genome.wustl.edu.TCGA-AR-A2LE.indel.97aa5e766ea447c79da152a341d09996.txt 987 KB
Newer Older
Pradat Yoann's avatar
Pradat Yoann committed
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452
#version 2.4
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_Position	End_Position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_File	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	HGVSc	HGVSp	HGVSp_Short	Transcript_ID	Exon_Number	t_depth	t_ref_count	t_alt_count	n_depth	n_ref_count	n_alt_count	all_effects	Allele	Gene	Feature	Feature_type	Consequence	cDNA_position	CDS_position	Protein_position	Amino_acids	Codons	Existing_variation	ALLELE_NUM	DISTANCE	STRAND_VEP	SYMBOL	SYMBOL_SOURCE	HGNC_ID	BIOTYPE	CANONICAL	CCDS	ENSP	SWISSPROT	TREMBL	UNIPARC	RefSeq	SIFT	PolyPhen	EXON	INTRON	DOMAINS	AF	AFR_AF	AMR_AF	ASN_AF	EAS_AF	EUR_AF	SAS_AF	AA_AF	EA_AF	CLIN_SIG	SOMATIC	PUBMED	MOTIF_NAME	MOTIF_POS	HIGH_INF_POS	MOTIF_SCORE_CHANGE	IMPACT	PICK	VARIANT_CLASS	TSL	HGVS_OFFSET	PHENO	MINIMISED	ExAC_AF	ExAC_AF_AFR	ExAC_AF_AMR	ExAC_AF_EAS	ExAC_AF_FIN	ExAC_AF_NFE	ExAC_AF_OTH	ExAC_AF_SAS	GENE_PHENO	FILTER	flanking_bps	vcf_id	vcf_qual	ExAC_AF_Adj	ExAC_AC_AN_Adj	ExAC_AC_AN	ExAC_AC_AN_AFR	ExAC_AC_AN_AMR	ExAC_AC_AN_EAS	ExAC_AC_AN_FIN	ExAC_AC_AN_NFE	ExAC_AC_AN_OTH	ExAC_AC_AN_SAS	ExAC_FILTER	gnomAD_AF	gnomAD_AFR_AF	gnomAD_AMR_AF	gnomAD_ASJ_AF	gnomAD_EAS_AF	gnomAD_FIN_AF	gnomAD_NFE_AF	gnomAD_OTH_AF	gnomAD_SAS_AF	vcf_pos
RP11-206L10.9	101930657	.	GRCh37	1	726314	726323	+	3'Flank	DEL	GAATGGAATG	GAATGGAATG	-	rs61728598		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAATGGAATG	GAATGGAATG																			ENST00000591702		3	.	3	0	.	0	RP11-206L10.9,intron_variant,,ENST00000429505,;RP11-206L10.9,intron_variant,,ENST00000585745,;RP11-206L10.9,intron_variant,,ENST00000585768,;RP11-206L10.9,intron_variant,,ENST00000586288,;RP11-206L10.9,intron_variant,,ENST00000587530,;RP11-206L10.9,intron_variant,,ENST00000588951,;RP11-206L10.9,intron_variant,,ENST00000589531,;RP11-206L10.9,intron_variant,,ENST00000590848,;RP11-206L10.9,intron_variant,,ENST00000591440,;RP11-206L10.9,intron_variant,,ENST00000593022,;RP11-206L10.9,downstream_gene_variant,,ENST00000358533,;RP11-206L10.9,downstream_gene_variant,,ENST00000586928,;RP11-206L10.9,downstream_gene_variant,,ENST00000591702,;	-	ENSG00000237491	ENST00000591702	Transcript	downstream_gene_variant						rs61728598	1	3262	1	RP11-206L10.9	Clone_based_vega_gene		lincRNA	YES																												MODIFIER	1	deletion														.	CCGAATGGAATGG	.	.																					726313
AURKAIP1	54998	.	GRCh37	1	1311059	1311059	+	5'Flank	DEL	A	A	-	rs113734584		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000338370		3	.	3	0	.	0	AURKAIP1,upstream_gene_variant,,ENST00000321751,NM_001127230.1;AURKAIP1,upstream_gene_variant,,ENST00000338338,NM_017900.2;AURKAIP1,upstream_gene_variant,,ENST00000338370,;AURKAIP1,upstream_gene_variant,,ENST00000378853,NM_001127229.1;AURKAIP1,upstream_gene_variant,,ENST00000489799,;AURKAIP1,upstream_gene_variant,,ENST00000496905,;RP5-890O3.3,upstream_gene_variant,,ENST00000435351,;,regulatory_region_variant,,ENSR00000000184,;,TF_binding_site_variant,,ENSM00524417562,;,TF_binding_site_variant,,ENSM00524493153,;	-	ENSG00000175756	ENST00000338370	Transcript	upstream_gene_variant						rs113734584	1	522	-1	AURKAIP1	HGNC	24114	protein_coding	YES	CCDS25.1	ENSP00000342676	Q9NWT8		UPI00000709CC																							MODIFIER	1	deletion														.	TTAA	.	.																					1311058
PRDM16	63976	.	GRCh37	1	3098131	3098132	+	Intron	DEL	CA	CA	-	rs199884884		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CA	CA																c.38-4558_38-4557del			ENST00000270722		6	.	3	5	.	5	PRDM16,intron_variant,,ENST00000270722,;PRDM16,intron_variant,,ENST00000378391,;PRDM16,intron_variant,,ENST00000378398,;PRDM16,intron_variant,,ENST00000441472,NM_022114.3;PRDM16,intron_variant,,ENST00000442529,NM_199454.2;PRDM16,intron_variant,,ENST00000511072,;PRDM16,intron_variant,,ENST00000514189,;PRDM16,intron_variant,,ENST00000607632,;	-	ENSG00000142611	ENST00000270722	Transcript	intron_variant						rs199884884	1		1	PRDM16	HGNC	14000	protein_coding	YES	CCDS41236.2	ENSP00000270722	Q9HAZ2		UPI0000458A29					1/16																		MODIFIER	1	deletion													1	.	CGCAG	.	.																					3098130
PRDM16	63976	.	GRCh37	1	3159943	3159943	+	Intron	DEL	A	A	-	rs57900782		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.388-698del			ENST00000270722		3	.	3	0	.	0	PRDM16,intron_variant,,ENST00000270722,;PRDM16,intron_variant,,ENST00000378391,;PRDM16,intron_variant,,ENST00000378398,;PRDM16,intron_variant,,ENST00000441472,NM_022114.3;PRDM16,intron_variant,,ENST00000442529,NM_199454.2;PRDM16,intron_variant,,ENST00000511072,;PRDM16,intron_variant,,ENST00000514189,;PRDM16,upstream_gene_variant,,ENST00000463591,;PRDM16,intron_variant,,ENST00000512462,;	-	ENSG00000142611	ENST00000270722	Transcript	intron_variant						rs57900782	1		1	PRDM16	HGNC	14000	protein_coding	YES	CCDS41236.2	ENSP00000270722	Q9HAZ2		UPI0000458A29					2/16			0.7542	0.7622		0.7698	0.7694	0.7331										MODIFIER	1	deletion													1	.	CCAA	.	.																					3159942
CEP104	9731	.	GRCh37	1	3750216	3750216	+	Intron	DEL	C	C	-	rs35801288		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.1659+210del			ENST00000378230		3	.	3	0	.	0	CEP104,intron_variant,,ENST00000378230,NM_014704.3;CEP104,upstream_gene_variant,,ENST00000438539,;CEP104,downstream_gene_variant,,ENST00000443466,;CEP104,upstream_gene_variant,,ENST00000461667,;CEP104,intron_variant,,ENST00000460038,;CEP104,downstream_gene_variant,,ENST00000494653,;CEP104,upstream_gene_variant,,ENST00000495701,;	-	ENSG00000116198	ENST00000378230	Transcript	intron_variant						rs35801288	1		-1	CEP104	HGNC	24866	protein_coding	YES	CCDS30571.1	ENSP00000367476	O60308		UPI0000139AA8	NM_014704.3				12/21		0.3544	0.2519	0.4971		0.3383	0.4294	0.3313										MODIFIER	1	deletion													1	.	AACA	.	.																					3750215
KLHL21	9903	.	GRCh37	1	6654765	6654765	+	Intron	DEL	A	A	-	rs878994294		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1500+780del			ENST00000377658		6	.	6	0	.	0	KLHL21,3_prime_UTR_variant,,ENST00000377663,;KLHL21,intron_variant,,ENST00000377658,NM_014851.2;KLHL21,intron_variant,,ENST00000463043,;KLHL21,intron_variant,,ENST00000467612,;KLHL21,intron_variant,,ENST00000496707,;	-	ENSG00000162413	ENST00000377658	Transcript	intron_variant						rs878994294	1		-1	KLHL21	HGNC	29041	protein_coding	YES	CCDS30575.1	ENSP00000366886	Q9UJP4	Q2NKK7,K7ESH2,K7EMF2,K7ELI0	UPI0000070D85	NM_014851.2				3/3																		MODIFIER	1	deletion														.	ATAA	.	.																					6654764
CAMTA1	23261	.	GRCh37	1	7328327	7328327	+	Intron	DEL	G	G	-	rs56775847		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.438+18647del			ENST00000303635		5	.	5	0	.	0	CAMTA1,intron_variant,,ENST00000303635,NM_015215.2;CAMTA1,intron_variant,,ENST00000439411,;	-	ENSG00000171735	ENST00000303635	Transcript	intron_variant						rs56775847	1		1	CAMTA1	HGNC	18806	protein_coding	YES	CCDS30576.1	ENSP00000306522	Q9Y6Y1		UPI00001C1D72	NM_015215.2				5/22			0.997	0.9265		0.8333	0.9036	0.8773										MODIFIER	1	deletion													1	.	AAGG	.	.																					7328326
CAMTA1	23261	.	GRCh37	1	7395833	7395833	+	Intron	DEL	A	A	-	rs5772272		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.438+86161del			ENST00000303635		3	.	3	0	.	0	CAMTA1,intron_variant,,ENST00000303635,NM_015215.2;CAMTA1,intron_variant,,ENST00000439411,;,regulatory_region_variant,,ENSR00000920069,;,TF_binding_site_variant,,ENSM00718914870,;	-	ENSG00000171735	ENST00000303635	Transcript	intron_variant						rs5772272	1		1	CAMTA1	HGNC	18806	protein_coding	YES	CCDS30576.1	ENSP00000306522	Q9Y6Y1		UPI00001C1D72	NM_015215.2				5/22																		MODIFIER	1	deletion													1	.	TTAA	.	.																					7395832
CAMTA1	23261	.	GRCh37	1	7588862	7588863	+	Intron	INS	-	-	ATGA	rs3033702		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.510+60935_510+60938dup			ENST00000303635		6	4	2	4	4	0	CAMTA1,intron_variant,,ENST00000303635,NM_015215.2;CAMTA1,intron_variant,,ENST00000439411,;	ATGA	ENSG00000171735	ENST00000303635	Transcript	intron_variant						rs3033702	1		1	CAMTA1	HGNC	18806	protein_coding	YES	CCDS30576.1	ENSP00000306522	Q9Y6Y1		UPI00001C1D72	NM_015215.2				6/22			0.3109	0.1873		0.1935	0.2306	0.3027										MODIFIER	1	insertion													1	.	GGA	.	.																					7588862
RERE	473	.	GRCh37	1	8791841	8791843	+	Intron	DEL	TTG	TTG	-	rs141905642		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTG	TTG																c.-145+60620_-145+60622del			ENST00000337907		3	.	3	0	.	0	RERE,intron_variant,,ENST00000337907,NM_012102.3;RERE,intron_variant,,ENST00000400908,NM_001042681.1;RERE,intron_variant,,ENST00000480342,;	-	ENSG00000142599	ENST00000337907	Transcript	intron_variant						rs141905642	1		-1	RERE	HGNC	9965	protein_coding	YES	CCDS95.1	ENSP00000338629	Q9P2R6	K7EJQ1,K7EIQ4,K7EIE3	UPI00001419CC	NM_012102.3				2/23			0.8691	0.8818		0.9325	0.841	0.6759										MODIFIER	1	deletion													1	.	TTTTGT	.	.																					8791840
UBE4B	10277	.	GRCh37	1	10119867	10119867	+	Intron	DEL	T	T	-	rs912413544		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.25-12211del			ENST00000343090		6	.	3	3	.	0	UBE4B,intron_variant,,ENST00000253251,;UBE4B,intron_variant,,ENST00000343090,NM_001105562.2;UBE4B,intron_variant,,ENST00000377153,;UBE4B,intron_variant,,ENST00000377157,NM_006048.4;PGAM1P11,downstream_gene_variant,,ENST00000416729,;	-	ENSG00000130939	ENST00000343090	Transcript	intron_variant						rs912413544	1		1	UBE4B	HGNC	12500	protein_coding	YES	CCDS41245.1	ENSP00000343001	O95155		UPI0000137944	NM_001105562.2				1/27																		MODIFIER	1	deletion														.	CATT	.	.																					10119866
KIF1B	23095	.	GRCh37	1	10372181	10372183	+	Intron	DEL	TGA	TGA	-	rs36109286		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGA	TGA																c.1978-7916_1978-7914del			ENST00000263934		3	.	3	0	.	0	KIF1B,intron_variant,,ENST00000263934,NM_015074.3;KIF1B,intron_variant,,ENST00000377081,;KIF1B,intron_variant,,ENST00000377086,;KIF1B,downstream_gene_variant,,ENST00000377093,NM_183416.3;	-	ENSG00000054523	ENST00000263934	Transcript	intron_variant						rs36109286	1		1	KIF1B	HGNC	16636	protein_coding	YES	CCDS111.1	ENSP00000263934	O60333	B4DMF3	UPI000013EE7E	NM_015074.3				20/46			0.264	0.3775		0.3472	0.3539	0.2873										MODIFIER	1	deletion													1	.	GCTGAT	.	.																					10372180
APITD1	378708	.	GRCh37	1	10490760	10490768	+	Intron	DEL	TGGCTTAAC	TGGCTTAAC	-	rs35995075		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGGCTTAAC	TGGCTTAAC																c.51+137_51+145del			ENST00000602787		7	.	3	11	.	0	APITD1,intron_variant,,ENST00000309048,NM_199294.2,NM_001270517.1;APITD1-CORT,intron_variant,,ENST00000400900,;APITD1-CORT,intron_variant,,ENST00000470413,;APITD1,intron_variant,,ENST00000602296,NM_199006.2;APITD1,intron_variant,,ENST00000602787,NM_198544.3;APITD1,upstream_gene_variant,,ENST00000477755,;APITD1-CORT,upstream_gene_variant,,ENST00000602446,;RP4-736L20.3,upstream_gene_variant,,ENST00000607572,;APITD1,intron_variant,,ENST00000602486,;APITD1,upstream_gene_variant,,ENST00000462462,;APITD1-CORT,upstream_gene_variant,,ENST00000465026,;,regulatory_region_variant,,ENSR00000001275,;	-	ENSG00000175279	ENST00000602787	Transcript	intron_variant						rs35995075	1		1	APITD1	HGNC	23163	protein_coding	YES	CCDS114.1	ENSP00000473509	Q8N2Z9		UPI000007101C	NM_198544.3				1/4			0.6891	0.6066		0.4643	0.492	0.5879										MODIFIER		deletion														.	GTTGGCTTAACT	.	.																					10490759
Unknown	0	.	GRCh37	1	14212447	14212456	+	IGR	DEL	TGTTTCTCAT	TGTTTCTCAT	-	rs70984293		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGTTTCTCAT	TGTTTCTCAT																					3	.	3	0	.	0		-				intergenic_variant						rs70984293	1																			0.4607	0.2632	0.2925		0.6964	0.4751	0.589										MODIFIER	1	deletion														.	ACTGTTTCTCATC	.	.																					14212446
CROCCP2	84809	.	GRCh37	1	16970870	16970871	+	Intron	INS	-	C	C	rs56378906		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.38+270dup			ENST00000362058		5	.	0	5	.	5	CROCCP2,intron_variant,,ENST00000362058,;MST1P2,upstream_gene_variant,,ENST00000334429,;MST1P2,upstream_gene_variant,,ENST00000418421,;MST1P2,upstream_gene_variant,,ENST00000457982,;,regulatory_region_variant,,ENSR00000002094,;	C	ENSG00000215908	ENST00000362058	Transcript	intron_variant,non_coding_transcript_variant						rs56378906	1		-1	CROCCP2	HGNC	28170	retained_intron	YES										1/5																		MODIFIER	1	insertion														.	CGC	.	.																					16970870
ESPNP	284729	.	GRCh37	1	17039464	17039465	+	Intron	INS	-	-	AAAT	rs61399088		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.195-4895_195-4892dup			ENST00000270691		8	.	4	8	.	0	ESPNP,intron_variant,,ENST00000492551,;ESPNP,intron_variant,,ENST00000270691,;ESPNP,upstream_gene_variant,,ENST00000535711,;,regulatory_region_variant,,ENSR00001493173,;	AAAT	ENSG00000268869	ENST00000270691	Transcript	intron_variant,non_coding_transcript_variant						rs61399088	1		-1	ESPNP	HGNC	23285	transcribed_unprocessed_pseudogene	YES										1/10			0.2141	0.2983		0.3938	0.2664	0.271										MODIFIER	1	insertion														.	AGA	.	.																					17039464
CROCC	9696	.	GRCh37	1	17278378	17278378	+	Intron	DEL	T	T	-	rs35956886		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.3006+772del			ENST00000375541		3	.	3	0	.	0	CROCC,intron_variant,,ENST00000375541,NM_014675.3;CROCC,intron_variant,,ENST00000445545,;CROCC,intron_variant,,ENST00000467938,;CROCC,intron_variant,,ENST00000486318,;CROCC,intron_variant,,ENST00000498688,;CROCC,downstream_gene_variant,,ENST00000477773,;CROCC,intron_variant,,ENST00000494191,;CROCC,upstream_gene_variant,,ENST00000497654,;,regulatory_region_variant,,ENSR00000250481,;,regulatory_region_variant,,ENSR00001493218,;,TF_binding_site_variant,,ENSM00527790104,;	-	ENSG00000058453	ENST00000375541	Transcript	intron_variant						rs35956886	1		1	CROCC	HGNC	21299	protein_coding	YES	CCDS30616.1	ENSP00000364691	Q5TZA2		UPI00001AE5A0	NM_014675.3				20/36			0.6006	0.6441		0.9137	0.6799	0.683										MODIFIER	1	deletion														.	TCTT	.	.																					17278377
Unknown	0	.	GRCh37	1	19159481	19159481	+	IGR	DEL	T	T	-	rs72268125		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					5	.	5	0	.	0		-				intergenic_variant						rs72268125	1																				0.5855	0.6081		0.5417	0.6879	0.6401										MODIFIER	1	deletion														.	TCTT	.	.																					19159480
AKR7L	0	.	GRCh37	1	19592799	19592800	+	3'UTR	INS	-	-	TTTG	rs147772000		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.*991_*994dup			ENST00000420396	5/5	6	.	6	3	.	0	AKR7L,3_prime_UTR_variant,,ENST00000420396,;AKR7L,downstream_gene_variant,,ENST00000493176,;AKR7L,3_prime_UTR_variant,,ENST00000457194,;AKR7L,downstream_gene_variant,,ENST00000429712,;	TTTG	ENSG00000211454	ENST00000420396	Transcript	3_prime_UTR_variant	1793-1794/2115					rs147772000	1		-1	AKR7L	HGNC	24056	protein_coding	YES		ENSP00000406430	Q8NHP1		UPI0000236FED				5/5																			MODIFIER	1	insertion														.	TAT	.	.																					19592799
Unknown	0	.	GRCh37	1	19819989	19819997	+	IGR	DEL	CAGGCTGCT	CAGGCTGCT	-	rs4065220		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAGGCTGCT	CAGGCTGCT																					3	.	3	0	.	0		-				intergenic_variant						rs4065220	1																				0.1989	0.3372		0.5486	0.335	0.4581										MODIFIER	1	deletion														.	CCCAGGCTGCTC	.	.																					19819988
HTR6	3362	.	GRCh37	1	20005323	20005324	+	Intron	DEL	GT	GT	-	rs141362075		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																c.874-77_874-76del			ENST00000289753		4	.	4	0	.	0	HTR6,intron_variant,,ENST00000289753,NM_000871.1;TMCO4,downstream_gene_variant,,ENST00000294543,NM_181719.4;TMCO4,downstream_gene_variant,,ENST00000375122,;TMCO4,downstream_gene_variant,,ENST00000375127,;TMCO4,downstream_gene_variant,,ENST00000489814,;	-	ENSG00000158748	ENST00000289753	Transcript	intron_variant						rs141362075	1		1	HTR6	HGNC	5301	protein_coding	YES	CCDS197.1	ENSP00000289753	P50406		UPI00000503E0	NM_000871.1				2/2			0.0061	0.0043		0.003	0.003	0.001										MODIFIER	1	deletion														.	GCGTG	.	.																					20005322
ZNF436	80818	.	GRCh37	1	23699631	23699631	+	5'Flank	DEL	A	A	-	rs71023203		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000314011		3	.	3	0	.	0	ZNF436,upstream_gene_variant,,ENST00000314011,NM_001077195.1;C1orf213,downstream_gene_variant,,ENST00000335648,;ZNF436,upstream_gene_variant,,ENST00000374608,NM_030634.2;C1orf213,downstream_gene_variant,,ENST00000437367,;C1orf213,downstream_gene_variant,,ENST00000454117,;C1orf213,downstream_gene_variant,,ENST00000518600,;C1orf213,downstream_gene_variant,,ENST00000518821,;Y_RNA,downstream_gene_variant,,ENST00000364535,;C1orf213,downstream_gene_variant,,ENST00000458053,;	-	ENSG00000125945	ENST00000314011	Transcript	upstream_gene_variant						rs71023203	1	3696	-1	ZNF436	HGNC	20814	protein_coding	YES	CCDS233.1	ENSP00000313582	Q9C0F3	Q15921	UPI0000001669	NM_001077195.1							0.3162	0.4971		0.4841	0.5129	0.4499										MODIFIER	1	deletion														.	TCAA	.	.																					23699630
