1	IGSF9B	HGNC	32326	protein_coding	YES	CCDS61010.1	ENSP00000436552		G5EA26	UPI0002C439DB	NM_001277285.1				18/19			0.2995	0.1455		0.0387	0.0845	0.2168	0.2489	0.2224								MODIFIER	1	deletion														.	ACGG	.	.																					133789013
CACNA1C	775	.	GRCh37	12	2548880	2548881	+	Intron	INS	-	-	T	rs57831176		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.478-9249dup			ENST00000347598		3	.	3	0	.	0	CACNA1C,intron_variant,,ENST00000327702,NM_001129830.1;CACNA1C,intron_variant,,ENST00000335762,;CACNA1C,intron_variant,,ENST00000344100,;CACNA1C,intron_variant,,ENST00000347598,NM_199460.2,NM_001129827.1;CACNA1C,intron_variant,,ENST00000399591,NM_001129838.1,NM_001129846.1;CACNA1C,intron_variant,,ENST00000399595,NM_001129837.1;CACNA1C,intron_variant,,ENST00000399597,NM_001129844.1,NM_001129842.1;CACNA1C,intron_variant,,ENST00000399601,NM_001129843.1;CACNA1C,intron_variant,,ENST00000399603,NM_001167623.1;CACNA1C,intron_variant,,ENST00000399606,NM_001129832.1;CACNA1C,intron_variant,,ENST00000399617,NM_001167624.1;CACNA1C,intron_variant,,ENST00000399621,;CACNA1C,intron_variant,,ENST00000399629,NM_001129836.1;CACNA1C,intron_variant,,ENST00000399634,NM_001167625.1;CACNA1C,intron_variant,,ENST00000399637,NM_001129835.1;CACNA1C,intron_variant,,ENST00000399638,NM_001129831.1;CACNA1C,intron_variant,,ENST00000399641,NM_001129840.1;CACNA1C,intron_variant,,ENST00000399644,NM_001129841.1;CACNA1C,intron_variant,,ENST00000399649,NM_001129839.1;CACNA1C,intron_variant,,ENST00000399655,NM_001129834.1,NM_001129829.1,NM_000719.6;CACNA1C,intron_variant,,ENST00000402845,NM_001129833.1;CACNA1C,intron_variant,,ENST00000406454,;CACNA1C,intron_variant,,ENST00000480911,;,regulatory_region_variant,,ENSR00001021777,;	T	ENSG00000151067	ENST00000347598	Transcript	intron_variant						rs57831176	1		1	CACNA1C	HGNC	1390	protein_coding	YES	CCDS44788.1	ENSP00000266376	Q13936	Q86XX0,O95234	UPI0000E593E5	NM_199460.2,NM_001129827.1				3/48																		MODIFIER	1	insertion													1	.	GGT	.	.																					2548880
Unknown	0	.	GRCh37	12	4187774	4187775	+	IGR	INS	-	-	G	rs35288854		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		G				intergenic_variant						rs35288854	1																				0.8185	0.4308		0.8135	0.3121	0.545										MODIFIER	1	insertion														.	GTG	.	.																					4187774
ANO2	57101	.	GRCh37	12	5942933	5942933	+	Intron	DEL	T	T	-	rs61564107		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.622-1164del			ENST00000327087		4	.	4	0	.	0	ANO2,intron_variant,,ENST00000327087,NM_001278596.1,NM_001278597.1;ANO2,intron_variant,,ENST00000356134,;ANO2,intron_variant,,ENST00000546188,;ANO2,intron_variant,,ENST00000544988,;	-	ENSG00000047617	ENST00000327087	Transcript	intron_variant						rs61564107	1		-1	ANO2	HGNC	1183	protein_coding	YES		ENSP00000314048	Q9NQ90	Q69YW4	UPI0001823FDD	NM_001278596.1,NM_001278597.1				4/25		0.5437	0.0885	0.7406		0.7242	0.666	0.7076										MODIFIER	1	deletion														.	CCTG	.	.																					5942932