ASAP3	55616	.	GRCh37	1	23759318	23759318	+	Intron	DEL	G	G	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.2323+252del			ENST00000336689		6	4	2	4	4	0	ASAP3,intron_variant,,ENST00000336689,NM_017707.3;ASAP3,intron_variant,,ENST00000437606,NM_001143778.1;ASAP3,intron_variant,,ENST00000465372,;ASAP3,intron_variant,,ENST00000495646,;ASAP3,intron_variant,,ENST00000492982,;ASAP3,downstream_gene_variant,,ENST00000475814,;ASAP3,downstream_gene_variant,,ENST00000484418,;ASAP3,downstream_gene_variant,,ENST00000530874,;	-	ENSG00000088280	ENST00000336689	Transcript	intron_variant							1		-1	ASAP3	HGNC	14987	protein_coding	YES	CCDS235.1	ENSP00000338769	Q8TDY4	H0YER8	UPI0000071371	NM_017707.3				22/24																		MODIFIER	1	deletion														.	GTGG	.	.																					23759317
TCEB3	6924	.	GRCh37	1	24082270	24082270	+	Intron	DEL	A	A	-	rs371132818		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1870-63del			ENST00000418390		4	.	4	0	.	0	TCEB3,intron_variant,,ENST00000418390,NM_003198.2;TCEB3,intron_variant,,ENST00000609199,;RP5-886K2.3,downstream_gene_variant,,ENST00000427796,;TCEB3,downstream_gene_variant,,ENST00000487554,;	-	ENSG00000011007	ENST00000418390	Transcript	intron_variant						rs371132818	1		1	TCEB3	HGNC	11620	protein_coding	YES	CCDS239.2	ENSP00000395574	Q14241		UPI000181BA17	NM_003198.2				7/10			0.3918	0.3689		0.3879	0.3439	0.4008										MODIFIER	1	sequence_alteration														.	TCAA	.	.																					24082269
IL22RA1	58985	.	GRCh37	1	24468503	24468503	+	Intron	DEL	T	T	-	rs5773070		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.43+1027del			ENST00000270800		3	.	3	0	.	0	IL22RA1,intron_variant,,ENST00000270800,NM_021258.3;	-	ENSG00000142677	ENST00000270800	Transcript	intron_variant						rs5773070	1		-1	IL22RA1	HGNC	13700	protein_coding	YES	CCDS247.1	ENSP00000270800	Q8N6P7		UPI0000071143	NM_021258.3				1/6		0.654	0.3056	0.7277		0.9782	0.673	0.7188										MODIFIER	1	deletion														.	GGTC	.	.																					24468502
PPP1R8	5511	.	GRCh37	1	28161891	28161892	+	Intron	INS	-	-	A	rs1334545900		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.117+2567dup			ENST00000311772		4	.	3	2	.	0	PPP1R8,intron_variant,,ENST00000236412,NM_002713.3;PPP1R8,intron_variant,,ENST00000311772,NM_014110.4;PPP1R8,intron_variant,,ENST00000373931,NM_138558.2;PPP1R8,intron_variant,,ENST00000431586,;SCARNA1,downstream_gene_variant,,ENST00000517138,;	A	ENSG00000117751	ENST00000311772	Transcript	intron_variant						rs1334545900	1		1	PPP1R8	HGNC	9296	protein_coding	YES	CCDS311.1	ENSP00000311677	Q12972	Q6ICT4	UPI00001320FD	NM_014110.4				2/6																		MODIFIER	1	insertion														.	TGA	.	.																					28161891
Unknown	0	.	GRCh37	1	29712466	29712470	+	IGR	DEL	TAAAA	TAAAA	-	rs59938613		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAAAA	TAAAA																					4	.	4	0	.	0		-				intergenic_variant						rs59938613	1																				0.5711	0.5		0.7589	0.6312	0.6534										MODIFIER	1	deletion														.	GTTAAAAT	.	.																					29712465
Unknown	0	.	GRCh37	1	30808093	30808094	+	IGR	INS	-	-	ACACAC	rs3045803		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		ACACAC				intergenic_variant						rs3045803	1																																			MODIFIER	1	insertion														.	CAA	.	.																					30808093
CSMD2	114784	.	GRCh37	1	34493442	34493459	+	Intron	DEL	TGGGCAGACAGCCCTACA	TGGGCAGACAGCCCTACA	-	rs6143184		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGGGCAGACAGCCCTACA	TGGGCAGACAGCCCTACA																c.397+4736_397+4753del			ENST00000241312		3	.	3	0	.	0	CSMD2,intron_variant,,ENST00000373381,NM_052896.3,NM_001281956.1;CSMD2,intron_variant,,ENST00000241312,;	-	ENSG00000121904	ENST00000241312	Transcript	intron_variant,NMD_transcript_variant						rs6143184	1		-1	CSMD2	HGNC	19290	nonsense_mediated_decay	YES	CCDS380.1	ENSP00000241312	Q7Z408		UPI00004561AB					3/69			0.6407	0.7291		0.7143	0.8499	0.7434										MODIFIER	1	deletion														.	CCTGGGCAGACAGCCCTACAT	.	.																					34493441
GJB5	2709	.	GRCh37	1	35217822	35217823	+	5'Flank	INS	-	-	GTGT	rs34555460		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000338513		3	.	3	0	.	0	GJB5,upstream_gene_variant,,ENST00000338513,NM_005268.3;SMIM12,intron_variant,,ENST00000426886,;	GTGT	ENSG00000189280	ENST00000338513	Transcript	upstream_gene_variant						rs34555460	1	2825	1	GJB5	HGNC	4287	protein_coding	YES	CCDS382.1	ENSP00000340811	O95377		UPI0000051E62	NM_005268.3																						MODIFIER	1	insertion														.	TGG	.	.																					35217822
SMIM12	113444	.	GRCh37	1	35313521	35313522	+	3'Flank	INS	-	-	GGGCTCAGACCCA	rs6143189		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000521580		3	.	3	0	.	0	SMIM12,downstream_gene_variant,,ENST00000521580,NM_001164825.1,NM_001164824.1,NM_138428.5;RP5-997D16.2,upstream_gene_variant,,ENST00000429293,;SMIM12,intron_variant,,ENST00000426886,;	GGGCTCAGACCCA	ENSG00000163866	ENST00000521580	Transcript	downstream_gene_variant						rs6143189	1	4748	-1	SMIM12	HGNC	25154	protein_coding	YES	CCDS53295.1	ENSP00000428585	Q96EX1	L0R6D7	UPI0000039F00	NM_001164825.1,NM_001164824.1,NM_138428.5							0.9531	0.562		0.2907	0.7674	0.6288										MODIFIER	1	insertion														.	CTG	.	.																					35313521
Unknown	0	.	GRCh37	1	37862830	37862839	+	IGR	DEL	GCACACACAG	GCACACACAG	-	rs61606736		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GCACACACAG	GCACACACAG																					3	.	3	0	.	0		-				intergenic_variant						rs61606736	1																				0.3623	0.6542		0.3512	0.5905	0.6135										MODIFIER	1	deletion														.	TTGCACACACAGG	.	.																					37862829
Unknown	0	.	GRCh37	1	39228508	39228510	+	IGR	DEL	TTG	TTG	-	rs199650803		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTG	TTG																					6	4	2	5	5	0		-				intergenic_variant						rs199650803	1																				0.0091	0.1167		0.003	0.1123	0.1503										MODIFIER	1	deletion														.	TATTGT	.	.																					39228507
KCNQ4	9132	.	GRCh37	1	41265104	41265105	+	Intron	INS	-	-	C	rs149663653		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.314+15034dup			ENST00000347132		4	.	3	3	.	0	KCNQ4,intron_variant,,ENST00000347132,NM_004700.3,NM_172163.2;KCNQ4,intron_variant,,ENST00000509682,;	C	ENSG00000117013	ENST00000347132	Transcript	intron_variant						rs149663653	1		1	KCNQ4	HGNC	6298	protein_coding	YES	CCDS456.1	ENSP00000262916	P56696		UPI000013D35B	NM_004700.3,NM_172163.2				1/13			0.4569	0.3084		0.2331	0.4076	0.4315										MODIFIER	1	insertion													1	.	TGC	.	.																					41265104
FOXJ3	22887	.	GRCh37	1	42639584	42639585	+	3'Flank	INS	-	-	G	rs34687885		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000372572		3	.	3	0	.	0	FOXJ3,downstream_gene_variant,,ENST00000361346,NM_014947.4;FOXJ3,downstream_gene_variant,,ENST00000361776,NM_001198852.1;FOXJ3,downstream_gene_variant,,ENST00000372571,;FOXJ3,downstream_gene_variant,,ENST00000372572,NM_001198851.1;FOXJ3,downstream_gene_variant,,ENST00000372573,NM_001198850.1;FOXJ3,downstream_gene_variant,,ENST00000545068,;,regulatory_region_variant,,ENSR00000251460,;,regulatory_region_variant,,ENSR00000928988,;	G	ENSG00000198815	ENST00000372572	Transcript	downstream_gene_variant						rs34687885	1	2625	-1	FOXJ3	HGNC	29178	protein_coding	YES	CCDS30689.1	ENSP00000361653	Q9UPW0	F6VXT0,C9JXI1	UPI000013D359	NM_001198851.1							0.6573	0.2032		0.252	0.3121	0.4683										MODIFIER	1	insertion														.	TAG	.	.																					42639584
GPBP1L1	60313	.	GRCh37	1	46105726	46105727	+	Intron	INS	-	-	A	rs66580837		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.744+156dup			ENST00000355105		6	.	3	11	.	0	GPBP1L1,intron_variant,,ENST00000290795,;GPBP1L1,intron_variant,,ENST00000355105,NM_021639.4;GPBP1L1,upstream_gene_variant,,ENST00000479235,;GPBP1L1,downstream_gene_variant,,ENST00000498128,;	AA	ENSG00000159592	ENST00000355105	Transcript	intron_variant						rs66580837	2		-1	GPBP1L1	HGNC	28843	protein_coding	YES	CCDS528.1	ENSP00000347224	Q9HC44		UPI0000072AA4	NM_021639.4				8/12			0.2769	0.3127		0.2817	0.2674	0.3405										MODIFIER	1	sequence_alteration														.	AGAA	.	.																					46105725
SSBP3	23648	.	GRCh37	1	54718192	54718213	+	Intron	DEL	GGGACAGGTGGCCACTAGGAGA	GGGACAGGTGGCCACTAGGAGA	-	rs146044344		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GGGACAGGTGGCCACTAGGAGA	GGGACAGGTGGCCACTAGGAGA																c.508-680_508-659del			ENST00000371320		4	.	4	0	.	0	SSBP3,intron_variant,,ENST00000357475,NM_018070.4;SSBP3,intron_variant,,ENST00000371319,NM_001009955.3;SSBP3,intron_variant,,ENST00000371320,NM_145716.3;SSBP3,intron_variant,,ENST00000417664,;SSBP3,intron_variant,,ENST00000525990,;SSBP3,upstream_gene_variant,,ENST00000444533,;SSBP3,intron_variant,,ENST00000326956,;SSBP3,intron_variant,,ENST00000426150,;SSBP3,intron_variant,,ENST00000528787,;SSBP3,intron_variant,,ENST00000533946,;SSBP3,intron_variant,,ENST00000420121,;SSBP3,intron_variant,,ENST00000533209,;SSBP3,upstream_gene_variant,,ENST00000530618,;,regulatory_region_variant,,ENSR00001498350,;	-	ENSG00000157216	ENST00000371320	Transcript	intron_variant						rs146044344	1		-1	SSBP3	HGNC	15674	protein_coding	YES	CCDS591.1	ENSP00000360371	Q9BWW4	Q9NW25,Q9BT57	UPI0000135F96	NM_145716.3				7/17			0.705	0.5346		0.3323	0.5388	0.7587										MODIFIER	1	deletion														.	GCGGGACAGGTGGCCACTAGGAGAG	.	.																					54718191
SNORD112	0	.	GRCh37	1	54994457	54994458	+	3'Flank	INS	-	-	T	rs35728927		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000516837		3	.	3	0	.	0	SNORD112,downstream_gene_variant,,ENST00000516837,;RP5-866L20.2,downstream_gene_variant,,ENST00000444140,;,regulatory_region_variant,,ENSR00000931727,;,regulatory_region_variant,,ENSR00001498393,;	T	ENSG00000252646	ENST00000516837	Transcript	downstream_gene_variant						rs35728927	1	3331	1	SNORD112	RFAM		snoRNA	YES													0.3434	0.1671		0.0744	0.2396	0.1687										MODIFIER		insertion														.	CCT	.	.																					54994457
ENSR00000931830	0	.	GRCh37	1	55415882	55415882	+	IGR	DEL	G	G	-	rs34180821		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																			ENSR00000931830		5	.	5	0	.	0	,regulatory_region_variant,,ENSR00000931830,;,regulatory_region_variant,,ENSR00001498456,;	-		ENSR00000931830	RegulatoryFeature	regulatory_region_variant						rs34180821	1																				0.9516	0.9971		1	0.999	1										MODIFIER	1	deletion														.	GTGG	.	.																					55415881
Unknown	0	.	GRCh37	1	55924558	55924558	+	IGR	DEL	T	T	-	rs77076490		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs77076490	1																				0.6929	0.7032		0.7411	0.7445	0.5511										MODIFIER	1	deletion														.	ACTT	.	.																					55924557
ENSR00001499393	0	.	GRCh37	1	63201490	63201491	+	IGR	DEL	TC	TC	-	rs67630296		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TC	TC																			ENSR00001499393		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001499393,;	-		ENSR00001499393	RegulatoryFeature	regulatory_region_variant						rs67630296	1																				0.705	0.889		0.9821	0.9602	0.8988										MODIFIER	1	deletion														.	TGTCT	.	.																					63201489
RP11-335E6.3	0	.	GRCh37	1	63715991	63715995	+	RNA	DEL	TTTTC	TTTTC	-	rs146971133		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTTC	TTTTC																n.425_429del			ENST00000449140	1/2	3	.	3	0	.	0	RP11-335E6.3,non_coding_transcript_exon_variant,,ENST00000449140,;LINC00466,intron_variant,,ENST00000418086,;LINC00466,intron_variant,,ENST00000455304,;	-	ENSG00000228734	ENST00000449140	Transcript	non_coding_transcript_exon_variant	401-405/859					rs146971133	1		1	RP11-335E6.3	Clone_based_vega_gene		lincRNA	YES									1/2				0.0098	0.0605		0.1349	0.1113	0.2065										MODIFIER	1	deletion														.	TATTTTCT	.	.																					63715990
ROR1	4919	.	GRCh37	1	64441038	64441042	+	Intron	DEL	TTAAG	TTAAG	-	rs147366169		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTAAG	TTAAG																c.92-33936_92-33932del			ENST00000371079		3	.	3	0	.	0	ROR1,intron_variant,,ENST00000371079,NM_005012.3;ROR1,intron_variant,,ENST00000371080,NM_001083592.1;ROR1,intron_variant,,ENST00000482426,;	-	ENSG00000185483	ENST00000371079	Transcript	intron_variant						rs147366169	1		1	ROR1	HGNC	10256	protein_coding	YES	CCDS626.1	ENSP00000360120	Q01973		UPI00001AF82C	NM_005012.3				1/8			0.0023	0.0159			0.0199	0.001										MODIFIER	1	deletion													1	.	GATTAAGT	.	.																					64441037
LEPR	54741	.	GRCh37	1	66074627	66074627	+	Intron	DEL	T	T	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1752+47del			ENST00000349533		16	.	4	25	.	0	LEPR,intron_variant,,ENST00000344610,;LEPR,intron_variant,,ENST00000349533,NM_002303.5;LEPR,intron_variant,,ENST00000371058,NM_001198688.1;LEPR,intron_variant,,ENST00000371059,NM_001198687.1,NM_001003680.3;LEPR,intron_variant,,ENST00000371060,NM_001198689.1,NM_001003679.3;LEPR,intron_variant,,ENST00000406510,;LEPR,intron_variant,,ENST00000462765,;	-	ENSG00000116678	ENST00000349533	Transcript	intron_variant							1		1	LEPR	HGNC	6554	protein_coding	YES	CCDS631.1	ENSP00000330393	P48357	L0I9J6,A2RRQ4	UPI000014C37B	NM_002303.5				12/19																		MODIFIER	1	deletion													1	.	TATT	.	.																					66074626
RNU6-1031P	0	.	GRCh37	1	68011875	68011876	+	3'Flank	INS	-	-	A	rs35008328		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000384773		4	.	4	0	.	0	RNU6-1031P,downstream_gene_variant,,ENST00000384773,;	A	ENSG00000207504	ENST00000384773	Transcript	downstream_gene_variant						rs35008328	1	4959	1	RNU6-1031P	HGNC	47994	snRNA	YES													0.5159	0.5447		0.63	0.5626	0.5869										MODIFIER	1	insertion														.	TCA	.	.																					68011875
NEGR1	257194	.	GRCh37	1	72664947	72664947	+	Intron	DEL	G	G	-	rs35669105		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.176+83055del			ENST00000357731		4	.	4	0	.	0	NEGR1,intron_variant,,ENST00000357731,NM_173808.2;NEGR1,intron_variant,,ENST00000434200,;	-	ENSG00000172260	ENST00000357731	Transcript	intron_variant						rs35669105	1		-1	NEGR1	HGNC	17302	protein_coding	YES	CCDS661.1	ENSP00000350364	Q7Z3B1	Q8N440,Q68DZ8	UPI00000477EE	NM_173808.2				1/6			0.6157	0.3631		0.1815	0.4761	0.3384										MODIFIER	1	deletion														.	CTGG	.	.																					72664946
Unknown	0	.	GRCh37	1	73604846	73604847	+	IGR	INS	-	-	T	rs57040732		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs57040732	1																				0.7118	0.9366		0.9653	0.9622	0.9438										MODIFIER	1	insertion														.	TAT	.	.																					73604846
MSH4	4438	.	GRCh37	1	76326852	76326852	+	Intron	DEL	T	T	-	rs35154985		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1231-6341del			ENST00000263187		5	.	5	0	.	0	MSH4,intron_variant,,ENST00000263187,NM_002440.3;	-	ENSG00000057468	ENST00000263187	Transcript	intron_variant						rs35154985	1		1	MSH4	HGNC	7327	protein_coding	YES	CCDS670.1	ENSP00000263187	O15457	Q5ZEZ0	UPI000006D934	NM_002440.3				8/19			0.8404	0.9914		1	0.999	1										MODIFIER	1	deletion														.	CCTT	.	.																					76326851
GIPC2	54810	.	GRCh37	1	78508992	78508994	+	5'Flank	DEL	AAG	AAG	-	rs140927295		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAG	AAG																			ENST00000370759		10	.	3	9	.	0	GIPC2,upstream_gene_variant,,ENST00000370759,NM_017655.4;GIPC2,intron_variant,,ENST00000476882,;RP11-386I14.2,downstream_gene_variant,,ENST00000265259,;	-	ENSG00000137960	ENST00000370759	Transcript	upstream_gene_variant						rs140927295	1	2592	1	GIPC2	HGNC	18177	protein_coding	YES	CCDS685.1	ENSP00000359795	Q8TF65		UPI000006EB65	NM_017655.4							0.4092	0.7061		0.7619	0.833	0.7045										MODIFIER	1	deletion														.	TAAAGA	.	.																					78508991
Unknown	0	.	GRCh37	1	81177030	81177030	+	IGR	DEL	A	A	-	rs35442612		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	4	0	.	0		-				intergenic_variant						rs35442612	1																				0.7897	0.428		0.6835	0.4354	0.5675										MODIFIER	1	deletion														.	AGAA	.	.																					81177029
Unknown	0	.	GRCh37	1	81499788	81499793	+	IGR	DEL	AAAAAA	AAAAAA	-	rs10573940		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAAAA	AAAAAA																					3	.	3	0	.	0		-				intergenic_variant						rs10573940	1																																			MODIFIER	1	deletion														.	GCAAAAAAA	.	.																					81499787
AGL	178	.	GRCh37	1	100344920	100344920	+	Intron	DEL	C	C	-	rs142035948		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.1612-559del			ENST00000294724		4	.	4	0	.	0	AGL,intron_variant,,ENST00000294724,NM_000028.2;AGL,intron_variant,,ENST00000361302,NM_000646.2;AGL,intron_variant,,ENST00000361522,NM_000645.2;AGL,intron_variant,,ENST00000361915,NM_000642.2;AGL,intron_variant,,ENST00000370161,;AGL,intron_variant,,ENST00000370163,NM_000643.2;AGL,intron_variant,,ENST00000370165,NM_000644.2;AGL,downstream_gene_variant,,ENST00000477753,;	-	ENSG00000162688	ENST00000294724	Transcript	intron_variant						rs142035948	1		1	AGL	HGNC	321	protein_coding	YES	CCDS759.1	ENSP00000294724	P35573	G1UI17	UPI00001694CB	NM_000028.2				12/33		0.1102	0.1203	0.0951		0.0278	0.1541	0.1472										MODIFIER	1	deletion													1	.	ATCA	.	.																					100344919
Unknown	0	.	GRCh37	1	101760945	101760945	+	IGR	DEL	C	C	-	rs150164735		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					5	.	4	3	.	0		-				intergenic_variant						rs150164735	1																				0.2602	0.0908		0.0536	0.1322	0.2239										MODIFIER	1	deletion														.	GGCC	.	.																					101760944
RP11-202K23.1	0	.	GRCh37	1	102810377	102810378	+	Intron	INS	-	-	A	rs35321243		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.340-34494dup			ENST00000447916		4	.	4	0	.	0	RP11-202K23.1,intron_variant,,ENST00000447916,;	A	ENSG00000233359	ENST00000447916	Transcript	intron_variant,non_coding_transcript_variant						rs35321243	1		-1	RP11-202K23.1	Clone_based_vega_gene		lincRNA	YES										4/5			0.5764	0.5692		0.6726	0.7296	0.8006										MODIFIER	1	insertion														.	CCA	.	.																					102810377
COL11A1	1301	.	GRCh37	1	103457391	103457391	+	Intron	DEL	T	T	-	rs5776670		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.2341-2264del			ENST00000370096		3	.	3	0	.	0	COL11A1,intron_variant,,ENST00000353414,NM_001190709.1;COL11A1,intron_variant,,ENST00000358392,NM_080629.2;COL11A1,intron_variant,,ENST00000370096,NM_001854.3;COL11A1,intron_variant,,ENST00000512756,NM_080630.3;	-	ENSG00000060718	ENST00000370096	Transcript	intron_variant						rs5776670	1		-1	COL11A1	HGNC	2186	protein_coding	YES	CCDS778.1	ENSP00000359114	P12107	Q4FAC4,B4DQZ0	UPI00002053EF	NM_001854.3				28/66			0.6089	0.8329		0.9008	0.825	0.8476										MODIFIER	1	deletion													1	.	AATT	.	.																					103457390
Unknown	0	.	GRCh37	1	105036066	105036067	+	IGR	INS	-	-	T	rs796968332		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs796968332	1																																			MODIFIER	1	insertion														.	GCT	.	.																					105036066
Unknown	0	.	GRCh37	1	105722914	105722915	+	IGR	INS	-	-	TT	rs35790489		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	3	3	.	0		TT				intergenic_variant						rs35790489	1																				0.3669	0.4697		0.1925	0.5437	0.3896										MODIFIER	1	insertion														.	GGT	.	.																					105722914
Unknown	0	.	GRCh37	1	105862327	105862328	+	IGR	INS	-	-	T	rs34957996		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		T				intergenic_variant						rs34957996	1																				0.1437	0.428		0.1706	0.4274	0.2679										MODIFIER	1	insertion														.	AAT	.	.																					105862327
Unknown	0	.	GRCh37	1	106090154	106090155	+	IGR	INS	-	-	TATC	rs3053095		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		TATC				intergenic_variant						rs3053095	1																				0.6679	0.4726		0.2242	0.4622	0.5041										MODIFIER	1	insertion														.	ATT	.	.																					106090154
SLC25A24P1	0	.	GRCh37	1	108881906	108881907	+	3'Flank	INS	-	-	A	rs3072975		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000411846		3	.	3	0	.	0	SLC25A24P1,intron_variant,,ENST00000450435,;SLC25A24P1,downstream_gene_variant,,ENST00000411846,;SLC25A24P1,downstream_gene_variant,,ENST00000434803,;	A	ENSG00000241361	ENST00000411846	Transcript	downstream_gene_variant						rs3072975	1	1431	1	SLC25A24P1	HGNC	48933	processed_transcript	YES																												MODIFIER	1	insertion														.	TTA	.	.																					108881906
WDR47	22911	.	GRCh37	1	109560373	109560373	+	Intron	DEL	T	T	-	rs33990918		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.159-150del			ENST00000400794		6	.	4	11	.	0	WDR47,intron_variant,,ENST00000357672,;WDR47,intron_variant,,ENST00000361054,;WDR47,intron_variant,,ENST00000369962,;WDR47,intron_variant,,ENST00000369965,NM_001142551.1,NM_014969.5,NM_001142550.1;WDR47,intron_variant,,ENST00000400794,;WDR47,intron_variant,,ENST00000528747,;WDR47,intron_variant,,ENST00000529074,;WDR47,intron_variant,,ENST00000530772,;WDR47,intron_variant,,ENST00000531337,;	-	ENSG00000085433	ENST00000400794	Transcript	intron_variant						rs33990918	1		-1	WDR47	HGNC	29141	protein_coding	YES	CCDS44186.1	ENSP00000383599	O94967	E9PKZ6	UPI0001639B05					2/14			0.7678	0.8833		0.8948	0.8588	0.9182										MODIFIER	1	deletion														.	AATT	.	.																					109560372
PIFO	128344	.	GRCh37	1	111894729	111894730	+	3'UTR	INS	-	-	ATG	rs79322001		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.*782_*783insGAT			ENST00000369738	6/6	5	.	4	3	.	0	PIFO,3_prime_UTR_variant,,ENST00000369738,NM_181643.4;PIFO,downstream_gene_variant,,ENST00000369737,;PIFO,non_coding_transcript_exon_variant,,ENST00000484512,;PIFO,downstream_gene_variant,,ENST00000468395,;CHIAP3,downstream_gene_variant,,ENST00000423668,;	ATG	ENSG00000173947	ENST00000369738	Transcript	3_prime_UTR_variant	1721-1722/2627					rs79322001	1		1	PIFO	HGNC	27009	protein_coding	YES	CCDS833.1	ENSP00000358753	Q8TCI5		UPI000019790E	NM_181643.4			6/6				0.0802	0.072		0.3185	0.1233	0.183										MODIFIER	1	insertion														.	ACA	.	.																					111894729
Unknown	0	.	GRCh37	1	116082634	116082640	+	IGR	DEL	GATACCT	GATACCT	-	rs35538417		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GATACCT	GATACCT																					3	.	3	0	.	0		-				intergenic_variant						rs35538417	1																				0.6354	0.3732		0.3998	0.3191	0.5849										MODIFIER	1	deletion														.	GGGATACCTG	.	.																					116082633
SPAG17	200162	.	GRCh37	1	118648479	118648480	+	Intron	INS	-	-	A	rs397844630		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.448-3931dup			ENST00000336338		3	.	3	0	.	0	SPAG17,intron_variant,,ENST00000336338,NM_206996.2;	A	ENSG00000155761	ENST00000336338	Transcript	intron_variant						rs397844630	1		-1	SPAG17	HGNC	26620	protein_coding	YES	CCDS899.1	ENSP00000337804	Q6Q759	A7LBF9	UPI00001601FD	NM_206996.2				4/48			0.6853	0.5043		0.4484	0.5487	0.5573										MODIFIER	1	insertion													1	.	AGA	.	.																					118648479
AL592494.5	0	.	GRCh37	1	121141962	121141979	+	Intron	DEL	TGAAATGAAAAGAAATGA	TGAAATGAAAAGAAATGA	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGAAATGAAAAGAAATGA	TGAAATGAAAAGAAATGA																n.551+2798_551+2815del			ENST00000417218		7	.	3	3	.	0	AL592494.5,intron_variant,,ENST00000417218,;RP11-343N15.1,upstream_gene_variant,,ENST00000429055,;RP11-343N15.1,upstream_gene_variant,,ENST00000437515,;	-	ENSG00000227082	ENST00000417218	Transcript	intron_variant,non_coding_transcript_variant							1		1	AL592494.5	Clone_based_vega_gene		lincRNA	YES										1/1																		MODIFIER	1	sequence_alteration														.	ACTGAAATGAAAAGAAATGAT	.	.																					121141961
Unknown	0	.	GRCh37	1	121352300	121352301	+	IGR	INS	-	-	T	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					39	33	6	35	0	0		T				intergenic_variant							1																																			MODIFIER	1	insertion														.	TGT	.	.																					121352300
PDE4DIP	9659	.	GRCh37	1	145058201	145058201	+	Intron	DEL	A	A	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.233+17429del			ENST00000369348		7	.	3	5	.	0	PDE4DIP,intron_variant,,ENST00000369348,NM_022359.5;PDE4DIP,intron_variant,,ENST00000369359,;PDE4DIP,intron_variant,,ENST00000530740,;PDE4DIP,intron_variant,,ENST00000528552,;PDE4DIP,intron_variant,,ENST00000533396,;PDE4DIP,intron_variant,,ENST00000526359,;PDE4DIP,intron_variant,,ENST00000527063,;PDE4DIP,intron_variant,,ENST00000528661,;	-	ENSG00000178104	ENST00000369348	Transcript	intron_variant							1		-1	PDE4DIP	HGNC	15580	protein_coding		CCDS30827.1	ENSP00000358354	Q5VU43		UPI000013F4FC	NM_022359.5				1/6																		MODIFIER	1	deletion													1	.	GGAA	.	.																					145058200
NBPF13P	728989	.	GRCh37	1	146513690	146513691	+	Intron	INS	-	-	AAT	rs34011406		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.2771-610_2771-608dup			ENST00000444082		3	.	3	0	.	0	NBPF13P,intron_variant,,ENST00000444082,;NBPF13P,intron_variant,,ENST00000444680,;	AAT	ENSG00000227242	ENST00000444082	Transcript	intron_variant,non_coding_transcript_variant						rs34011406	1		-1	NBPF13P	HGNC	31995	unprocessed_pseudogene	YES										21/27			0.4622	0.2349		0.5099	0.173	0.2587										MODIFIER	1	insertion														.	CAA	.	.																					146513690
RP11-763B22.6	0	.	GRCh37	1	148848700	148848701	+	5'Flank	INS	-	-	TCATT	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000456469		13	.	4	6	.	0	RP11-763B22.6,upstream_gene_variant,,ENST00000456469,;	TCATT	ENSG00000235887	ENST00000456469	Transcript	upstream_gene_variant							1	3692	1	RP11-763B22.6	Clone_based_vega_gene		lincRNA	YES																												MODIFIER	1	insertion														.	CCT	.	.																					148848700
RP11-763B22.6	0	.	GRCh37	1	148855273	148855298	+	3'Flank	DEL	AAAGCCGCAGCGGCGGGTGGGGGCAG	AAAGCCGCAGCGGCGGGTGGGGGCAG	-	rs71083878,rs782601743		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAGCCGCAGCGGCGGGTGGGGGCAG	AAAGCCGCAGCGGCGGGTGGGGGCAG																			ENST00000456469		3	.	3	0	.	0	RP11-763B22.6,downstream_gene_variant,,ENST00000456469,;RP11-763B22.9,intron_variant,,ENST00000444424,;RP11-763B22.7,upstream_gene_variant,,ENST00000444165,;,regulatory_region_variant,,ENSR00000945681,;	-	ENSG00000235887	ENST00000456469	Transcript	downstream_gene_variant						rs71083878,rs782601743	1	1556	1	RP11-763B22.6	Clone_based_vega_gene		lincRNA	YES																												MODIFIER		deletion														.	AAAAAGCCGCAGCGGCGGGTGGGGGCAGA	.	.																					148855272
LINC00869	57234	.	GRCh37	1	149287128	149287129	+	3'Flank	DEL	CT	CT	-	rs75714611		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CT	CT																			ENST00000424684		16	10	6	9	0	0	LINC00869,downstream_gene_variant,,ENST00000424684,;RP11-403I13.8,upstream_gene_variant,,ENST00000433084,;RNU1-143P,upstream_gene_variant,,ENST00000516296,;	-	ENSG00000226067	ENST00000424684	Transcript	downstream_gene_variant						rs75714611	1	153	1	LINC00869	HGNC	29050	lincRNA	YES																												MODIFIER		deletion														.	GCCTC	.	.																					149287127
RP11-126K1.2	0	.	GRCh37	1	151253892	151253893	+	Intron	INS	-	-	T	rs33967833		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.117+126dup			ENST00000447795		3	.	3	0	.	0	RP11-126K1.2,intron_variant,,ENST00000447795,;ZNF687,upstream_gene_variant,,ENST00000324048,;ZNF687,upstream_gene_variant,,ENST00000336715,;ZNF687,upstream_gene_variant,,ENST00000368879,NM_020832.1;ZNF687,upstream_gene_variant,,ENST00000443959,;RP11-126K1.2,intron_variant,,ENST00000494138,;ZNF687,upstream_gene_variant,,ENST00000449313,;,regulatory_region_variant,,ENSR00000013603,;,TF_binding_site_variant,,ENSM00522872326,;,TF_binding_site_variant,,ENSM00524449609,;	T	ENSG00000232671	ENST00000447795	Transcript	intron_variant						rs33967833	1		-1	RP11-126K1.2	Clone_based_vega_gene		protein_coding	YES		ENSP00000411098		A2A3Q1	UPI00001412D2					1/1																		MODIFIER	1	insertion														.	GGT	.	.																					151253892
TUFT1	7286	.	GRCh37	1	151557322	151557322	+	3'Flank	DEL	C	C	-	rs35861463		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENST00000368849		3	.	3	0	.	0	TUFT1,downstream_gene_variant,,ENST00000353024,;TUFT1,downstream_gene_variant,,ENST00000368848,NM_001126337.1;TUFT1,downstream_gene_variant,,ENST00000368849,NM_020127.2;TUFT1,downstream_gene_variant,,ENST00000392712,;TUFT1,downstream_gene_variant,,ENST00000538902,;,regulatory_region_variant,,ENSR00000946197,;	-	ENSG00000143367	ENST00000368849	Transcript	downstream_gene_variant						rs35861463	1	1263	1	TUFT1	HGNC	12422	protein_coding	YES	CCDS1000.1	ENSP00000357842	Q9NNX1		UPI0000037BFA	NM_020127.2						0.4597	0.2837	0.5447		0.4206	0.663	0.4683										MODIFIER	1	deletion														.	GGCT	.	.																					151557321
Unknown	0	.	GRCh37	1	152513511	152513512	+	IGR	DEL	CA	CA	-	rs5777815		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CA	CA																					3	.	3	0	.	0		-				intergenic_variant						rs5777815	1																				0.497	0.5519		0.6081	0.6193	0.6002										MODIFIER	1	deletion														.	GCCAC	.	.																					152513510
S100A7	6278	.	GRCh37	1	153433913	153433914	+	5'Flank	INS	-	-	CCCCGCAG	rs56152346		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000368723		3	.	3	0	.	0	S100A7,upstream_gene_variant,,ENST00000368722,;S100A7,upstream_gene_variant,,ENST00000368723,NM_002963.3;,regulatory_region_variant,,ENSR00000946595,;	CCCCGCAG	ENSG00000143556	ENST00000368723	Transcript	upstream_gene_variant						rs56152346	1	736	-1	S100A7	HGNC	10497	protein_coding	YES	CCDS1039.1	ENSP00000357712	P31151		UPI000013D90F	NM_002963.3							0.8578	0.853		0.7292	0.8231	0.6595										MODIFIER	1	insertion													1	.	CCC	.	.																					153433913
ENSR00000947323	0	.	GRCh37	1	156153489	156153496	+	IGR	DEL	TGTGTGTG	TGTGTGTG	-	rs71080752		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGTGTGTG	TGTGTGTG																			ENSR00000947323		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00000947323,;	-		ENSR00000947323	RegulatoryFeature	regulatory_region_variant						rs71080752	1																																			MODIFIER	1	deletion														.	TTTGTGTGTGT	.	.																					156153488
ETV3	2117	.	GRCh37	1	157088339	157088344	+	3'Flank	DEL	TTTCTT	TTTCTT	-	rs10522191		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTCTT	TTTCTT																			ENST00000368192		4	.	4	0	.	0	ETV3,downstream_gene_variant,,ENST00000368192,NM_001145312.1;	-	ENSG00000117036	ENST00000368192	Transcript	downstream_gene_variant						rs10522191	1	2639	-1	ETV3	HGNC	3492	protein_coding	YES	CCDS44250.1	ENSP00000357175	P41162		UPI0000071047	NM_001145312.1							0.5136	0.4597		0.7173	0.2972	0.5552										MODIFIER	1	deletion														.	TCTTTCTTT	.	.																					157088338
FCRL3	115352	.	GRCh37	1	157669293	157669294	+	Intron	INS	-	-	A	rs74599050		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.52+189dup			ENST00000368184		15	.	5	13	.	0	FCRL3,intron_variant,,ENST00000368184,NM_052939.3;FCRL3,intron_variant,,ENST00000368186,;FCRL3,intron_variant,,ENST00000496769,;RP11-367J7.3,downstream_gene_variant,,ENST00000453692,;FCRL3,intron_variant,,ENST00000480682,;FCRL3,intron_variant,,ENST00000494724,;FCRL3,upstream_gene_variant,,ENST00000473231,;FCRL3,upstream_gene_variant,,ENST00000478179,;FCRL3,intron_variant,,ENST00000477837,;FCRL3,intron_variant,,ENST00000485028,;FCRL3,intron_variant,,ENST00000492769,;	AA	ENSG00000160856	ENST00000368184	Transcript	intron_variant						rs74599050	1		-1	FCRL3	HGNC	18506	protein_coding	YES	CCDS1167.1	ENSP00000357167	Q96P31	R4GNJ6	UPI000006D60E	NM_052939.3				3/14																		MODIFIER	1	sequence_alteration													1	.	AGAA	.	.																					157669292
Unknown	0	.	GRCh37	1	159649896	159649896	+	IGR	DEL	T	T	-	rs34098113		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs34098113	1																																			MODIFIER	1	deletion														.	TCTT	.	.																					159649895
IGSF9	57549	.	GRCh37	1	159907173	159907174	+	Intron	INS	-	-	C	rs35861479		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.400+302dup			ENST00000368094		5	.	4	6	.	0	IGSF9,intron_variant,,ENST00000361509,NM_020789.3;IGSF9,intron_variant,,ENST00000368094,NM_001135050.1;IGSF9,intron_variant,,ENST00000476102,;IGSF9,upstream_gene_variant,,ENST00000493195,;IGSF9,upstream_gene_variant,,ENST00000496645,;,regulatory_region_variant,,ENSR00001506765,;	C	ENSG00000085552	ENST00000368094	Transcript	intron_variant						rs35861479	1		-1	IGSF9	HGNC	18132	protein_coding	YES	CCDS44254.1	ENSP00000357073	Q9P2J2	Q6XYD8	UPI000004A10B	NM_001135050.1				4/20			0.4191	0.4092		0.4643	0.4016	0.4018										MODIFIER	1	insertion														.	AGC	.	.																					159907173
USP21	27005	.	GRCh37	1	161135142	161135142	+	Splice_Region	DEL	C	C	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.1608-4del			ENST00000368002		75	.	55	49	.	47	USP21,splice_region_variant,,ENST00000289865,NM_012475.4;USP21,splice_region_variant,,ENST00000368001,;USP21,splice_region_variant,,ENST00000368002,NM_001014443.2;PPOX,upstream_gene_variant,,ENST00000352210,NM_000309.3;PPOX,upstream_gene_variant,,ENST00000367999,NM_001122764.1;PPOX,upstream_gene_variant,,ENST00000432542,;USP21,downstream_gene_variant,,ENST00000479344,;USP21,downstream_gene_variant,,ENST00000492950,;PPOX,upstream_gene_variant,,ENST00000535223,;PPOX,upstream_gene_variant,,ENST00000537523,;PPOX,upstream_gene_variant,,ENST00000537829,;PPOX,upstream_gene_variant,,ENST00000544598,;USP21,splice_region_variant,,ENST00000493054,;PPOX,upstream_gene_variant,,ENST00000460611,;PPOX,upstream_gene_variant,,ENST00000462866,;PPOX,upstream_gene_variant,,ENST00000462977,;PPOX,upstream_gene_variant,,ENST00000466452,;PPOX,upstream_gene_variant,,ENST00000470607,;USP21,downstream_gene_variant,,ENST00000486299,;PPOX,upstream_gene_variant,,ENST00000490768,;PPOX,upstream_gene_variant,,ENST00000494216,;PPOX,upstream_gene_variant,,ENST00000495483,;PPOX,upstream_gene_variant,,ENST00000497522,;USP21,splice_region_variant,,ENST00000485277,;USP21,splice_region_variant,,ENST00000487163,;PPOX,upstream_gene_variant,,ENST00000468968,;PPOX,upstream_gene_variant,,ENST00000479246,;USP21,downstream_gene_variant,,ENST00000482385,;PPOX,upstream_gene_variant,,ENST00000539753,;PPOX,upstream_gene_variant,,ENST00000541818,;	-	ENSG00000143258	ENST00000368002	Transcript	splice_region_variant,intron_variant							1		1	USP21	HGNC	12620	protein_coding	YES	CCDS30920.1	ENSP00000356981	Q9UK80		UPI00001379FD	NM_001014443.2				13/13																		LOW	1	deletion														.	TTCC	.	.																					161135141