RP1-96H9.5	0	.	GRCh37	12	6379673	6379673	+	5'Flank	DEL	T	T	-	rs1304933187		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000539998		6	4	2	7	7	0	RP1-96H9.5,upstream_gene_variant,,ENST00000537967,;RP1-96H9.5,upstream_gene_variant,,ENST00000539998,;	-	ENSG00000256103	ENST00000539998	Transcript	upstream_gene_variant						rs1304933187	1	82	-1	RP1-96H9.5	Clone_based_vega_gene		processed_pseudogene	YES																												MODIFIER	1	deletion														.	TCTC	.	.																					6379672
Unknown	0	.	GRCh37	12	9504970	9505013	+	IGR	DEL	TTCTCAACTGAGACAGAATACATTTCTATTGTTATAAGCCAGGG	TTCTCAACTGAGACAGAATACATTTCTATTGTTATAAGCCAGGG	-	rs6144607		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTCTCAACTGAGACAGAATACATTTCTATTGTTATAAGCCAGGG	TTCTCAACTGAGACAGAATACATTTCTATTGTTATAAGCCAGGG																					3	.	3	0	.	0		-				intergenic_variant						rs6144607	1																			0.8367	0.5877	0.879		0.9692	0.9145	0.9264										MODIFIER	1	deletion														.	CCTTCTCAACTGAGACAGAATACATTTCTATTGTTATAAGCCAGGGA	.	.																					9504969
CLEC9A	283420	.	GRCh37	12	10196270	10196271	+	Intron	DEL	TA	TA	-	rs60284724		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TA	TA																c.-163+2069_-163+2070del			ENST00000355819		3	.	3	0	.	0	CLEC9A,intron_variant,,ENST00000355819,NM_207345.2;CLEC9A,intron_variant,,ENST00000544751,;RP11-133L14.2,intron_variant,,ENST00000538284,;	-	ENSG00000197992	ENST00000355819	Transcript	intron_variant						rs60284724	1		1	CLEC9A	HGNC	26705	protein_coding	YES	CCDS8611.1	ENSP00000348074	Q6UXN8		UPI00001D696C	NM_207345.2				2/8																		MODIFIER	1	deletion														.	TGTAT	.	.																					10196269
DUSP16	80824	.	GRCh37	12	12627325	12627326	+	3'Flank	DEL	AT	AT	-	rs16727		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																			ENST00000228862		3	.	3	0	.	0	DUSP16,downstream_gene_variant,,ENST00000228862,NM_030640.2;DUSP16,downstream_gene_variant,,ENST00000298573,;DUSP16,downstream_gene_variant,,ENST00000545864,;,regulatory_region_variant,,ENSR00001545213,;	-	ENSG00000111266	ENST00000228862	Transcript	downstream_gene_variant						rs16727	1	1503	-1	DUSP16	HGNC	17909	protein_coding	YES	CCDS8650.1	ENSP00000228862	Q9BY84	Q8IVT8,F5H5X4	UPI0000001BCE	NM_030640.2						0.0613	0.003	0.0418		0.1766	0.0825	0.0133										MODIFIER	1	deletion														.	ACATG	.	.																					12627324
Unknown	0	.	GRCh37	12	17912796	17912797	+	IGR	INS	-	-	ACAGGGGCCATCTTCTC	rs71061256		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		ACAGGGGCCATCTTCTC				intergenic_variant						rs71061256	1																				0.4319	0.5706		0.5813	0.507	0.6094										MODIFIER	1	insertion														.	GGA	.	.																					17912796
RP11-283G6.4	0	.	GRCh37	12	26443652	26443653	+	Intron	INS	-	-	GACTTTT	rs56094350		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.130+35664_130+35665insAAAAGTC			ENST00000540392		5	.	5	0	.	0	RP11-283G6.4,intron_variant,,ENST00000540392,;RP11-283G6.5,intron_variant,,ENST00000540625,;SSPN,intron_variant,,ENST00000534829,;SSPN,downstream_gene_variant,,ENST00000544231,;	GACTTTT	ENSG00000256234	ENST00000540392	Transcript	intron_variant,non_coding_transcript_variant						rs56094350	1		-1	RP11-283G6.4	Clone_based_vega_gene		antisense	YES										2/3		0.6046	0.562	0.6744		0.7847	0.498	0.5368										MODIFIER	1	insertion														.	TAA	.	.																					26443652