Unknown	0	.	GRCh37	1	163627527	163627528	+	IGR	INS	-	-	T	rs35669231		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	3	4	.	0		T				intergenic_variant						rs35669231	1																																			MODIFIER	1	insertion														.	GAT	.	.																					163627527
Unknown	0	.	GRCh37	1	163883031	163883032	+	IGR	INS	-	-	TA	rs80104661		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		TA				intergenic_variant						rs80104661	1																				0.2284	0.2622		0.0248	0.4205	0.1166										MODIFIER	1	insertion														.	AGT	.	.																					163883031
FMO9P	116123	.	GRCh37	1	166594483	166594484	+	3'Flank	DEL	TT	TT	-	rs3032708		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																			ENST00000477875		6	.	4	1	.	0	FMO9P,downstream_gene_variant,,ENST00000477875,;FMO9P,intron_variant,,ENST00000488458,;	-	ENSG00000215834	ENST00000477875	Transcript	downstream_gene_variant						rs3032708	1	8	1	FMO9P	HGNC	32210	processed_transcript	YES													0.6974	0.4424		0.3373	0.6103	0.3211										MODIFIER	1	deletion														.	TCTTT	.	.																					166594482
RP11-277B15.1	0	.	GRCh37	1	167131443	167131446	+	3'Flank	DEL	ACTC	ACTC	-	rs35496966		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACTC	ACTC																			ENST00000450126		4	.	4	0	.	0	RP11-277B15.1,downstream_gene_variant,,ENST00000450126,;,regulatory_region_variant,,ENSR00000949688,;	-	ENSG00000213068	ENST00000450126	Transcript	downstream_gene_variant						rs35496966	1	214	-1	RP11-277B15.1	Clone_based_vega_gene		processed_pseudogene	YES													0.3737	0.1585		0.5962	0.163	0.2127										MODIFIER	1	deletion														.	TAACTCA	.	.																					167131442
MPZL1	9019	.	GRCh37	1	167734559	167734559	+	Intron	DEL	A	A	-	rs34061385		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.92-252del			ENST00000359523		4	.	3	3	.	0	MPZL1,intron_variant,,ENST00000359523,NM_024569.4,NM_003953.5;MPZL1,intron_variant,,ENST00000392121,NM_001146191.1;MPZL1,intron_variant,,ENST00000474859,;MPZL1,upstream_gene_variant,,ENST00000367853,;MPZL1,non_coding_transcript_exon_variant,,ENST00000474729,;MPZL1,intron_variant,,ENST00000448405,;MPZL1,intron_variant,,ENST00000464954,;MPZL1,intron_variant,,ENST00000465787,;	-	ENSG00000197965	ENST00000359523	Transcript	intron_variant						rs34061385	1		1	MPZL1	HGNC	7226	protein_coding	YES	CCDS1264.1	ENSP00000352513	O95297	A8K5D4	UPI000004BA6A	NM_024569.4,NM_003953.5				1/5			0.0991	0.3689		0.3661	0.164	0.1554										MODIFIER	1	deletion														.	TTAA	.	.																					167734558
Unknown	0	.	GRCh37	1	169464231	169464231	+	IGR	DEL	A	A	-	rs5778617		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	4	0	.	0		-				intergenic_variant						rs5778617	1																																			MODIFIER	1	deletion														.	TCAA	.	.																					169464230
KIFAP3	22920	.	GRCh37	1	169920149	169920150	+	Intron	INS	-	-	A	rs66584019		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2273+3002dup			ENST00000361580		4	.	4	0	.	0	KIFAP3,intron_variant,,ENST00000361580,NM_014970.3;KIFAP3,intron_variant,,ENST00000367765,NM_001204517.1;KIFAP3,intron_variant,,ENST00000367767,NM_001204516.1;KIFAP3,intron_variant,,ENST00000538366,NM_001204514.1;KIFAP3,intron_variant,,ENST00000540905,;	A	ENSG00000075945	ENST00000361580	Transcript	intron_variant						rs66584019	1		-1	KIFAP3	HGNC	17060	protein_coding	YES	CCDS1288.1	ENSP00000354560	Q92845	B7Z7E7	UPI000006CD6C	NM_014970.3				19/19			0.8654	0.8141		0.875	0.83	0.818										MODIFIER	1	insertion														.	TTA	.	.																					169920149
MYOC	4653	.	GRCh37	1	171606757	171606757	+	Intron	DEL	T	T	-	rs1242075694		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.731-908del			ENST00000037502		3	.	3	0	.	0	MYOC,intron_variant,,ENST00000037502,NM_000261.1;	-	ENSG00000034971	ENST00000037502	Transcript	intron_variant						rs1242075694	1		-1	MYOC	HGNC	7610	protein_coding	YES	CCDS1297.1	ENSP00000037502	Q99972	B4DV60	UPI00000012D6	NM_000261.1				2/2																		MODIFIER	1	deletion													1	.	TATT	.	.																					171606756
DNM3	26052	.	GRCh37	1	171905499	171905500	+	Intron	INS	-	-	AAAGAAAG	rs3051605		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.235+14547_235+14554dup			ENST00000358155		3	.	3	0	.	0	DNM3,intron_variant,,ENST00000355305,;DNM3,intron_variant,,ENST00000358155,NM_015569.4;DNM3,intron_variant,,ENST00000367731,NM_001136127.2;DNM3,intron_variant,,ENST00000367733,NM_001278252.1;DNM3,intron_variant,,ENST00000520906,;	AAAGAAAG	ENSG00000197959	ENST00000358155	Transcript	intron_variant						rs3051605	1		1	DNM3	HGNC	29125	protein_coding	YES	CCDS53431.1	ENSP00000350876	Q9UQ16	E5RIK2	UPI0000251D91	NM_015569.4				2/20			0.6899	0.6009		0.5417	0.6412	0.6544										MODIFIER	1	insertion														.	GAA	.	.																					171905499
Unknown	0	.	GRCh37	1	172657258	172657259	+	IGR	INS	-	-	TG	rs141767478		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					7	4	3	4	4	0		TG				intergenic_variant						rs141767478	1																																			MODIFIER	1	insertion														.	TAT	.	.																					172657258
TNN	63923	.	GRCh37	1	175093824	175093831	+	Intron	DEL	CAAACAAA	CAAACAAA	-	rs59814606		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAAACAAA	CAAACAAA																c.2914+1046_2914+1053del			ENST00000239462		3	.	3	0	.	0	TNN,intron_variant,,ENST00000239462,NM_022093.1;	-	ENSG00000120332	ENST00000239462	Transcript	intron_variant						rs59814606	1		1	TNN	HGNC	22942	protein_coding	YES	CCDS30943.1	ENSP00000239462	Q9UQP3		UPI00001D7DA9	NM_022093.1				12/18																		MODIFIER	1	deletion														.	AGCAAACAAAC	.	.																					175093823
Unknown	0	.	GRCh37	1	177288341	177288342	+	IGR	INS	-	-	GTGT	rs3066140		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		GTGT				intergenic_variant						rs3066140	1																				0.5098	0.6326		0.5317	0.5268	0.5746										MODIFIER	1	insertion														.	GAG	.	.																					177288341
C1ORF220	0	.	GRCh37	1	178507387	178507390	+	5'Flank	DEL	GAGT	GAGT	-	rs5778993		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAGT	GAGT																			ENST00000367636		3	.	3	0	.	0	C1ORF220,upstream_gene_variant,,ENST00000367636,;C1orf220,upstream_gene_variant,,ENST00000367638,;C1orf220,upstream_gene_variant,,ENST00000521244,;TEX35,intron_variant,,ENST00000419909,;	-	ENSG00000184909	ENST00000367636	Transcript	upstream_gene_variant						rs5778993	1	4560	1	C1ORF220	Uniprot_gn		protein_coding	YES		ENSP00000356608			UPI00001405B8								0.174	0.4207		0.3839	0.3956	0.317										MODIFIER	1	deletion														.	AGGAGTG	.	.																					178507386
ABL2	27	.	GRCh37	1	179118036	179118037	+	Intron	DEL	AA	AA	-	rs35904029		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																c.158-15528_158-15527del			ENST00000502732		3	.	3	0	.	0	ABL2,intron_variant,,ENST00000367623,;ABL2,intron_variant,,ENST00000392043,NM_001136001.1;ABL2,intron_variant,,ENST00000502732,NM_001168237.1,NM_007314.3,NM_001168238.1,NM_001168236.1;ABL2,intron_variant,,ENST00000507173,;ABL2,intron_variant,,ENST00000511413,;	-	ENSG00000143322	ENST00000502732	Transcript	intron_variant						rs35904029	1		-1	ABL2	HGNC	77	protein_coding	YES	CCDS30947.1	ENSP00000427562	P42684		UPI0000125140	NM_001168237.1,NM_007314.3,NM_001168238.1,NM_001168236.1				1/11																		MODIFIER	1	deletion													1	.	TGAAA	.	.																					179118035
SOAT1	6646	.	GRCh37	1	179317896	179317921	+	Intron	DEL	TGTGTGTGTGTGTGTGTGTGTGTGTG	TGTGTGTGTGTGTGTGTGTGTGTGTG	-	rs71111912		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGTGTGTGTGTGTGTGTGTGTGTGTG	TGTGTGTGTGTGTGTGTGTGTGTGTG																c.1216-54_1216-29del			ENST00000367619		58	.	19	43	.	7	SOAT1,intron_variant,,ENST00000367619,NM_003101.5;SOAT1,intron_variant,,ENST00000535686,;SOAT1,intron_variant,,ENST00000539888,NM_001252512.1;SOAT1,intron_variant,,ENST00000540564,NM_001252511.1;	-	ENSG00000057252	ENST00000367619	Transcript	intron_variant						rs71111912	1		1	SOAT1	HGNC	11177	protein_coding	YES	CCDS1330.1	ENSP00000356591	P35610	B4DFD8,B1APM4	UPI0000071233	NM_003101.5				12/15																		MODIFIER	1	deletion														.	GATGTGTGTGTGTGTGTGTGTGTGTGTGT	.	.																					179317895
AXDND1	126859	.	GRCh37	1	179476914	179476914	+	Intron	DEL	A	A	-	rs5779029		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.2389-1507del			ENST00000367618		3	.	3	0	.	0	AXDND1,intron_variant,,ENST00000367618,NM_144696.5;AXDND1,intron_variant,,ENST00000434088,;AXDND1,intron_variant,,ENST00000484883,;AXDND1,intron_variant,,ENST00000511157,;	-	ENSG00000162779	ENST00000367618	Transcript	intron_variant						rs5779029	1		1	AXDND1	HGNC	26564	protein_coding	YES	CCDS30948.1	ENSP00000356590	Q5T1B0	D6REE1,D6RDY4,D6RCN1,D6RB87,D6R9B7	UPI000022AC91	NM_144696.5				20/25			0.4312	0.7767		0.8006	0.7416	0.8149										MODIFIER	1	deletion														.	TTAA	.	.																					179476913
NPHS2	7827	.	GRCh37	1	179536133	179536134	+	Intron	INS	-	-	G	rs199642250		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.275-2206dup			ENST00000367615		3	.	3	0	.	0	NPHS2,intron_variant,,ENST00000367615,NM_014625.2;NPHS2,intron_variant,,ENST00000367616,;	G	ENSG00000116218	ENST00000367615	Transcript	intron_variant						rs199642250	1		-1	NPHS2	HGNC	13394	protein_coding	YES	CCDS1331.1	ENSP00000356587	Q9NP85		UPI000003F549	NM_014625.2				1/7			0.0772	0.2853		0.3839	0.3111	0.3967										MODIFIER	1	insertion													1	.	GTG	.	.																					179536133
Unknown	0	.	GRCh37	1	184753319	184753320	+	IGR	INS	-	-	TCTTTGTGACCTAC	rs11272701		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TCTTTGTGACCTAC				intergenic_variant						rs11272701	1																				0.6725	0.4582		0.6508	0.4304	0.5164										MODIFIER	1	insertion														.	GAT	.	.																					184753319
LINC01036	0	.	GRCh37	1	187145740	187145741	+	Intron	INS	-	-	T	rs755253160		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.105+83675dup			ENST00000458683		4	.	4	0	.	0	LINC01036,intron_variant,,ENST00000458683,;	T	ENSG00000236030	ENST00000458683	Transcript	intron_variant,non_coding_transcript_variant						rs755253160	1		1	LINC01036	HGNC	49024	lincRNA	YES										1/3																		MODIFIER	1	insertion														.	CCT	.	.																					187145740
Unknown	0	.	GRCh37	1	188081583	188081583	+	IGR	DEL	T	T	-	rs78473107		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	3	3	.	0		-				intergenic_variant						rs78473107	1																			0.1677	0.0151	0.2262		0.1944	0.3022	0.1667										MODIFIER	1	deletion														.	AATG	.	.																					188081582
Unknown	0	.	GRCh37	1	188444582	188444585	+	IGR	DEL	CTCT	CTCT	-	rs71831047		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTCT	CTCT																					7	.	7	0	.	0		-				intergenic_variant						rs71831047	1																				0.2186	0.3372		0.1518	0.4135	0.2393										MODIFIER	1	deletion														.	CCCTCTC	.	.																					188444581
RP11-316I3.1	0	.	GRCh37	1	188676257	188676258	+	Intron	INS	-	-	TTT	rs111862098		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.71-844_71-842dup			ENST00000432976		3	.	3	0	.	0	RP11-316I3.1,intron_variant,,ENST00000432976,;,regulatory_region_variant,,ENSR00001509878,;,TF_binding_site_variant,,ENSM00527054436,;	TTT	ENSG00000237283	ENST00000432976	Transcript	intron_variant,non_coding_transcript_variant						rs111862098	1		-1	RP11-316I3.1	Clone_based_vega_gene		lincRNA	YES										1/1																		MODIFIER	1	insertion														.	AAT	.	.																					188676257
Unknown	0	.	GRCh37	1	189039065	189039066	+	IGR	DEL	CA	CA	-	rs10534294		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CA	CA																					3	.	3	0	.	0		-				intergenic_variant						rs10534294	1																			0.5288	0.4251	0.5879		0.5754	0.5199	0.5879										MODIFIER	1	deletion														.	TTCAG	.	.																					189039064
ENSR00000954480	0	.	GRCh37	1	190833179	190833202	+	IGR	DEL	TTGTTGTTGTTGTTGTTGTTATTG	TTGTTGTTGTTGTTGTTGTTATTG	-	rs71103687		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTGTTGTTGTTGTTGTTGTTATTG	TTGTTGTTGTTGTTGTTGTTATTG																			ENSR00000954480		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00000954480,;,regulatory_region_variant,,ENSR00001509966,;	-		ENSR00000954480	RegulatoryFeature	regulatory_region_variant						rs71103687	1																																			MODIFIER	1	deletion														.	TATTGTTGTTGTTGTTGTTGTTATTGT	.	.																					190833178
Unknown	0	.	GRCh37	1	191586637	191586638	+	IGR	INS	-	-	TCTA	rs144979501		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TCTA				intergenic_variant						rs144979501	1																				0.2126	0.3545		0.4921	0.4533	0.4335										MODIFIER	1	insertion														.	TCT	.	.																					191586637
RP11-21J7.1	0	.	GRCh37	1	193661778	193661778	+	Intron	DEL	A	-	-	rs61395568		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																n.112+13644del			ENST00000448412		6	.	0	3	.	3	RP11-21J7.1,intron_variant,,ENST00000448412,;RP11-98G13.1,upstream_gene_variant,,ENST00000447056,;	-	ENSG00000226640	ENST00000448412	Transcript	intron_variant,non_coding_transcript_variant						rs61395568	1		1	RP11-21J7.1	Clone_based_vega_gene		lincRNA	YES										1/2																		MODIFIER	1	deletion														.	CTAA	.	.																					193661777
Unknown	0	.	GRCh37	1	193981407	193981407	+	IGR	DEL	A	-	-	rs139326553		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					6	3	3	3	0	0		-				intergenic_variant						rs139326553	1																				0.0015	0.0432		0.0119	0.0557	0.0164										MODIFIER	1	deletion														.	ATAA	.	.																					193981406
Unknown	0	.	GRCh37	1	194252845	194252845	+	IGR	DEL	A	A	-	rs11341664		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	3	2	.	0		-				intergenic_variant						rs11341664	1																				0.5401	0.7882		0.9077	0.7962	0.8221										MODIFIER	1	deletion														.	AGAA	.	.																					194252844
Unknown	0	.	GRCh37	1	195126697	195126698	+	IGR	DEL	AG	AG	-	rs112739796		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																					4	.	4	0	.	0		-				intergenic_variant						rs112739796	1																																			MODIFIER	1	deletion														.	TAAGA	.	.																					195126696
Unknown	0	.	GRCh37	1	196996391	196996392	+	IGR	DEL	TT	TT	-	rs66823348		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																					3	.	3	0	.	0		-				intergenic_variant						rs66823348	1																																			MODIFIER	1	deletion														.	TCTTT	.	.																					196996390
NR5A2	2494	.	GRCh37	1	200056370	200056373	+	Intron	DEL	ACAC	ACAC	-	rs34917175		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACAC	ACAC																c.1111-23938_1111-23935del			ENST00000367362		3	.	3	0	.	0	NR5A2,intron_variant,,ENST00000236914,NM_003822.4;NR5A2,intron_variant,,ENST00000367362,NM_205860.2;NR5A2,intron_variant,,ENST00000544748,NM_001276464.1;	-	ENSG00000116833	ENST00000367362	Transcript	intron_variant						rs34917175	1		1	NR5A2	HGNC	7984	protein_coding	YES	CCDS1401.1	ENSP00000356331	O00482	Q8WY08,B4E2P3	UPI0000130482	NM_205860.2				5/7																		MODIFIER	1	deletion														.	CAACACA	.	.																					200056369
DDX59	83479	.	GRCh37	1	200607760	200607760	+	Intron	DEL	T	T	-	rs34715492		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1596+9807del			ENST00000447706		3	.	3	0	.	0	DDX59,intron_variant,,ENST00000447706,;DDX59,downstream_gene_variant,,ENST00000367348,;DDX59,downstream_gene_variant,,ENST00000413408,;DDX59,downstream_gene_variant,,ENST00000452560,;	-	ENSG00000118197	ENST00000447706	Transcript	intron_variant						rs34715492	1		-1	DDX59	HGNC	25360	protein_coding			ENSP00000394367	Q5T1V6	Q5T1V5,B7ZBU4	UPI0000037B2C					7/7			0.8812	0.7378		0.8145	0.7147	0.819										MODIFIER	1	deletion													1	.	CATT	.	.																					200607759
RNPEP	6051	.	GRCh37	1	201955667	201955668	+	Intron	INS	-	-	C	rs55711441		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.448-2365_448-2364insC			ENST00000295640		3	.	3	0	.	0	RNPEP,intron_variant,,ENST00000295640,NM_020216.3;RNPEP,intron_variant,,ENST00000367286,;RNPEP,intron_variant,,ENST00000447312,;RNPEP,intron_variant,,ENST00000471105,;RNPEP,intron_variant,,ENST00000478617,;RNPEP,intron_variant,,ENST00000479726,;RNPEP,intron_variant,,ENST00000481780,;RNPEP,intron_variant,,ENST00000487116,;RNPEP,intron_variant,,ENST00000492587,;RNPEP,intron_variant,,ENST00000492849,;	C	ENSG00000176393	ENST00000295640	Transcript	intron_variant						rs55711441	1		1	RNPEP	HGNC	10078	protein_coding	YES	CCDS1418.1	ENSP00000295640	Q9H4A4		UPI00000463FA	NM_020216.3				1/10			0.8169	0.9597		0.9861	0.9722	0.9836										MODIFIER	1	insertion														.	TTT	.	.																					201955667
TMCC2	9911	.	GRCh37	1	205244159	205244161	+	3'Flank	DEL	AAC	AAC	-	rs143823297		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAC	AAC																			ENST00000358024		3	.	3	0	.	0	TMCC2,downstream_gene_variant,,ENST00000329800,;TMCC2,downstream_gene_variant,,ENST00000330675,;TMCC2,downstream_gene_variant,,ENST00000358024,NM_014858.3;TMCC2,downstream_gene_variant,,ENST00000545499,NM_001242925.1;TMCC2,downstream_gene_variant,,ENST00000468846,;TMCC2,downstream_gene_variant,,ENST00000481950,;TMCC2,downstream_gene_variant,,ENST00000495538,;,regulatory_region_variant,,ENSR00001511536,;	-	ENSG00000133069	ENST00000358024	Transcript	downstream_gene_variant						rs143823297	1	1688	1	TMCC2	HGNC	24239	protein_coding	YES	CCDS30984.1	ENSP00000350718	O75069		UPI00002056FC	NM_014858.3							0.0227	0.1542		0.0317	0.3231	0.0644										MODIFIER	1	deletion														.	AAAACA	.	.																					205244158
CR1L	1379	.	GRCh37	1	207848618	207848619	+	Intron	INS	-	-	ATC	rs75729926		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.98-2114_98-2113insCAT			ENST00000508064		4	.	4	0	.	0	CR1L,intron_variant,,ENST00000508064,NM_175710.1;CR1L,intron_variant,,ENST00000430248,;CR1L,intron_variant,,ENST00000530905,;CR1L,intron_variant,,ENST00000531844,;CR1L,upstream_gene_variant,,ENST00000294997,;	ATC	ENSG00000197721	ENST00000508064	Transcript	intron_variant						rs75729926	1		1	CR1L	HGNC	2335	protein_coding	YES	CCDS44310.1	ENSP00000421736	Q2VPA4		UPI0000DD792A	NM_175710.1				1/11			0.298	0.3026		0.3353	0.3787	0.3221										MODIFIER	1	insertion														.	TTA	.	.																					207848618
ENSR00001512330	0	.	GRCh37	1	211692529	211692540	+	IGR	DEL	ATATATATATAT	ATATATATATAT	-	rs58127111		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATATATATATAT	ATATATATATAT																			ENSR00001512330		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001512330,;	-		ENSR00001512330	RegulatoryFeature	regulatory_region_variant						rs58127111	1																																			MODIFIER	1	deletion														.	TGATATATATATATA	.	.																					211692528
Unknown	0	.	GRCh37	1	212060545	212060546	+	IGR	INS	-	-	G	rs5780664		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					7	.	4	5	.	0		G				intergenic_variant						rs5780664	1																				0.5688	0.5533		0.7688	0.3767	0.4703										MODIFIER	1	insertion														.	GTG	.	.																					212060545
Unknown	0	.	GRCh37	1	212086961	212086962	+	IGR	DEL	AC	AC	-	rs68045282		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																					3	.	3	0	.	0		-				intergenic_variant						rs68045282	1																																			MODIFIER	1	deletion														.	GAACA	.	.																					212086960
INTS7	25896	.	GRCh37	1	212188060	212188061	+	Intron	INS	-	-	T	rs369061478		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.509+2167dup			ENST00000366994		3	.	3	0	.	0	INTS7,intron_variant,,ENST00000366992,;INTS7,intron_variant,,ENST00000366993,;INTS7,intron_variant,,ENST00000366994,NM_001199811.1,NM_015434.3,NM_001199812.1;INTS7,intron_variant,,ENST00000440600,NM_001199809.1;INTS7,intron_variant,,ENST00000469606,;INTS7,upstream_gene_variant,,ENST00000460867,;	T	ENSG00000143493	ENST00000366994	Transcript	intron_variant						rs369061478	1		-1	INTS7	HGNC	24484	protein_coding	YES	CCDS1501.1	ENSP00000355961	Q9NVH2		UPI000006FE2E	NM_001199811.1,NM_015434.3,NM_001199812.1				4/19			0.0439	0.2695		0.254	0.4264	0.3671										MODIFIER	1	insertion														.	TAT	.	.																					212188060
TATDN3	128387	.	GRCh37	1	212970082	212970082	+	Intron	DEL	T	T	-	rs76166503		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.173+159del			ENST00000532324		6	.	6	0	.	0	TATDN3,intron_variant,,ENST00000366973,;TATDN3,intron_variant,,ENST00000366974,NM_001042553.2,NM_001146171.1,NM_001146169.1,NM_001042552.2;TATDN3,intron_variant,,ENST00000488246,;TATDN3,intron_variant,,ENST00000526641,NM_001146170.1;TATDN3,intron_variant,,ENST00000526997,;TATDN3,intron_variant,,ENST00000530399,;TATDN3,intron_variant,,ENST00000530441,;TATDN3,intron_variant,,ENST00000531963,;TATDN3,intron_variant,,ENST00000532324,;NSL1,upstream_gene_variant,,ENST00000366975,;NSL1,upstream_gene_variant,,ENST00000366976,;NSL1,upstream_gene_variant,,ENST00000366977,NM_015471.3;NSL1,upstream_gene_variant,,ENST00000422588,NM_001042549.1;TATDN3,upstream_gene_variant,,ENST00000606486,;TATDN3,intron_variant,,ENST00000497768,;TATDN3,intron_variant,,ENST00000525569,;TATDN3,intron_variant,,ENST00000530392,;NSL1,upstream_gene_variant,,ENST00000487995,;TATDN3,non_coding_transcript_exon_variant,,ENST00000532433,;TATDN3,intron_variant,,ENST00000525574,;TATDN3,intron_variant,,ENST00000533650,;	-	ENSG00000203705	ENST00000532324	Transcript	intron_variant						rs76166503	1		1	TATDN3	HGNC	27010	protein_coding	YES	CCDS53475.1	ENSP00000431376	Q17R31		UPI0000205E43					3/9			0.3222	0.1037		0.252	0.1481	0.2076										MODIFIER	1	deletion														.	CCTT	.	.																					212970081
Unknown	0	.	GRCh37	1	213575825	213575826	+	IGR	INS	-	-	TA	rs3085101		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		TA				intergenic_variant						rs3085101	1																				0.6225	0.879		0.9891	0.836	0.8967										MODIFIER	1	insertion														.	TTG	.	.																					213575825
PROX1	5629	.	GRCh37	1	214159851	214159852	+	5'Flank	INS	-	-	GT	rs35146556		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000366958		5	.	5	0	.	0	PROX1,intron_variant,,ENST00000471129,;PROX1,upstream_gene_variant,,ENST00000366958,NM_001270616.1;PROX1,upstream_gene_variant,,ENST00000435016,NM_002763.4;PROX1,upstream_gene_variant,,ENST00000498508,;PROX1,upstream_gene_variant,,ENST00000607425,;PROX1-AS1,intron_variant,,ENST00000598091,;PROX1-AS1,upstream_gene_variant,,ENST00000451396,;PROX1,upstream_gene_variant,,ENST00000607726,;,regulatory_region_variant,,ENSR00001512609,;	GT	ENSG00000117707	ENST00000366958	Transcript	upstream_gene_variant						rs35146556	1	1434	1	PROX1	HGNC	9459	protein_coding	YES	CCDS31021.1	ENSP00000355925	Q92786	U3KPY6,C9JU29,B4DP41	UPI0000071D14	NM_001270616.1							0.2231	0.4885		0.5437	0.496	0.5348										MODIFIER	1	insertion														.	GAG	.	.																					214159851
KCNK2	3776	.	GRCh37	1	215398566	215398566	+	Intron	DEL	G	G	-	rs55750248		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.964-9604del			ENST00000444842		6	.	6	0	.	0	KCNK2,intron_variant,,ENST00000391894,;KCNK2,intron_variant,,ENST00000391895,NM_001017424.2;KCNK2,intron_variant,,ENST00000444842,NM_014217.3,NM_001017425.2;KCNK2,intron_variant,,ENST00000467031,;KCNK2,intron_variant,,ENST00000474771,;KCNK2,intron_variant,,ENST00000486921,;	-	ENSG00000082482	ENST00000444842	Transcript	intron_variant						rs55750248	1		1	KCNK2	HGNC	6277	protein_coding	YES	CCDS41467.1	ENSP00000394033	O95069	C9JXY2,C9JDK1	UPI000013D4B8	NM_014217.3,NM_001017425.2				6/6			0.3684	0.1398		0.0804	0.1928	0.1155										MODIFIER	1	deletion														.	TTGG	.	.																					215398565
EPRS	2058	.	GRCh37	1	220224557	220224557	+	5'Flank	DEL	A	A	-	rs749407537		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000366923		4	.	4	0	.	0	EPRS,upstream_gene_variant,,ENST00000366923,NM_004446.2;EPRS,upstream_gene_variant,,ENST00000609181,;EPRS,upstream_gene_variant,,ENST00000477030,;	-	ENSG00000136628	ENST00000366923	Transcript	upstream_gene_variant						rs749407537	1	4557	-1	EPRS	HGNC	3418	protein_coding	YES	CCDS31027.1	ENSP00000355890	P07814		UPI0000205E8C	NM_004446.2																						MODIFIER	1	deletion													1	.	CTAA	.	.																					220224556
ENSR00001513538	0	.	GRCh37	1	223235630	223235631	+	IGR	INS	-	-	G	rs75853898		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001513538		6	.	3	1	.	0	,regulatory_region_variant,,ENSR00001513538,;	G		ENSR00001513538	RegulatoryFeature	regulatory_region_variant						rs75853898	1																				0.264	0.3228		0.2748	0.3579	0.3793										MODIFIER	1	insertion														.	ATG	.	.																					223235630
CAPN8	388743	.	GRCh37	1	223826063	223826064	+	Intron	DEL	GT	GT	-	rs34370642		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																c.308-9582_308-9581del			ENST00000366872		3	.	3	0	.	0	CAPN8,intron_variant,,ENST00000366872,;CAPN8,intron_variant,,ENST00000366873,;CAPN8,intron_variant,,ENST00000419193,NM_001143962.1;CAPN8,intron_variant,,ENST00000467384,;	-	ENSG00000203697	ENST00000366872	Transcript	intron_variant						rs34370642	1		-1	CAPN8	HGNC	1485	protein_coding	YES		ENSP00000355837	A6NHC0		UPI0001AE7978					2/19																		MODIFIER	1	deletion														.	GGGTG	.	.																					223826062
CAPN2	824	.	GRCh37	1	223962514	223962515	+	Intron	INS	-	-	T	rs533089157		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2080-22dup			ENST00000295006		55	.	12	34	.	0	CAPN2,intron_variant,,ENST00000295006,NM_001748.4;CAPN2,intron_variant,,ENST00000433674,NM_001146068.1;CAPN2,intron_variant,,ENST00000463997,;CAPN2,intron_variant,,ENST00000474026,;CAPN2,intron_variant,,ENST00000487223,;CAPN2,downstream_gene_variant,,ENST00000472601,;CAPN2,downstream_gene_variant,,ENST00000492664,;CAPN2,downstream_gene_variant,,ENST00000498027,;,regulatory_region_variant,,ENSR00000961642,;	TT	ENSG00000162909	ENST00000295006	Transcript	intron_variant						rs533089157	1		1	CAPN2	HGNC	1479	protein_coding	YES	CCDS31035.1	ENSP00000295006	P17655		UPI000059D0B9	NM_001748.4				20/20									0.002345	0.003635								MODIFIER	1	sequence_alteration														.	ACTT	.	.												0.003013	0.001327	0.003802	0.001496	0.001562	0.002184	0.002865	0.004306	0.005596	223962513
Unknown	0	.	GRCh37	1	225858522	225858522	+	IGR	DEL	C	C	-	rs554945276		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					3	.	3	0	.	0		-				intergenic_variant						rs554945276	1																																			MODIFIER	1	deletion														.	TGCC	.	.																					225858521
PRSS38	339501	.	GRCh37	1	227998535	227998535	+	5'Flank	DEL	A	A	-	rs55865777		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000366757		3	.	3	0	.	0	PRSS38,upstream_gene_variant,,ENST00000366757,NM_183062.2;	-	ENSG00000185888	ENST00000366757	Transcript	upstream_gene_variant						rs55865777	1	4859	1	PRSS38	HGNC	29625	protein_coding	YES	CCDS1563.1	ENSP00000355719	A1L453		UPI00001BBB34	NM_183062.2							0.2156	0.1801		0.125	0.2485	0.1769										MODIFIER	1	deletion														.	TGAA	.	.																					227998534
RNF187	149603	.	GRCh37	1	228673071	228673071	+	5'Flank	DEL	T	T	-	rs11320436		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000305943		9	.	9	0	.	0	RNF187,upstream_gene_variant,,ENST00000305943,NM_001010858.2;RNF187,upstream_gene_variant,,ENST00000482739,;RNF187,upstream_gene_variant,,ENST00000484293,;	-	ENSG00000168159	ENST00000305943	Transcript	upstream_gene_variant						rs11320436	1	1691	1	RNF187	HGNC	27146	protein_coding	YES		ENSP00000306396	Q5TA31		UPI0000470B86	NM_001010858.2							0.9402	0.9265		1	0.8091	0.9049										MODIFIER	1	deletion														.	GCTT	.	.																					228673070
Unknown	0	.	GRCh37	1	229991220	229991221	+	IGR	INS	-	-	TG	rs5781554		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TG				intergenic_variant						rs5781554	1																				0.9039	0.6974		0.6101	0.5547	0.5481										MODIFIER	1	insertion														.	AAT	.	.																					229991220
Unknown	0	.	GRCh37	1	230588349	230588349	+	IGR	DEL	C	C	-	rs11288302		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					5	.	5	0	.	0		-				intergenic_variant						rs11288302	1																				0.1694	0.4914		0.379	0.4056	0.1943										MODIFIER	1	deletion														.	CACC	.	.																					230588348
PCNXL2	80003	.	GRCh37	1	233137226	233137229	+	Intron	DEL	ATAA	-	-	rs4027365		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATAA	ATAA																c.5097+54_5097+57del			ENST00000258229		8	.	3	4	.	0	PCNXL2,intron_variant,,ENST00000258229,NM_014801.3;PCNXL2,intron_variant,,ENST00000344698,;PCNXL2,intron_variant,,ENST00000462233,;PCNXL2,upstream_gene_variant,,ENST00000497623,;	-	ENSG00000135749	ENST00000258229	Transcript	intron_variant						rs4027365	1		-1	PCNXL2	HGNC	8736	protein_coding	YES	CCDS44335.1	ENSP00000258229	A6NKB5	B3KNZ5	UPI0000F58F23	NM_014801.3				29/33			0.9531	0.9251		0.9117	0.9463	0.9151										MODIFIER	1	deletion														.	TCATAAA	.	.																					233137225
Unknown	0	.	GRCh37	1	238618799	238618800	+	IGR	INS	-	-	AT	rs1201803204		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AT				intergenic_variant						rs1201803204	1																																			MODIFIER	1	insertion														.	CCA	.	.																					238618799
RGS7	6000	.	GRCh37	1	240942804	240942804	+	Intron	DEL	A	A	-	rs35230381		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1414-3291del			ENST00000366565		4	.	4	0	.	0	RGS7,intron_variant,,ENST00000331110,;RGS7,intron_variant,,ENST00000348120,NM_001282773.1;RGS7,intron_variant,,ENST00000366562,;RGS7,intron_variant,,ENST00000366563,NM_001282775.1;RGS7,intron_variant,,ENST00000366564,NM_001282778.1;RGS7,intron_variant,,ENST00000366565,NM_002924.4;RGS7,intron_variant,,ENST00000440928,;RGS7,intron_variant,,ENST00000446183,;	-	ENSG00000182901	ENST00000366565	Transcript	intron_variant						rs35230381	1		-1	RGS7	HGNC	10003	protein_coding	YES	CCDS31071.1	ENSP00000355523	P49802		UPI000040E182	NM_002924.4				17/17		0.2165	0.5197	0.1009		0.124	0.1133	0.09										MODIFIER	1	deletion													1	.	CCAG	.	.																					240942803
WDR64	128025	.	GRCh37	1	241950968	241950968	+	Intron	DEL	A	A	-	rs58063137		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.2676-167del			ENST00000366552		10	.	3	12	.	0	WDR64,intron_variant,,ENST00000366552,NM_144625.4;WDR64,intron_variant,,ENST00000414635,;WDR64,intron_variant,,ENST00000425826,;WDR64,intron_variant,,ENST00000437684,;WDR64,intron_variant,,ENST00000468967,;WDR64,intron_variant,,ENST00000472717,;WDR64,intron_variant,,ENST00000478331,;	-	ENSG00000162843	ENST00000366552	Transcript	intron_variant						rs58063137	1		1	WDR64	HGNC	26570	protein_coding	YES		ENSP00000355510	B1ANS9	D6RCR1	UPI0000519142	NM_144625.4				22/26																		MODIFIER	1	deletion														.	TCAA	.	.																					241950967
BECN1P1	0	.	GRCh37	1	242116811	242116811	+	5'Flank	DEL	A	A	-	rs71570920		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000356052		5	.	5	0	.	0	BECN1P1,upstream_gene_variant,,ENST00000356052,;BECN1P1,upstream_gene_variant,,ENST00000419583,;	-	ENSG00000196289	ENST00000356052	Transcript	upstream_gene_variant						rs71570920	1	4231	1	BECN1P1	HGNC	38606	processed_pseudogene	YES												0.2947	0.3026	0.3271		0.244	0.3459	0.2607										MODIFIER	1	deletion														.	CTAT	.	.																					242116810
PLD5	200150	.	GRCh37	1	242396456	242396457	+	Intron	INS	-	-	AATG	rs55916345		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.608-13043_608-13040dup			ENST00000536534		7	.	7	0	.	0	PLD5,intron_variant,,ENST00000427495,NM_001195811.1,NM_001195812.1;PLD5,intron_variant,,ENST00000442594,NM_152666.2;PLD5,intron_variant,,ENST00000536534,;PLD5,downstream_gene_variant,,ENST00000474177,;PLD5,intron_variant,,ENST00000314833,;PLD5,intron_variant,,ENST00000366545,;PLD5,intron_variant,,ENST00000467561,;	AATG	ENSG00000180287	ENST00000536534	Transcript	intron_variant						rs55916345	1		-1	PLD5	HGNC	26879	protein_coding	YES	CCDS1621.2	ENSP00000440896	Q8N7P1	J3KP61	UPI000040E1A4					4/9																		MODIFIER	1	insertion														.	CAA	.	.																					242396456
PLD5	200150	.	GRCh37	1	242470115	242470116	+	Intron	INS	-	-	T	rs34920004		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.327-18284dup			ENST00000536534		3	.	3	0	.	0	PLD5,intron_variant,,ENST00000427495,NM_001195811.1,NM_001195812.1;PLD5,intron_variant,,ENST00000442594,NM_152666.2;PLD5,intron_variant,,ENST00000459864,;PLD5,intron_variant,,ENST00000536534,;PLD5,intron_variant,,ENST00000314833,;PLD5,intron_variant,,ENST00000366545,;PLD5,intron_variant,,ENST00000467561,;	T	ENSG00000180287	ENST00000536534	Transcript	intron_variant						rs34920004	1		-1	PLD5	HGNC	26879	protein_coding	YES	CCDS1621.2	ENSP00000440896	Q8N7P1	J3KP61	UPI000040E1A4					2/9			0.8865	0.9438		0.9593	0.9046	0.9376										MODIFIER	1	insertion														.	TCT	.	.																					242470115
Unknown	0	.	GRCh37	1	242796694	242796695	+	IGR	INS	-	-	TAT	rs55937230		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	3	4	.	0		TAT				intergenic_variant						rs55937230	1																				0.0076	0.0375			0.0477	0.0245										MODIFIER	1	insertion														.	TGT	.	.																					242796694
SMYD3	64754	.	GRCh37	1	246375887	246375888	+	Intron	INS	-	-	A	rs35077215		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.531+114615_531+114616insT			ENST00000388985		6	.	3	4	.	0	SMYD3,intron_variant,,ENST00000388985,;SMYD3,intron_variant,,ENST00000453676,;SMYD3,intron_variant,,ENST00000490107,NM_001167740.1;SMYD3,intron_variant,,ENST00000541742,NM_022743.2;SMYD3,intron_variant,,ENST00000462422,;SMYD3,intron_variant,,ENST00000492487,;	A	ENSG00000185420	ENST00000388985	Transcript	intron_variant						rs35077215	1		-1	SMYD3	HGNC	15513	protein_coding	YES	CCDS53486.1	ENSP00000373637	Q9H7B4	B3KN46,B0QZA0,B0QZ99,A8MXR1	UPI000022AFDA					5/11		0.2228	0.1286	0.3199		0.3562	0.1441	0.2249										MODIFIER	1	insertion														.	CCG	.	.																					246375887
RP11-488L18.10	0	.	GRCh37	1	247348801	247348802	+	3'Flank	DEL	TC	TC	-	rs67409799		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TC	TC																			ENST00000566446		13	.	3	7	.	0	RP11-488L18.10,downstream_gene_variant,,ENST00000566446,;RP11-488L18.3,upstream_gene_variant,,ENST00000400933,;MIR3916,downstream_gene_variant,,ENST00000421406,;MIR3916,downstream_gene_variant,,ENST00000452874,;	-	ENSG00000259865	ENST00000566446	Transcript	downstream_gene_variant						rs67409799	1	1781	-1	RP11-488L18.10	Clone_based_vega_gene		lincRNA	YES																												MODIFIER		deletion														.	TTTCT	.	.																					247348800