ITPR2	3709	.	GRCh37	12	26867982	26867983	+	Intron	DEL	TG	TG	-	rs148080935		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																c.855+249_855+250del			ENST00000381340		5	.	5	0	.	0	ITPR2,intron_variant,,ENST00000381340,NM_002223.2;ITPR2,intron_variant,,ENST00000540791,;ITPR2,downstream_gene_variant,,ENST00000545235,;	-	ENSG00000123104	ENST00000381340	Transcript	intron_variant						rs148080935	1		-1	ITPR2	HGNC	6181	protein_coding	YES	CCDS41764.1	ENSP00000370744	Q14571	I1VE21	UPI00001FB7D2	NM_002223.2				8/56																		MODIFIER	1	deletion													1	.	AATGT	.	.																					26867981
CCDC91	55297	.	GRCh37	12	28588236	28588237	+	Intron	INS	-	-	T	rs112683375		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.763-14848dup			ENST00000545336		4	.	4	0	.	0	CCDC91,intron_variant,,ENST00000306172,;CCDC91,intron_variant,,ENST00000381256,;CCDC91,intron_variant,,ENST00000381259,NM_018318.3;CCDC91,intron_variant,,ENST00000536154,;CCDC91,intron_variant,,ENST00000539107,;CCDC91,intron_variant,,ENST00000540794,;CCDC91,intron_variant,,ENST00000545336,;CCDC91,intron_variant,,ENST00000539904,;CCDC91,intron_variant,,ENST00000540401,;CCDC91,intron_variant,,ENST00000535520,;CCDC91,intron_variant,,ENST00000536442,;CCDC91,intron_variant,,ENST00000543809,;CCDC91,intron_variant,,ENST00000545737,;	T	ENSG00000123106	ENST00000545336	Transcript	intron_variant						rs112683375	1		1	CCDC91	HGNC	24855	protein_coding	YES	CCDS8716.1	ENSP00000438040	Q7Z6B0	F5H4N8,F5GZH9,F5GXK6	UPI00001AEE23					11/15																		MODIFIER	1	insertion														.	CGT	.	.																					28588236
RP11-242C24.2	0	.	GRCh37	12	39859960	39859960	+	3'Flank	DEL	T	T	-	rs150473250		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000396414		3	.	3	0	.	0	RP11-242C24.2,downstream_gene_variant,,ENST00000396414,;	-	ENSG00000255991	ENST00000396414	Transcript	downstream_gene_variant						rs150473250	1	284	-1	RP11-242C24.2	Clone_based_vega_gene		processed_pseudogene	YES													0.0492	0.0865		0.0089	0.164	0.0654										MODIFIER	1	deletion														.	AATT	.	.																					39859959
ABCD2	225	.	GRCh37	12	40011026	40011026	+	Intron	DEL	T	T	-	rs66517223		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.940-56del			ENST00000308666		4	.	4	0	.	0	ABCD2,intron_variant,,ENST00000308666,NM_005164.3;,regulatory_region_variant,,ENSR00000050809,;	-	ENSG00000173208	ENST00000308666	Transcript	intron_variant						rs66517223	1		-1	ABCD2	HGNC	66	protein_coding	YES	CCDS8734.1	ENSP00000310688	Q9UBJ2		UPI000004C4C6	NM_005164.3				1/9			0.1914	0.4467		0.4058	0.4225	0.3589										MODIFIER	1	deletion														.	TCTT	.	.																					40011025