OR1C1	26188	.	GRCh37	1	247920509	247920510	+	3'Flank	DEL	TA	TA	-	rs35325984		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TA	TA																			ENST00000408896		6	.	3	7	.	0	OR1C1,downstream_gene_variant,,ENST00000408896,NM_012353.2;	-	ENSG00000221888	ENST00000408896	Transcript	downstream_gene_variant						rs35325984	1	166	-1	OR1C1	HGNC	8182	protein_coding	YES	CCDS41481.1	ENSP00000386138	Q15619		UPI000004B1DC	NM_012353.2							0.5575	0.9236		0.9851	0.9592	0.8793										MODIFIER	1	deletion														.	ACTAT	.	.																					247920508
LINC01115	339822	.	GRCh37	2	849913	849914	+	Intron	DEL	GG	GG	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GG	GG																n.310-18_310-17del			ENST00000414556		4	.	4	0	.	0	LINC01115,intron_variant,,ENST00000414556,;LINC01115,intron_variant,,ENST00000415700,;,regulatory_region_variant,,ENSR00001614300,;,regulatory_region_variant,,ENSR00001614301,;	-	ENSG00000237667	ENST00000414556	Transcript	intron_variant,non_coding_transcript_variant							1		-1	LINC01115	HGNC	49258	lincRNA	YES										1/3																		MODIFIER	1	deletion														.	AAGGG	.	.																					849912
SNTG2	54221	.	GRCh37	2	1292271	1292272	+	Intron	DEL	CA	-	-	rs56238543		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CA	CA																c.1285-19989_1285-19988del			ENST00000308624		6	.	0	4	.	4	SNTG2,intron_variant,,ENST00000308624,NM_018968.3;SNTG2,intron_variant,,ENST00000407292,;SNTG2,intron_variant,,ENST00000471239,;	-	ENSG00000172554	ENST00000308624	Transcript	intron_variant						rs56238543	1		1	SNTG2	HGNC	13741	protein_coding	YES	CCDS46220.1	ENSP00000311837	Q9NY99		UPI0000456D73	NM_018968.3				14/16			0.1528	0.3329		0.2798	0.3728	0.3067										MODIFIER	1	deletion														.	TTCAC	.	.																					1292270
Unknown	0	.	GRCh37	2	2423265	2423265	+	IGR	DEL	T	T	-	rs34142183		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs34142183	1																				0.1505	0.3199		0.2688	0.5169	0.3722										MODIFIER	1	deletion														.	GATT	.	.																					2423264
Unknown	0	.	GRCh37	2	3854136	3854136	+	IGR	DEL	T	T	-	rs34504660		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	4	0	.	0		-				intergenic_variant						rs34504660	1																				0.6831	0.6801		0.9018	0.6362	0.7761										MODIFIER	1	deletion														.	TCTT	.	.																					3854135
Unknown	0	.	GRCh37	2	3863612	3863613	+	IGR	INS	-	-	TAAC	rs145376684		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	3	2	.	0		TAAC				intergenic_variant						rs145376684	1																				0.0166	0.0836		0.0139	0.1859	0.1002										MODIFIER	1	insertion														.	GAT	.	.																					3863612
Unknown	0	.	GRCh37	2	4580016	4580017	+	IGR	DEL	GA	GA	-	rs763169311		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GA	GA																					3	.	3	0	.	0		-				intergenic_variant						rs763169311	1																																			MODIFIER	1	deletion														.	GTGAG	.	.																					4580015
AC021021.2	0	.	GRCh37	2	6640529	6640530	+	Intron	DEL	AC	AC	-	rs35309858		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																n.251-2320_251-2319del			ENST00000436082		7	.	3	2	.	0	AC021021.2,intron_variant,,ENST00000436082,;AC021021.1,upstream_gene_variant,,ENST00000454229,;	-	ENSG00000226488	ENST00000436082	Transcript	intron_variant,non_coding_transcript_variant						rs35309858	1		1	AC021021.2	Clone_based_vega_gene		lincRNA	YES										1/2			0.2511	0.5548		0.4821	0.5308	0.5757										MODIFIER	1	deletion														.	ATACA	.	.																					6640528
Unknown	0	.	GRCh37	2	10700547	10700552	+	IGR	DEL	CCAGCC	CCAGCC	-	rs61032112		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCAGCC	CCAGCC																					6	.	6	4	.	0		-				intergenic_variant						rs61032112	1																				0.1566	0.2277		0.1885	0.3777	0.2853										MODIFIER	1	deletion														.	TGCCAGCCC	.	.																					10700546
ENSR00000289735	0	.	GRCh37	2	11040691	11040692	+	IGR	INS	-	-	G	rs386389530		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00000289735		5	.	5	0	.	0	,regulatory_region_variant,,ENSR00000289735,;,regulatory_region_variant,,ENSR00001168169,;	G		ENSR00000289735	RegulatoryFeature	regulatory_region_variant						rs386389530	1																				0.0756	0.3473		0.3611	0.5646	0.3354										MODIFIER	1	insertion														.	TTG	.	.																					11040691
GREB1	9687	.	GRCh37	2	11678736	11678787	+	Intron	DEL	TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC	TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC	-	rs66497558		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC	TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC																c.-162+4384_-162+4435del			ENST00000381486		3	.	3	0	.	0	GREB1,intron_variant,,ENST00000381486,NM_014668.3;GREB1,upstream_gene_variant,,ENST00000263834,NM_148903.2;GREB1,upstream_gene_variant,,ENST00000381483,NM_033090.2;GREB1,upstream_gene_variant,,ENST00000389825,;MIR4429,downstream_gene_variant,,ENST00000580105,;	-	ENSG00000196208	ENST00000381486	Transcript	intron_variant						rs66497558	1		1	GREB1	HGNC	24885	protein_coding	YES	CCDS42655.1	ENSP00000370896	Q4ZG55		UPI0000163937	NM_014668.3				1/32																		MODIFIER	1	deletion														.	TGTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	.	.																					11678735
MIR4262	100422996	.	GRCh37	2	11976013	11976014	+	3'Flank	INS	-	-	T	rs34989285		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000578394		3	.	3	0	.	0	MIR4262,downstream_gene_variant,,ENST00000578394,;	T	ENSG00000265172	ENST00000578394	Transcript	downstream_gene_variant						rs34989285	1	1045	-1	MIR4262	HGNC	38308	miRNA	YES													0.0454	0.2666		0.0446	0.4145	0.2628										MODIFIER	1	insertion														.	TGT	.	.																					11976013
AC096559.1	100506457	.	GRCh37	2	12370907	12370908	+	Intron	INS	-	-	A	rs34884472		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.315+63940dup			ENST00000412294		4	.	4	0	.	0	AC096559.1,intron_variant,,ENST00000412294,;AC096559.1,intron_variant,,ENST00000438292,;	A	ENSG00000224184	ENST00000412294	Transcript	intron_variant,non_coding_transcript_variant						rs34884472	1		1	AC096559.1	Clone_based_vega_gene		lincRNA	YES										3/5			0.5424	0.1037		0.0456	0.1302	0.1585										MODIFIER	1	insertion														.	ATA	.	.																					12370907
AC096559.1	100506457	.	GRCh37	2	12577342	12577343	+	Intron	INS	-	-	TG	rs34645282		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.413-120956_413-120955dup			ENST00000412294		3	.	3	0	.	0	AC096559.1,intron_variant,,ENST00000412294,;AC096559.1,intron_variant,,ENST00000412606,;,regulatory_region_variant,,ENSR00001615618,;	TG	ENSG00000224184	ENST00000412294	Transcript	intron_variant,non_coding_transcript_variant						rs34645282	1		1	AC096559.1	Clone_based_vega_gene		lincRNA	YES										4/5																		MODIFIER	1	insertion														.	TAT	.	.																					12577342
AC008271.1	101926966	.	GRCh37	2	15865924	15865925	+	Intron	INS	-	-	G	rs35632910		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.283-17684dup			ENST00000436967		6	.	6	0	.	0	AC008271.1,intron_variant,,ENST00000436967,;	G	ENSG00000231031	ENST00000436967	Transcript	intron_variant						rs35632910	1		1	AC008271.1	Clone_based_vega_gene		protein_coding	YES		ENSP00000399192			UPI000173A3E9					2/3			0.3903	0.5072		0.2649	0.4761	0.547										MODIFIER	1	insertion														.	GAG	.	.																					15865924
Unknown	0	.	GRCh37	2	19006827	19006828	+	IGR	INS	-	-	CA	rs66707718		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		CA				intergenic_variant						rs66707718	1																				0.7277	0.7349		0.8938	0.7584	0.8712										MODIFIER	1	insertion														.	TGC	.	.																					19006827
Unknown	0	.	GRCh37	2	19722695	19722696	+	IGR	INS	-	-	CCC	rs5829703		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		CCC				intergenic_variant						rs5829703	1																				0.2398	0.3905		0.1994	0.494	0.4407										MODIFIER	1	insertion														.	GAC	.	.																					19722695
Unknown	0	.	GRCh37	2	19750374	19750387	+	IGR	DEL	TGGGTAAGACAGGC	TGGGTAAGACAGGC	-	rs67622352		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGGGTAAGACAGGC	TGGGTAAGACAGGC																					4	.	4	0	.	0		-				intergenic_variant						rs67622352	1																			0.0573	0.1513	0.036			0.0457	0.0164										MODIFIER	1	deletion														.	AATGGGTAAGACAGGCA	.	.																					19750373
AC067959.1	0	.	GRCh37	2	21784677	21784679	+	Intron	DEL	TTG	TTG	-	rs140656890		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTG	TTG																n.193+32576_193+32578del			ENST00000435237		4	.	4	0	.	0	AC067959.1,intron_variant,,ENST00000435237,;AC011752.1,downstream_gene_variant,,ENST00000451476,;	-	ENSG00000233005	ENST00000435237	Transcript	intron_variant,non_coding_transcript_variant						rs140656890	1		1	AC067959.1	Clone_based_vega_gene		lincRNA											3/5			0.6331	0.9092		0.8075	0.9334	0.9458										MODIFIER	1	deletion														.	TTTTGT	.	.																					21784676
ADCY3	109	.	GRCh37	2	25104680	25104681	+	Intron	DEL	GT	GT	-	rs3037312		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																c.676-9093_676-9092del			ENST00000260600		5	.	3	3	.	0	ADCY3,intron_variant,,ENST00000260600,NM_004036.3;ADCY3,intron_variant,,ENST00000435135,;ADCY3,upstream_gene_variant,,ENST00000433852,;,regulatory_region_variant,,ENSR00000383672,;,regulatory_region_variant,,ENSR00001171087,;	-	ENSG00000138031	ENST00000260600	Transcript	intron_variant						rs3037312	1		-1	ADCY3	HGNC	234	protein_coding	YES	CCDS1715.1	ENSP00000260600	O60266	Q8NBM1,C9J969	UPI000013D0ED	NM_004036.3				1/20			0.3971	0.2752		0.4792	0.3877	0.4274										MODIFIER	1	deletion														.	CAGTG	.	.																					25104679
DTNB	1838	.	GRCh37	2	25788482	25788482	+	Intron	DEL	T	T	-	rs5829980		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.876+11225del			ENST00000406818		4	.	4	0	.	0	DTNB,intron_variant,,ENST00000288642,;DTNB,intron_variant,,ENST00000404103,NM_033147.3;DTNB,intron_variant,,ENST00000405222,NM_183361.2;DTNB,intron_variant,,ENST00000406818,NM_001256303.1,NM_021907.4;DTNB,intron_variant,,ENST00000407038,NM_033148.3;DTNB,intron_variant,,ENST00000407186,;DTNB,intron_variant,,ENST00000407661,NM_183360.2,NM_001256304.1;DTNB,intron_variant,,ENST00000496972,NM_001256308.1;DTNB,intron_variant,,ENST00000545439,;DTNB,intron_variant,,ENST00000356599,;DTNB,intron_variant,,ENST00000398951,;DTNB,intron_variant,,ENST00000485845,;,regulatory_region_variant,,ENSR00001616863,;	-	ENSG00000138101	ENST00000406818	Transcript	intron_variant						rs5829980	1		-1	DTNB	HGNC	3058	protein_coding	YES	CCDS46237.1	ENSP00000384084	O60941	Q53TC8,Q53T51,Q53SF9,Q53QV1,F8W9U0,E9PE76,E7ES64	UPI0000129949	NM_001256303.1,NM_021907.4				8/20			0.5998	0.3098		0.4534	0.2366	0.2393										MODIFIER	1	deletion														.	CATT	.	.																					25788481
OTOF	9381	.	GRCh37	2	26748998	26748999	+	Intron	INS	-	-	GGA	rs70950195		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.227+1699_227+1701dup			ENST00000272371		5	.	4	3	.	0	OTOF,intron_variant,,ENST00000272371,NM_194248.2;OTOF,intron_variant,,ENST00000403946,NM_001287489.1;	GGA	ENSG00000115155	ENST00000272371	Transcript	intron_variant						rs70950195	1		-1	OTOF	HGNC	8515	protein_coding	YES	CCDS1725.1	ENSP00000272371	Q9HC10		UPI000013D94D	NM_194248.2				3/46			0.2837	0.8228		0.7143	0.8618	0.865										MODIFIER	1	insertion													1	.	ATG	.	.																					26748998
BRE	9577	.	GRCh37	2	28443979	28443982	+	Intron	DEL	CTCT	CTCT	-	rs72394956		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTCT	CTCT																c.681-16073_681-16070del			ENST00000344773		3	.	3	0	.	0	BRE,intron_variant,,ENST00000342045,NM_199194.2;BRE,intron_variant,,ENST00000344773,NM_004899.4;BRE,intron_variant,,ENST00000361704,NM_199192.2;BRE,intron_variant,,ENST00000379624,NM_001261840.1,NM_199191.2;BRE,intron_variant,,ENST00000379629,;BRE,intron_variant,,ENST00000379632,NM_199193.2;	-	ENSG00000158019	ENST00000344773	Transcript	intron_variant						rs72394956	1		1	BRE	HGNC	1106	protein_coding	YES	CCDS1764.1	ENSP00000343412	Q9NXR7	C9J2G0	UPI0000072A9C	NM_004899.4				7/12			0.208	0.098		0.006	0.1918	0.1074										MODIFIER	1	deletion														.	TCCTCTC	.	.																					28443978
FOSL2	2355	.	GRCh37	2	28628596	28628596	+	Intron	DEL	G	G	-	rs11340945		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.354+1374del			ENST00000264716		3	.	3	0	.	0	FOSL2,intron_variant,,ENST00000264716,NM_005253.3;FOSL2,intron_variant,,ENST00000379619,;FOSL2,intron_variant,,ENST00000436647,;FOSL2,intron_variant,,ENST00000545753,;FOSL2,intron_variant,,ENST00000460736,;,regulatory_region_variant,,ENSR00001617286,;	-	ENSG00000075426	ENST00000264716	Transcript	intron_variant						rs11340945	1		1	FOSL2	HGNC	3798	protein_coding	YES	CCDS1766.1	ENSP00000264716	P15408	C9JCN8	UPI000004F8AB	NM_005253.3				2/3			0.2231	0.2233		0.1766	0.4006	0.4499										MODIFIER	1	deletion														.	TTGG	.	.																					28628595
SNRPGP7	0	.	GRCh37	2	28684317	28684322	+	5'Flank	DEL	CAGTAC	CAGTAC	-	rs55822322		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAGTAC	CAGTAC																			ENST00000469016		3	.	3	0	.	0	PLB1,intron_variant,,ENST00000416713,;SNRPGP7,upstream_gene_variant,,ENST00000469016,;,regulatory_region_variant,,ENSR00001617299,;	-	ENSG00000242915	ENST00000469016	Transcript	upstream_gene_variant						rs55822322	1	1089	-1	SNRPGP7	HGNC	39326	processed_pseudogene	YES													0.2511	0.4524		0.3095	0.5229	0.6145										MODIFIER	1	deletion														.	TACAGTACC	.	.																					28684316
AC009499.1	0	.	GRCh37	2	34106106	34106107	+	Intron	DEL	AT	AT	-	rs58877876		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																n.134+25286_134+25287del			ENST00000366209		3	.	3	0	.	0	AC009499.1,intron_variant,,ENST00000366209,;AC009499.1,intron_variant,,ENST00000442026,;	-	ENSG00000203386	ENST00000366209	Transcript	intron_variant,non_coding_transcript_variant						rs58877876	1		1	AC009499.1	Clone_based_vega_gene		lincRNA	YES										2/5		0.3043	0.1596	0.353		0.3125	0.3996	0.3589										MODIFIER	1	deletion														.	ACATG	.	.																					34106105
Unknown	0	.	GRCh37	2	35468231	35468232	+	IGR	INS	-	-	AA	rs72248337		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		AA				intergenic_variant						rs72248337	1																				0.587	0.696		0.9514	0.5447	0.8599										MODIFIER	1	insertion														.	ATA	.	.																					35468231
STRN	6801	.	GRCh37	2	37141133	37141133	+	Intron	DEL	T	T	-	rs887137743		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.412+2088del			ENST00000263918		3	.	3	0	.	0	STRN,intron_variant,,ENST00000263918,NM_003162.3;STRN,intron_variant,,ENST00000379213,;,regulatory_region_variant,,ENSR00000384067,;	-	ENSG00000115808	ENST00000263918	Transcript	intron_variant						rs887137743	1		-1	STRN	HGNC	11424	protein_coding	YES	CCDS1784.1	ENSP00000263918	O43815		UPI000013D48A	NM_003162.3				3/17																		MODIFIER	1	deletion													1	.	GATT	.	.																					37141132
SLC8A1	6546	.	GRCh37	2	40359906	40359906	+	Intron	DEL	T	T	-	rs147809272		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.2545+6635del			ENST00000403092		3	.	3	0	.	0	SLC8A1,intron_variant,,ENST00000332839,NM_021097.2;SLC8A1,intron_variant,,ENST00000402441,NM_001112802.1;SLC8A1,intron_variant,,ENST00000403092,;SLC8A1,intron_variant,,ENST00000405269,;SLC8A1,intron_variant,,ENST00000405901,NM_001112800.1;SLC8A1,intron_variant,,ENST00000406391,;SLC8A1,intron_variant,,ENST00000406785,;SLC8A1,intron_variant,,ENST00000408028,NM_001252624.1;SLC8A1,intron_variant,,ENST00000542024,;SLC8A1,intron_variant,,ENST00000542756,;SLC8A1-AS1,intron_variant,,ENST00000435515,;SLC8A1-AS1,intron_variant,,ENST00000444629,;SLC8A1-AS1,intron_variant,,ENST00000593848,;SLC8A1-AS1,intron_variant,,ENST00000593878,;SLC8A1-AS1,intron_variant,,ENST00000596532,;SLC8A1-AS1,intron_variant,,ENST00000597170,;SLC8A1-AS1,intron_variant,,ENST00000597385,;SLC8A1-AS1,intron_variant,,ENST00000598247,;SLC8A1-AS1,intron_variant,,ENST00000599268,;SLC8A1-AS1,intron_variant,,ENST00000599740,;SLC8A1-AS1,intron_variant,,ENST00000599956,;SLC8A1-AS1,intron_variant,,ENST00000601679,;SLC8A1,intron_variant,,ENST00000407929,;	-	ENSG00000183023	ENST00000403092	Transcript	intron_variant						rs147809272	1		-1	SLC8A1	HGNC	11068	protein_coding	YES	CCDS1806.1	ENSP00000384763	P32418	Q6LAJ9,Q6LAJ8,Q4QQH3,E9PCL8,E9PB98	UPI000012FC46					10/10		0.1088	0.2368	0.0865		0.0079	0.0984	0.0665										MODIFIER	1	deletion														.	AATA	.	.																					40359905