MUC19	283463	.	GRCh37	12	40910269	40910269	+	Intron	DEL	G	G	-	rs149400131		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.*5782+25140del			ENST00000454784		3	.	3	0	.	0	MUC19,intron_variant,,ENST00000454784,;MUC19,upstream_gene_variant,,ENST00000398702,;,regulatory_region_variant,,ENSR00001547469,;	-	ENSG00000205592	ENST00000454784	Transcript	intron_variant						rs149400131	1		1	MUC19	HGNC	14362	protein_coding	YES		ENSP00000476404		C9JCE7	UPI0003B927DE					49/83			0.0106	0.013			0.0249	0.0194										MODIFIER	1	deletion														.	CAGG	.	.																					40910268
CNTN1	1272	.	GRCh37	12	41298159	41298160	+	Intron	INS	-	-	TTCCTTCCT	rs11281401		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-76-3989_-76-3981dup			ENST00000551295		3	.	3	0	.	0	CNTN1,intron_variant,,ENST00000547702,NM_001256063.1;CNTN1,intron_variant,,ENST00000547849,NM_001256064.1;CNTN1,intron_variant,,ENST00000548005,;CNTN1,intron_variant,,ENST00000551295,NM_001843.3;CNTN1,intron_variant,,ENST00000551424,;CNTN1,intron_variant,,ENST00000552248,;CNTN1,intron_variant,,ENST00000552913,;CNTN1,upstream_gene_variant,,ENST00000347616,;CNTN1,upstream_gene_variant,,ENST00000348761,NM_175038.2;CNTN1,upstream_gene_variant,,ENST00000360099,;	TTCCTTCCT	ENSG00000018236	ENST00000551295	Transcript	intron_variant						rs11281401	1		1	CNTN1	HGNC	2171	protein_coding	YES	CCDS8737.1	ENSP00000447006	Q12860	F8VX96,F8VUI9,F8VUI8,F8VQW3	UPI0000127EBA	NM_001843.3				1/23			0.4085	0.3458		0.2123	0.1948	0.1227										MODIFIER	1	insertion													1	.	CCT	.	.																					41298159
Unknown	0	.	GRCh37	12	42040680	42040681	+	IGR	INS	-	-	G	rs34007175		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		G				intergenic_variant						rs34007175	1																				0.4425	0.4078		0.2589	0.3539	0.3006										MODIFIER	1	insertion														.	TAG	.	.																					42040680
BIN2	51411	.	GRCh37	12	51689358	51689403	+	Intron	DEL	AAAAATATATATATATATATATATATATATATATATATATATATAT	AAAAATATATATATATATATATATATATATATATATATATATATAT	-	rs375633854		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAAATATATATATATATATATATATATATATATATATATATATAT	AAAAATATATATATATATATATATATATATATATATATATATATAT																c.761+177_761+222del			ENST00000267012		3	.	3	0	.	0	BIN2,intron_variant,,ENST00000267012,NM_016293.2;BIN2,intron_variant,,ENST00000452142,;BIN2,intron_variant,,ENST00000544402,;BIN2,intron_variant,,ENST00000604560,;BIN2,intron_variant,,ENST00000603177,;BIN2,intron_variant,,ENST00000605039,;BIN2,intron_variant,,ENST00000605819,;	-	ENSG00000110934	ENST00000267012	Transcript	intron_variant						rs375633854	1		-1	BIN2	HGNC	1053	protein_coding	YES	CCDS8811.1	ENSP00000267012	Q9UBW5		UPI000013D71F	NM_016293.2				9/12																		MODIFIER	1	deletion														.	AAAAAAATATATATATATATATATATATATATATATATATATATATATA	.	.																					51689357