SLC8A1	6546	.	GRCh37	2	40414799	40414799	+	Intron	DEL	G	G	-	rs34653594		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.1809-9166del			ENST00000403092		3	.	3	0	.	0	SLC8A1,intron_variant,,ENST00000332839,NM_021097.2;SLC8A1,intron_variant,,ENST00000402441,NM_001112802.1;SLC8A1,intron_variant,,ENST00000403092,;SLC8A1,intron_variant,,ENST00000405269,;SLC8A1,intron_variant,,ENST00000405901,NM_001112800.1;SLC8A1,intron_variant,,ENST00000406391,;SLC8A1,intron_variant,,ENST00000406785,;SLC8A1,intron_variant,,ENST00000408028,NM_001252624.1;SLC8A1,intron_variant,,ENST00000542024,;SLC8A1,intron_variant,,ENST00000542756,;SLC8A1-AS1,intron_variant,,ENST00000435515,;SLC8A1-AS1,intron_variant,,ENST00000444629,;SLC8A1-AS1,intron_variant,,ENST00000593848,;SLC8A1-AS1,intron_variant,,ENST00000593878,;SLC8A1-AS1,intron_variant,,ENST00000596532,;SLC8A1-AS1,intron_variant,,ENST00000597170,;SLC8A1-AS1,intron_variant,,ENST00000597385,;SLC8A1-AS1,intron_variant,,ENST00000598247,;SLC8A1-AS1,intron_variant,,ENST00000599268,;SLC8A1-AS1,intron_variant,,ENST00000599740,;SLC8A1-AS1,intron_variant,,ENST00000599956,;SLC8A1-AS1,intron_variant,,ENST00000601679,;SLC8A1,intron_variant,,ENST00000407929,;	-	ENSG00000183023	ENST00000403092	Transcript	intron_variant						rs34653594	1		-1	SLC8A1	HGNC	11068	protein_coding	YES	CCDS1806.1	ENSP00000384763	P32418	Q6LAJ9,Q6LAJ8,Q4QQH3,E9PCL8,E9PB98	UPI000012FC46					2/10		0.1356	0.1528	0.2349		0.1627	0.0974	0.0532										MODIFIER	1	deletion														.	TTGT	.	.																					40414798
Unknown	0	.	GRCh37	2	41447665	41447665	+	IGR	DEL	A	A	-	rs10714182		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					6	.	3	3	.	0		-				intergenic_variant						rs10714182	1																				0.8631	0.6729		0.5179	0.6759	0.7536										MODIFIER	1	deletion														.	TTAA	.	.																					41447664
Unknown	0	.	GRCh37	2	41455736	41455737	+	IGR	INS	-	-	A	rs11443068		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	6	0	.	0		A				intergenic_variant						rs11443068	1																				0.7269	0.6657		0.5446	0.6819	0.7495										MODIFIER	1	insertion														.	ATA	.	.																					41455736
AC012354.6	0	.	GRCh37	2	45180422	45180422	+	5'Flank	DEL	C	C	-	rs5830817		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENST00000425325		3	.	3	0	.	0	AC012354.6,upstream_gene_variant,,ENST00000425325,;	-	ENSG00000225156	ENST00000425325	Transcript	upstream_gene_variant						rs5830817	1	1381	1	AC012354.6	Clone_based_vega_gene		lincRNA	YES																												MODIFIER	1	deletion														.	GGCC	.	.																					45180421
AC007682.1	730100	.	GRCh37	2	52513038	52513049	+	Intron	DEL	AAAAAAAAAAAA	AAAAAAAAAAAA	-	rs10527778		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAAAAAAAAAA	AAAAAAAAAAAA																n.880-30322_880-30311del			ENST00000440698		3	.	3	0	.	0	AC007682.1,intron_variant,,ENST00000440698,;	-	ENSG00000231918	ENST00000440698	Transcript	intron_variant,non_coding_transcript_variant						rs10527778	1		1	AC007682.1	Clone_based_vega_gene		lincRNA	YES										7/10																		MODIFIER	1	deletion														.	TCAAAAAAAAAAAAA	.	.																					52513037
AC010967.2	0	.	GRCh37	2	52971052	52971053	+	Intron	INS	-	-	TT	rs67773714		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.120-11139_120-11138dup			ENST00000421575		5	.	3	3	.	0	AC010967.2,intron_variant,,ENST00000421575,;AC010967.2,intron_variant,,ENST00000443237,;	TT	ENSG00000228033	ENST00000421575	Transcript	intron_variant,non_coding_transcript_variant						rs67773714	1		-1	AC010967.2	Clone_based_vega_gene		lincRNA	YES										2/4			0.1112	0.0692		0.001	0.1103	0.1043										MODIFIER	1	insertion														.	CAT	.	.																					52971052
Unknown	0	.	GRCh37	2	53226860	53226863	+	IGR	DEL	ATTT	ATTT	-	rs141425914		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATTT	ATTT																					4	.	4	0	.	0		-				intergenic_variant						rs141425914	1																				0.3654	0.1643		0.1052	0.1889	0.2301										MODIFIER	1	deletion														.	AAATTTA	.	.																					53226859
Unknown	0	.	GRCh37	2	57485831	57485832	+	IGR	INS	-	-	AATA	rs5831457		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	6	0	.	0		AATA				intergenic_variant						rs5831457	1																				0.6611	0.6484		0.7173	0.7038	0.6217										MODIFIER	1	insertion														.	TTA	.	.																					57485831
LINC01122	0	.	GRCh37	2	59219072	59219073	+	Intron	INS	-	-	A	rs11383630		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.816-11998dup			ENST00000452840		3	.	3	0	.	0	LINC01122,intron_variant,,ENST00000427421,;LINC01122,intron_variant,,ENST00000449448,;LINC01122,intron_variant,,ENST00000452840,;	A	ENSG00000233723	ENST00000452840	Transcript	intron_variant,non_coding_transcript_variant						rs11383630	1		1	LINC01122	HGNC	49267	lincRNA	YES										6/11			0.73	0.3487		0.3016	0.4076	0.5123										MODIFIER	1	insertion														.	CTA	.	.																					59219072
Unknown	0	.	GRCh37	2	59402220	59402225	+	IGR	DEL	CCGCTG	CCGCTG	-	rs11278170		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCGCTG	CCGCTG																					3	.	3	0	.	0		-				intergenic_variant						rs11278170	1																				0.8533	0.5533		0.7143	0.6481	0.6483										MODIFIER	1	deletion														.	TCCCGCTGC	.	.																					59402219
ENSR00001178401	0	.	GRCh37	2	60792434	60792434	+	IGR	DEL	T	T	-	rs145463538		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENSR00001178401		6	.	3	3	.	0	,regulatory_region_variant,,ENSR00001178401,;	-		ENSR00001178401	RegulatoryFeature	regulatory_region_variant						rs145463538	1																				0.0166	0.1455		0.005	0.2634	0.0603										MODIFIER	1	deletion														.	GATT	.	.																					60792433
Unknown	0	.	GRCh37	2	65102387	65102388	+	IGR	DEL	AA	AA	-	rs11294808		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																					4	.	4	0	.	0		-				intergenic_variant						rs11294808	1																																			MODIFIER	1	deletion														.	GCAAA	.	.																					65102386
RAB1A	5861	.	GRCh37	2	65325265	65325266	+	Intron	INS	-	-	A	rs199607937		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.97-65dup			ENST00000409784		8	.	8	0	.	0	RAB1A,intron_variant,,ENST00000260638,;RAB1A,intron_variant,,ENST00000356214,;RAB1A,intron_variant,,ENST00000398529,NM_015543.1;RAB1A,intron_variant,,ENST00000409751,;RAB1A,intron_variant,,ENST00000409784,NM_004161.4;RAB1A,intron_variant,,ENST00000409892,;RAB1A,intron_variant,,ENST00000494188,;	AA	ENSG00000138069	ENST00000409784	Transcript	intron_variant						rs199607937	1		-1	RAB1A	HGNC	9758	protein_coding	YES	CCDS46306.1	ENSP00000387286	P62820	Q96RD8,Q5U0I6	UPI0000001259	NM_004161.4				2/5																		MODIFIER	1	sequence_alteration														.	GGAA	.	.																					65325264
FBXO48	554251	.	GRCh37	2	68691329	68691329	+	3'UTR	DEL	T	T	-	rs755534404		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.*12del			ENST00000377957	4/4	195	.	108	149	.	144	FBXO48,3_prime_UTR_variant,,ENST00000377957,NM_001024680.1;APLF,upstream_gene_variant,,ENST00000303795,NM_173545.2;APLF,upstream_gene_variant,,ENST00000445692,;APLF,upstream_gene_variant,,ENST00000529851,;	-	ENSG00000204923	ENST00000377957	Transcript	3_prime_UTR_variant	888/5666					rs755534404	1		-1	FBXO48	HGNC	33857	protein_coding	YES	CCDS33213.1	ENSP00000367193	Q5FWF7		UPI00004C96E0	NM_001024680.1			4/4																			MODIFIER	1	sequence_alteration														.	GATT	.	.												4.013e-06						8.843e-06			68691328
LRRTM4	80059	.	GRCh37	2	77041031	77041032	+	Intron	INS	-	-	ATT	rs3055932		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1552-64992_1552-64990dup			ENST00000409093		3	.	3	0	.	0	LRRTM4,intron_variant,,ENST00000409093,;LRRTM4,intron_variant,,ENST00000409884,;LRRTM4,intron_variant,,ENST00000409911,NM_001282924.1,NM_001134745.1;	ATT	ENSG00000176204	ENST00000409093	Transcript	intron_variant						rs3055932	1		-1	LRRTM4	HGNC	19411	protein_coding	YES	CCDS46346.1	ENSP00000386357	Q86VH4	C9JM64	UPI0000047808					3/3			0.5893	0.611		0.744	0.3996	0.5307										MODIFIER	1	insertion														.	CAA	.	.																					77041031
ENSR00001622499	0	.	GRCh37	2	79227130	79227131	+	IGR	INS	-	-	ACAAATACCCA	rs67005065		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001622499		4	.	4	0	.	0	,regulatory_region_variant,,ENSR00001622499,;	ACAAATACCCA		ENSR00001622499	RegulatoryFeature	regulatory_region_variant						rs67005065	1																				0.5893	0.755		0.7937	0.659	0.7249										MODIFIER	1	insertion														.	GCA	.	.																					79227130
SFTPB	6439	.	GRCh37	2	85897400	85897400	+	5'Flank	DEL	T	T	-	rs34248947		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000393822		6	.	3	4	.	0	SFTPB,upstream_gene_variant,,ENST00000342375,NM_000542.3,NM_198843.2;SFTPB,upstream_gene_variant,,ENST00000393822,;SFTPB,upstream_gene_variant,,ENST00000409383,;SFTPB,upstream_gene_variant,,ENST00000428225,;SFTPB,upstream_gene_variant,,ENST00000519937,;SFTPB,upstream_gene_variant,,ENST00000473692,;	-	ENSG00000168878	ENST00000393822	Transcript	upstream_gene_variant						rs34248947	1	1536	-1	SFTPB	HGNC	10801	protein_coding	YES	CCDS1983.2	ENSP00000377409		D6W5L6	UPI0000421A06								0.7526	0.598		0.629	0.5825	0.6626										MODIFIER	1	deletion													1	.	TCTT	.	.																					85897399
PTCD3	55037	.	GRCh37	2	86369181	86369181	+	3'UTR	DEL	G	G	-	rs58330825		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.*4504del			ENST00000254630	24/24	4	.	4	0	.	0	PTCD3,3_prime_UTR_variant,,ENST00000254630,NM_017952.5;IMMT,downstream_gene_variant,,ENST00000254636,;IMMT,downstream_gene_variant,,ENST00000409051,;IMMT,downstream_gene_variant,,ENST00000410111,NM_001100169.1,NM_006839.2,NM_001100170.1;IMMT,downstream_gene_variant,,ENST00000419070,;IMMT,downstream_gene_variant,,ENST00000442664,;IMMT,downstream_gene_variant,,ENST00000449247,;,regulatory_region_variant,,ENSR00001183288,;	-	ENSG00000132300	ENST00000254630	Transcript	3_prime_UTR_variant	6635/6734					rs58330825	1		1	PTCD3	HGNC	24717	protein_coding	YES	CCDS33235.1	ENSP00000254630	Q96EY7		UPI0000208870	NM_017952.5			24/24				0.5545	0.8401		0.753	0.8489	0.8906										MODIFIER	1	deletion														.	AAGG	.	.																					86369180
ANKRD36BP2	645784	.	GRCh37	2	89083543	89083543	+	Intron	DEL	G	G	-	rs142584977		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																n.577-570del			ENST00000393525		16	.	5	17	.	0	ANKRD36BP2,intron_variant,,ENST00000393515,;ANKRD36BP2,intron_variant,,ENST00000393525,;ANKRD36BP2,downstream_gene_variant,,ENST00000421951,;ANKRD36BP2,intron_variant,,ENST00000575193,;	-	ENSG00000230006	ENST00000393525	Transcript	intron_variant,non_coding_transcript_variant						rs142584977	1		1	ANKRD36BP2	HGNC	33607	processed_transcript	YES										5/14																		MODIFIER	1	deletion														.	ATGG	.	.																					89083542
ANKRD36BP2	645784	.	GRCh37	2	89105282	89105282	+	Intron	DEL	G	G	-	rs1225469355		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																n.4899-347del			ENST00000393525		6	4	2	4	4	0	ANKRD36BP2,intron_variant,,ENST00000393515,;ANKRD36BP2,intron_variant,,ENST00000393525,;AC096579.13,downstream_gene_variant,,ENST00000452230,;ANKRD36BP2,non_coding_transcript_exon_variant,,ENST00000454490,;ANKRD36BP2,downstream_gene_variant,,ENST00000575193,;	-	ENSG00000230006	ENST00000393525	Transcript	intron_variant,non_coding_transcript_variant						rs1225469355	1		1	ANKRD36BP2	HGNC	33607	processed_transcript	YES										14/14																		MODIFIER	1	deletion														.	AAGG	.	.																					89105281
Unknown	0	.	GRCh37	2	89871441	89871442	+	IGR	INS	-	-	C	rs377041336		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					9	.	1	8	.	5		C				intergenic_variant						rs377041336	1																																			MODIFIER	1	insertion														.	ATT	.	.																					89871441
Unknown	0	.	GRCh37	2	90413338	90413339	+	IGR	INS	-	-	T	rs796235929		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs796235929	1																				0.4637	0.902		0.9187	0.9026	0.9376										MODIFIER	1	insertion														.	CCG	.	.																					90413338
Unknown	0	.	GRCh37	2	90417245	90417247	+	IGR	DEL	GAG	GAG	-	rs1213758606		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAG	GAG																					6	4	2	4	4	0		-				intergenic_variant						rs1213758606	1																																			MODIFIER	1	deletion														.	ATGAGG	.	.																					90417244
AC116050.1	0	.	GRCh37	2	91793868	91793868	+	Intron	DEL	C	C	-	rs112963259		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																n.542-1649del			ENST00000443031		13	.	8	10	.	10	AC116050.1,intron_variant,,ENST00000443031,;	-	ENSG00000233991	ENST00000443031	Transcript	intron_variant,non_coding_transcript_variant						rs112963259	1		1	AC116050.1	Clone_based_vega_gene		unprocessed_pseudogene	YES										2/4																		MODIFIER	1	deletion														.	GTCC	.	.																					91793867
AC027612.6	654342	.	GRCh37	2	91822551	91822552	+	3'Flank	INS	-	-	A	rs113222391		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000544283		5	.	5	0	.	0	AC027612.6,intron_variant,,ENST00000608501,;AC027612.6,intron_variant,,ENST00000609777,;AC027612.6,downstream_gene_variant,,ENST00000544283,;AC027612.6,downstream_gene_variant,,ENST00000608018,;AC027612.6,downstream_gene_variant,,ENST00000271699,;,regulatory_region_variant,,ENSR00001184173,;	A	ENSG00000143429	ENST00000544283	Transcript	downstream_gene_variant						rs113222391	1	714	-1	AC027612.6	Clone_based_vega_gene		processed_transcript	YES													0.4047	0.5115		0.505	0.5169	0.5245										MODIFIER	1	insertion														.	AGA	.	.																					91822551
Unknown	0	.	GRCh37	2	92315653	92315791	+	IGR	INS	TTGCATTCAAGTCACAGAGTTCAAAGTTCGGTATCATAGAGCAGGTTGGAAACACGCCCTTTGTCATATCTGGATGTGTCCGTTTGGAGCGCATTCAGGCTTGTGTTGAAAAAGGAAATATCTTCCCATAGAAACCAGA	TTGCATTCAAGTCACAGAGTTCAAAGTTCGGTATCATAGAGCAGGTTGGAAACACGCCCTTTGTCATATCTGGATGTGTCCGTTTGGAGCGCATTCAGGCTTGTGTTGAAAAAGGAAATATCTTCCCATAGAAACCAGA	GTTTGCATTCAAGTCACAGAGTTCAAAGTTCGGTATCATAGAGCAGGTTGGAAACACGCCCTTTGTCATATCTGGATGTGTCCGTTTGGAGCGCATTCAGGCTTGTGTTGAAAAAGGAAATATCTTCCCATAGAAACCAGA	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTGCATTCAAGTCACAGAGTTCAAAGTTCGGTATCATAGAGCAGGTTGGAAACACGCCCTTTGTCATATCTGGATGTGTCCGTTTGGAGCGCATTCAGGCTTGTGTTGAAAAAGGAAATATCTTCCCATAGAAACCAGA	TTGCATTCAAGTCACAGAGTTCAAAGTTCGGTATCATAGAGCAGGTTGGAAACACGCCCTTTGTCATATCTGGATGTGTCCGTTTGGAGCGCATTCAGGCTTGTGTTGAAAAAGGAAATATCTTCCCATAGAAACCAGA																					58	.	3	50	.	2		AAACAAGACAGAAGCATTCTCTGAAACCGGTTTCTGAGGTGTGTCCTCAACTAACAGAGTTGAACATTTCTTTTGACAGAACAGTTTTGAAACACTCATTTTGTGGTATCTGCAAGTGAATATTTGGCTGGCCTTGAGGATTTCGTTGGAACCGGGAATACTTATAAAAAGCAGACAGCAGCATTGTGAGAAACTTCTTTGTGATGTGTTTGCATTCAAGTCACAGAGTTCAAAGTTCGGTATCATAGAGCAGGTTGGAAACACGCCCTTTGTCATATCTGGATGTGTCCGTTTGGAGCGCATTCAGGCTTGTGTTGAAAAAGGAAATATCTTCCCATAGAAACCAGA				intergenic_variant							3																																			MODIFIER	1	indel														.	AAAACAAGACAGAAGCATTCTCTGAAACCGGTTTCTGAGGTGTGTCCTCAACTAACAGAGTTGAACATTTCTTTTGACAGAACAGTTTTGAAACACTCATTTTGTGGTATCTGCAAGTGAATATTTGGCTGGCCTTGAGGATTTCGTTGGAACCGGGAATACTTATAAAAAGCAGACAGCAGCATTGTGAGAAACTTCTTTGTGATGTTTGCATTCAAGTCACAGAGTTCAAAGTTCGGTATCATAGAGCAGGTTGGAAACACGCCCTTTGTCATATCTGGATGTGTCCGTTTGGAGCGCATTCAGGCTTGTGTTGAAAAAGGAAATATCTTCCCATAGAAACCAGAC	.	.																					92315446
ENSR00001623455	0	.	GRCh37	2	95729185	95729186	+	IGR	INS	-	-	T	rs56106066		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001623455		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001623455,;	T		ENSR00001623455	RegulatoryFeature	regulatory_region_variant						rs56106066	1																				0.4274	0.3862		0.381	0.5189	0.5235										MODIFIER	1	insertion														.	AAT	.	.																					95729185
ANKRD36C	0	.	GRCh37	2	96526347	96526348	+	Intron	INS	-	-	AA	rs75959480		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.764-526_764-525insTT			ENST00000419039		8	4	4	4	4	0	ANKRD36C,intron_variant,,ENST00000419039,;ANKRD36C,intron_variant,,ENST00000420871,;ANKRD36C,intron_variant,,ENST00000456556,;ANKRD36C,intron_variant,,ENST00000531153,;ANKRD36C,intron_variant,,ENST00000534304,;ANKRD36C,upstream_gene_variant,,ENST00000488721,;	AA	ENSG00000174501	ENST00000419039	Transcript	intron_variant						rs75959480	1		-1	ANKRD36C	HGNC	32946	protein_coding			ENSP00000407838		I1Z9D5,I1Z9D4,I1Z9D3,I1Z9D2,F8WEX4	UPI0002065901					52/57																		MODIFIER		insertion														.	ACT	.	.																					96526347
VWA3B	200403	.	GRCh37	2	98902743	98902753	+	Intron	DEL	TACTGGCTAGA	TACTGGCTAGA	-	rs151031310		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TACTGGCTAGA	TACTGGCTAGA																c.3046-4231_3046-4221del			ENST00000477737		3	.	3	0	.	0	VWA3B,intron_variant,,ENST00000473149,;VWA3B,intron_variant,,ENST00000477737,NM_144992.4;VWA3B,intron_variant,,ENST00000490947,;VWA3B,intron_variant,,ENST00000409460,;VWA3B,intron_variant,,ENST00000432242,;VWA3B,intron_variant,,ENST00000489630,;VWA3B,intron_variant,,ENST00000495571,;	-	ENSG00000168658	ENST00000477737	Transcript	intron_variant						rs151031310	1		1	VWA3B	HGNC	28385	protein_coding	YES	CCDS42718.1	ENSP00000417955	Q502W6	Q53RD3	UPI0000E9B173	NM_144992.4				22/27		0.0733	0.0492	0.1124		0.0258	0.1571	0.0409										MODIFIER	1	deletion														.	TGTACTGGCTAGAA	.	.																					98902742
Unknown	0	.	GRCh37	2	99579503	99579511	+	IGR	DEL	GTATTTTTA	GTATTTTTA	-	rs111887919		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GTATTTTTA	GTATTTTTA																					3	.	3	0	.	0		-				intergenic_variant						rs111887919	1																				0.6256	0.4337		0.126	0.2594	0.3313										MODIFIER	1	deletion														.	TTGTATTTTTAG	.	.																					99579502