ANKRD33	341405	.	GRCh37	12	52285209	52285210	+	3'UTR	INS	-	-	TA	rs35582441		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.*129_*130dup			ENST00000301190	5/5	6	4	2	4	4	0	ANKRD33,3_prime_UTR_variant,,ENST00000301190,NM_001130015.1,NM_182608.3;ANKRD33,3_prime_UTR_variant,,ENST00000340970,;ANKRD33,downstream_gene_variant,,ENST00000538991,;ANKRD33,non_coding_transcript_exon_variant,,ENST00000547119,;ANKRD33,downstream_gene_variant,,ENST00000549316,;ANKRD33,non_coding_transcript_exon_variant,,ENST00000548526,;ANKRD33,non_coding_transcript_exon_variant,,ENST00000550652,;ANKRD33,downstream_gene_variant,,ENST00000548383,;ANKRD33,downstream_gene_variant,,ENST00000549751,;	TA	ENSG00000167612	ENST00000301190	Transcript	3_prime_UTR_variant	1706-1707/1935					rs35582441	1		1	ANKRD33	HGNC	13788	protein_coding	YES	CCDS8815.1	ENSP00000301190	Q7Z3H0	Q5K626,Q5K625,Q5K618,Q5K617	UPI00003668C0	NM_001130015.1,NM_182608.3			5/5				0.1392	0.1239		0.1726	0.2316	0.2321										MODIFIER	1	insertion														.	CCT	.	.																					52285209
OR6C74	254783	.	GRCh37	12	55638511	55638512	+	5'Flank	INS	-	-	AG	rs57109992		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000343870		5	.	5	0	.	0	OR6C74,upstream_gene_variant,,ENST00000343870,NM_001005490.1;	AG	ENSG00000197706	ENST00000343870	Transcript	upstream_gene_variant						rs57109992	1	2470	1	OR6C74	HGNC	31303	protein_coding	YES	CCDS31816.1	ENSP00000342836	A6NCV1		UPI000016150B	NM_001005490.1							0.0961	0.2262		0.0794	0.333	0.3742										MODIFIER	1	insertion														.	ATA	.	.																					55638511
ITGA7	3679	.	GRCh37	12	56096600	56096601	+	Intron	INS	-	-	ACACAC	rs138614852		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.414+50_414+55dup			ENST00000553804		30	.	11	18	.	0	ITGA7,intron_variant,,ENST00000257879,NM_002206.2;ITGA7,intron_variant,,ENST00000257880,;ITGA7,intron_variant,,ENST00000347027,;ITGA7,intron_variant,,ENST00000394229,;ITGA7,intron_variant,,ENST00000394230,;ITGA7,intron_variant,,ENST00000452168,NM_001144997.1;ITGA7,intron_variant,,ENST00000553804,NM_001144996.1;ITGA7,intron_variant,,ENST00000555728,;ITGA7,intron_variant,,ENST00000557257,;ITGA7,intron_variant,,ENST00000553276,;ITGA7,intron_variant,,ENST00000553737,;ITGA7,intron_variant,,ENST00000553893,;ITGA7,intron_variant,,ENST00000554724,;ITGA7,intron_variant,,ENST00000555687,;ITGA7,intron_variant,,ENST00000555809,;ITGA7,intron_variant,,ENST00000556273,;ITGA7,intron_variant,,ENST00000556371,;ITGA7,downstream_gene_variant,,ENST00000554359,;ITGA7,upstream_gene_variant,,ENST00000554543,;ITGA7,upstream_gene_variant,,ENST00000557488,;	ACACAC	ENSG00000135424	ENST00000553804	Transcript	intron_variant						rs138614852	2		-1	ITGA7	HGNC	6143	protein_coding	YES	CCDS55832.1	ENSP00000452120	Q13683		UPI00003668CF	NM_001144996.1				3/24			0.0197	0.036		0.001	0.0676	0.0429										MODIFIER	1	insertion													1	.	AAA	.	.																					56096600
ENSR00001032857	0	.	GRCh37	12	58874341	58874342	+	IGR	DEL	TA	TA	-	rs3032496		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TA	TA																			ENSR00001032857		5	.	4	2	.	0	,regulatory_region_variant,,ENSR00001032857,;	-		ENSR00001032857	RegulatoryFeature	regulatory_region_variant						rs3032496	1																				0.3608	0.3804		0.4196	0.5746	0.3834										MODIFIER	1	deletion														.	TGTAT	.	.																					58874340