ENSR00001624280	0	.	GRCh37	2	101944533	101944534	+	IGR	INS	-	-	GGAGATGATTATGGAGCCAT	rs371443609		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001624280		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001624280,;,TF_binding_site_variant,,ENSM00530259200,;,TF_binding_site_variant,,ENSM00908974550,;	GGAGATGATTATGGAGCCAT		ENSR00001624280	RegulatoryFeature	regulatory_region_variant						rs371443609	1																				0.0045	0.0043			0.0159	0.0041										MODIFIER		insertion														.	ACG	.	.																					101944533
LINC01158	100506421	.	GRCh37	2	105440965	105440966	+	Intron	INS	-	-	TGG	rs376797707		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.148-11655_148-11653dup			ENST00000458253		7	3	4	4	4	0	LINC01158,intron_variant,,ENST00000413121,;LINC01158,intron_variant,,ENST00000443988,;LINC01158,intron_variant,,ENST00000447876,;LINC01158,intron_variant,,ENST00000454729,;LINC01158,intron_variant,,ENST00000458253,;	TGG	ENSG00000233639	ENST00000458253	Transcript	intron_variant,non_coding_transcript_variant						rs376797707	1		-1	LINC01158	HGNC	49513	antisense	YES										1/3																		MODIFIER	1	insertion														.	GAT	.	.																					105440965
AC023672.2	0	.	GRCh37	2	108661091	108661091	+	3'Flank	DEL	A	A	-	rs11354001		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000424355		4	.	4	0	.	0	AC023672.2,downstream_gene_variant,,ENST00000424355,;	-	ENSG00000231221	ENST00000424355	Transcript	downstream_gene_variant						rs11354001	1	4565	-1	AC023672.2	Clone_based_vega_gene		lincRNA	YES													0.9244	0.9784		1	0.9781	0.9775										MODIFIER	1	deletion														.	AGAA	.	.																					108661090
BCL2L11	10018	.	GRCh37	2	111881264	111881264	+	Intron	DEL	T	T	-	rs372903612		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.-13-36del			ENST00000393256		11	.	3	5	.	0	BCL2L11,intron_variant,,ENST00000308659,;BCL2L11,intron_variant,,ENST00000337565,NM_207002.3;BCL2L11,intron_variant,,ENST00000357757,;BCL2L11,intron_variant,,ENST00000393252,;BCL2L11,intron_variant,,ENST00000393253,;BCL2L11,intron_variant,,ENST00000393256,NM_006538.4,NM_001204106.1,NM_138621.4,NM_138627.3;BCL2L11,intron_variant,,ENST00000432179,;BCL2L11,upstream_gene_variant,,ENST00000405953,;BCL2L11,upstream_gene_variant,,ENST00000438054,NM_001204113.1;BCL2L11,intron_variant,,ENST00000433098,;BCL2L11,upstream_gene_variant,,ENST00000361493,;BCL2L11,upstream_gene_variant,,ENST00000415458,NM_001204112.1;BCL2L11,upstream_gene_variant,,ENST00000431217,NM_138624.3;BCL2L11,upstream_gene_variant,,ENST00000436733,NM_001204109.1;BCL2L11,upstream_gene_variant,,ENST00000437029,;BCL2L11,upstream_gene_variant,,ENST00000439718,;BCL2L11,upstream_gene_variant,,ENST00000452231,NM_001204110.1;,regulatory_region_variant,,ENSR00000292932,;	-	ENSG00000153094	ENST00000393256	Transcript	intron_variant						rs372903612	1		1	BCL2L11	HGNC	994	protein_coding	YES	CCDS2089.1	ENSP00000376943	O43521	E9PAM9,C9J417	UPI0000033ABA	NM_006538.4,NM_001204106.1,NM_138621.4,NM_138627.3				1/3																		MODIFIER	1	deletion														.	GATT	.	.																					111881263
MIR4435-1HG	112597	.	GRCh37	2	111999898	111999899	+	5'Flank	INS	-	-	A	rs560827012		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000371162		3	.	3	0	.	0	MIR4435-1HG,intron_variant,,ENST00000431385,;MIR4435-1HG,intron_variant,,ENST00000439362,;MIR4435-1HG,intron_variant,,ENST00000443467,;MIR4435-1HG,intron_variant,,ENST00000609220,;MIR4435-1HG,intron_variant,,ENST00000609902,;MIR4435-1HG,upstream_gene_variant,,ENST00000371162,;	A	ENSG00000172965	ENST00000371162	Transcript	upstream_gene_variant						rs560827012	1	3274	-1	MIR4435-1HG	HGNC	35163	lincRNA	YES													0.0794	0.0821		0.0982	0.17	0.1084										MODIFIER	1	insertion														.	TCA	.	.																					111999898
POLR1B	84172	.	GRCh37	2	113300960	113300960	+	Intron	DEL	A	A	-	rs11298106		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.177+713del			ENST00000263331		4	.	4	0	.	0	POLR1B,intron_variant,,ENST00000263331,NM_019014.4;POLR1B,intron_variant,,ENST00000409894,NM_001282774.1;POLR1B,intron_variant,,ENST00000417433,NM_001137604.1;POLR1B,intron_variant,,ENST00000430769,;POLR1B,intron_variant,,ENST00000438748,;POLR1B,intron_variant,,ENST00000537335,NM_001282776.1;POLR1B,intron_variant,,ENST00000541869,NM_001282772.1;TTL,downstream_gene_variant,,ENST00000233336,NM_153712.4;POLR1B,intron_variant,,ENST00000496238,;POLR1B,intron_variant,,ENST00000333990,NM_001282777.1;POLR1B,intron_variant,,ENST00000424062,;POLR1B,intron_variant,,ENST00000430293,;POLR1B,intron_variant,,ENST00000448770,;POLR1B,upstream_gene_variant,,ENST00000468475,;,regulatory_region_variant,,ENSR00000121947,;	-	ENSG00000125630	ENST00000263331	Transcript	intron_variant						rs11298106	1		1	POLR1B	HGNC	20454	protein_coding	YES	CCDS2097.1	ENSP00000263331	Q9H9Y6	Q9BSR4,Q6DKI9,F5H643,C9JS83,C9JJG2,B7Z1W6	UPI00001B6B03	NM_019014.4				1/14			0.7776	0.7853		0.7063	0.7803	0.7986										MODIFIER	1	deletion														.	ATAA	.	.																					113300959
ENSR00000121968	0	.	GRCh37	2	113463917	113463918	+	IGR	INS	-	-	CTCTCCA	rs11282964		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00000121968		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00000121968,;	CTCTCCA		ENSR00000121968	RegulatoryFeature	regulatory_region_variant						rs11282964	1																				0.5484	0.3862		0.1706	0.497	0.4836										MODIFIER	1	insertion														.	CTC	.	.																					113463917
CKAP2L	150468	.	GRCh37	2	113504675	113504675	+	Intron	DEL	T	T	-	rs11365193		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1603-523del			ENST00000302450		3	.	3	0	.	0	CKAP2L,intron_variant,,ENST00000302450,NM_152515.3;CKAP2L,intron_variant,,ENST00000541405,;NT5DC4,downstream_gene_variant,,ENST00000327581,;CKAP2L,intron_variant,,ENST00000435431,;CKAP2L,intron_variant,,ENST00000474331,;	-	ENSG00000169607	ENST00000302450	Transcript	intron_variant						rs11365193	1		-1	CKAP2L	HGNC	26877	protein_coding	YES	CCDS2100.1	ENSP00000305204	Q8IYA6	F5H0M5	UPI0000207D64	NM_152515.3				5/8			0.792	0.4222		0.3323	0.4543	0.5297										MODIFIER	1	deletion													1	.	TCTT	.	.																					113504674
Unknown	0	.	GRCh37	2	115099817	115099817	+	IGR	DEL	T	T	-	rs70937274		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs70937274	1																				0.6271	0.9179		0.9097	0.8946	0.9366										MODIFIER	1	deletion														.	TCTT	.	.																					115099816
DPP10	57628	.	GRCh37	2	116593676	116593679	+	Intron	DEL	TGTG	TGTG	-	rs10549769		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGTG	TGTG																c.1963-57_1963-54del			ENST00000393147		14	.	4	11	.	0	DPP10,intron_variant,,ENST00000310323,NM_001004360.3;DPP10,intron_variant,,ENST00000393147,NM_001178034.1;DPP10,intron_variant,,ENST00000409163,NM_001178036.1;DPP10,intron_variant,,ENST00000410059,NM_001178037.1,NM_020868.3;DPP10,intron_variant,,ENST00000473362,;	-	ENSG00000175497	ENST00000393147	Transcript	intron_variant						rs10549769	2		1	DPP10	HGNC	20823	protein_coding	YES	CCDS54388.1	ENSP00000376855	Q8N608	J3KQK8,C9J4M8	UPI00015E0A22	NM_001178034.1				21/25																		MODIFIER	1	sequence_alteration													1	.	TATGTGT	.	.																					116593675
Unknown	0	.	GRCh37	2	116962896	116962900	+	IGR	DEL	CTAGT	CTAGT	-	rs560165376		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTAGT	CTAGT																					3	.	3	0	.	0		-				intergenic_variant						rs560165376	1																					0.0086			0.005	0.002										MODIFIER	1	deletion														.	TGCTAGTC	.	.																					116962895
CCDC93	54520	.	GRCh37	2	118771683	118771685	+	5'UTR	DEL	GCC	GCC	-	rs58181584		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GCC	GCC																c.-114_-112del			ENST00000376300	1/24	5	.	3	5	.	0	CCDC93,5_prime_UTR_variant,,ENST00000376300,NM_019044.4;CCDC93,5_prime_UTR_variant,,ENST00000319432,;RN7SL111P,upstream_gene_variant,,ENST00000468841,;AC009303.1,downstream_gene_variant,,ENST00000588042,;AC009303.1,downstream_gene_variant,,ENST00000590516,;,regulatory_region_variant,,ENSR00000122209,;	-	ENSG00000125633	ENST00000376300	Transcript	5_prime_UTR_variant	25-27/6899					rs58181584	1		-1	CCDC93	HGNC	25611	protein_coding	YES	CCDS2121.2	ENSP00000365477	Q567U6		UPI0000207DEC	NM_019044.4			1/24																			MODIFIER	1	deletion														.	CTGCCG	.	.												0.2537	0.44	0.1624	0.3222	0.2084	0.1606	0.2757	0.2824	0.2973	118771682
TFCP2L1	29842	.	GRCh37	2	121989684	121989693	+	Intron	DEL	TTTTGTTTTG	TTTTGTTTTG	-	rs3835787		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTTGTTTTG	TTTTGTTTTG																c.1199-149_1199-140del			ENST00000263707		14	.	3	20	.	6	TFCP2L1,intron_variant,,ENST00000263707,NM_014553.2;TFCP2L1,intron_variant,,ENST00000464621,;	-	ENSG00000115112	ENST00000263707	Transcript	intron_variant						rs3835787	1		-1	TFCP2L1	HGNC	17925	protein_coding	YES	CCDS2134.1	ENSP00000263707	Q9NZI6	Q5JV87,Q53RS7	UPI0000072817	NM_014553.2				12/14																		MODIFIER	1	deletion														.	CTTTTTGTTTTGT	.	.																					121989683
CNTNAP5	129684	.	GRCh37	2	125394472	125394473	+	Intron	INS	-	-	CTCTGTCTCTTTTTCTCCTCTC	rs779505626		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1874-10859_1874-10858insGTCTCTTTTTCTCCTCTCCTCT			ENST00000431078		3	.	3	0	.	0	CNTNAP5,intron_variant,,ENST00000431078,NM_130773.3;	CTCTGTCTCTTTTTCTCCTCTC	ENSG00000155052	ENST00000431078	Transcript	intron_variant						rs779505626	1		1	CNTNAP5	HGNC	18748	protein_coding	YES	CCDS46401.1	ENSP00000399013	Q8WYK1		UPI0000071988	NM_130773.3				12/23																		MODIFIER	1	insertion														.	ATC	.	.																					125394472
HS6ST1	9394	.	GRCh37	2	129025599	129025600	+	3'UTR	INS	-	-	T	rs139353260		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.*136dup			ENST00000259241	2/2	4	.	4	0	.	0	HS6ST1,3_prime_UTR_variant,,ENST00000259241,NM_004807.2;HS6ST1,intron_variant,,ENST00000469019,;HS6ST1,downstream_gene_variant,,ENST00000463963,;,regulatory_region_variant,,ENSR00001626817,;	T	ENSG00000136720	ENST00000259241	Transcript	3_prime_UTR_variant	1386-1387/3932					rs139353260	1		-1	HS6ST1	HGNC	5201	protein_coding	YES	CCDS42748.1	ENSP00000259241	O60243	B4E2L3	UPI0000D61231	NM_004807.2			2/2																			MODIFIER	1	insertion													1	.	TGT	.	.																					129025599
ENSR00001190989	0	.	GRCh37	2	129320994	129321016	+	IGR	DEL	GGAGCTCCTCCAAGGCTGGAGCT	GGAGCTCCTCCAAGGCTGGAGCT	-	rs11275589		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GGAGCTCCTCCAAGGCTGGAGCT	GGAGCTCCTCCAAGGCTGGAGCT																			ENSR00001190989		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001190989,;	-		ENSR00001190989	RegulatoryFeature	regulatory_region_variant						rs11275589	1																				0.9554	0.9741		0.9663	0.9652	0.9611										MODIFIER	1	deletion														.	TGGGAGCTCCTCCAAGGCTGGAGCTG	.	.																					129320993
Unknown	0	.	GRCh37	2	132813521	132813522	+	IGR	INS	-	-	T	rs3080952		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs3080952	1																				0.1997	0.3948		0.3462	0.4583	0.3037										MODIFIER	1	insertion														.	ACT	.	.																					132813521
AC097532.2	0	.	GRCh37	2	133052507	133052508	+	5'Flank	INS	-	-	G	rs10928344		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000440802		6	.	6	0	.	0	AC097532.2,upstream_gene_variant,,ENST00000440802,;	G	ENSG00000230803	ENST00000440802	Transcript	upstream_gene_variant						rs10928344	1	557	-1	AC097532.2	Clone_based_vega_gene		lincRNA	YES																												MODIFIER	1	insertion														.	CAT	.	.																					133052507
CCNT2	905	.	GRCh37	2	135678923	135678924	+	Intron	INS	-	-	T	rs66839618		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.240+1472dup			ENST00000264157		6	.	6	0	.	0	CCNT2,intron_variant,,ENST00000264157,NM_058241.2,NM_001241.3;CCNT2,intron_variant,,ENST00000295238,;CCNT2,intron_variant,,ENST00000446247,;CCNT2,intron_variant,,ENST00000537343,;CCNT2-AS1,upstream_gene_variant,,ENST00000392929,;CCNT2-AS1,upstream_gene_variant,,ENST00000413962,;CCNT2-AS1,upstream_gene_variant,,ENST00000428857,;CCNT2-AS1,upstream_gene_variant,,ENST00000537615,;CCNT2,intron_variant,,ENST00000417175,;CCNT2,intron_variant,,ENST00000419781,;CCNT2,intron_variant,,ENST00000452839,;CCNT2,intron_variant,,ENST00000475094,;CCNT2,downstream_gene_variant,,ENST00000464932,;,regulatory_region_variant,,ENSR00000123487,;	T	ENSG00000082258	ENST00000264157	Transcript	intron_variant						rs66839618	1		1	CCNT2	HGNC	1600	protein_coding	YES	CCDS2174.1	ENSP00000264157	O60583		UPI000013E228	NM_058241.2,NM_001241.3				2/8			0.4894	0.3401		0.4871	0.327	0.3906										MODIFIER	1	insertion														.	AAT	.	.																					135678923
Unknown	0	.	GRCh37	2	138486605	138486606	+	IGR	DEL	TG	TG	-	rs67366963		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																					4	.	4	0	.	0		-				intergenic_variant						rs67366963	1																																			MODIFIER	1	deletion														.	TTTGT	.	.																					138486604
AC062021.1	0	.	GRCh37	2	140132262	140132263	+	Intron	INS	-	-	G	rs142769721		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.320-4218_320-4217insG			ENST00000429008		4	.	4	0	.	0	AC062021.1,intron_variant,,ENST00000429008,;	G	ENSG00000226939	ENST00000429008	Transcript	intron_variant,non_coding_transcript_variant						rs142769721	1		1	AC062021.1	Clone_based_vega_gene		lincRNA	YES										3/3		0.0214	0.003	0.0274			0.0636	0.0204										MODIFIER	1	insertion														.	CTC	.	.																					140132262
LRP1B	53353	.	GRCh37	2	142081564	142081565	+	Intron	INS	-	-	CACA	rs57960872		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.344-69358_344-69355dup			ENST00000389484		3	.	3	0	.	0	LRP1B,intron_variant,,ENST00000389484,NM_018557.2;LRP1B,intron_variant,,ENST00000434794,;	CACA	ENSG00000168702	ENST00000389484	Transcript	intron_variant						rs57960872	1		-1	LRP1B	HGNC	6693	protein_coding	YES	CCDS2182.1	ENSP00000374135	Q9NZR2	Q8WY27,Q8WY26,Q580W7,Q53TB8,Q53S76,Q53S73,Q53S26,Q53RL0,Q53RG4,Q53RA0,Q53QP5,Q53QM8,Q4ZG53,Q4ZFV5	UPI00001B045B	NM_018557.2				3/90																		MODIFIER	1	insertion													1	.	ATC	.	.																					142081564
ENSR00001627937	0	.	GRCh37	2	143826169	143826170	+	IGR	DEL	AC	AC	-	rs71404462		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																			ENSR00001627937		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001627937,;	-		ENSR00001627937	RegulatoryFeature	regulatory_region_variant						rs71404462	1																																			MODIFIER	1	deletion														.	ATACA	.	.																					143826168
Unknown	0	.	GRCh37	2	148138164	148138164	+	IGR	DEL	C	C	-	rs1440487068		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					3	.	3	0	.	0		-				intergenic_variant						rs1440487068	1																																			MODIFIER	1	deletion														.	TTCA	.	.																					148138163
Unknown	0	.	GRCh37	2	150767147	150767148	+	IGR	INS	-	-	A	rs5835237		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		A				intergenic_variant						rs5835237	1																				0.6006	0.7075		0.7054	0.7018	0.6268										MODIFIER	1	insertion														.	CTA	.	.																					150767147
Unknown	0	.	GRCh37	2	151810737	151810739	+	IGR	DEL	CCC	CCC	-	rs58330685		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCC	CCC																					3	.	3	0	.	0		-				intergenic_variant						rs58330685	1																																			MODIFIER	1	deletion														.	TACCCC	.	.																					151810736
Unknown	0	.	GRCh37	2	152071198	152071199	+	IGR	INS	-	-	G	rs58977967		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		G				intergenic_variant						rs58977967	1																				0.9735	0.9971		0.9395	1	0.9796										MODIFIER	1	insertion														.	GTG	.	.																					152071198
Unknown	0	.	GRCh37	2	161675376	161675377	+	IGR	INS	-	-	CT	rs34053948		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	6	2	.	0		CT				intergenic_variant						rs34053948	1																				0.9024	0.6326		0.8452	0.7893	0.8037										MODIFIER	1	insertion														.	TGC	.	.																					161675376
Unknown	0	.	GRCh37	2	161692041	161692041	+	IGR	DEL	G	G	-	rs10707100		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					3	.	3	0	.	0		-				intergenic_variant						rs10707100	1																				0.4002	0.3012		0.5248	0.4771	0.5419										MODIFIER	1	deletion														.	ATGG	.	.																					161692040
ENSR00001630138	0	.	GRCh37	2	167659770	167659770	+	IGR	DEL	T	T	-	rs35762912		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENSR00001630138		4	.	4	0	.	0	,regulatory_region_variant,,ENSR00001630138,;	-		ENSR00001630138	RegulatoryFeature	regulatory_region_variant						rs35762912	1																				0.1483	0.1196		0.1518	0.1372	0.1912										MODIFIER	1	deletion														.	ACTT	.	.																					167659769
Unknown	0	.	GRCh37	2	169190562	169190562	+	IGR	DEL	T	T	-	rs71397651		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs71397651	1																				0.6286	0.6599		0.7589	0.7594	0.7393										MODIFIER	1	deletion														.	CCTT	.	.																					169190561
ABCB11	8647	.	GRCh37	2	169884775	169884776	+	Intron	INS	-	-	A	rs141762876		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-28+2959dup			ENST00000263817		6	.	4	2	.	0	ABCB11,intron_variant,,ENST00000263817,NM_003742.2;	A	ENSG00000073734	ENST00000263817	Transcript	intron_variant						rs141762876	1		-1	ABCB11	HGNC	42	protein_coding	YES	CCDS46444.1	ENSP00000263817	O95342	Q9UIL3,Q53S60,B4DYQ0	UPI0000163BFA	NM_003742.2				1/27				0.0432			0.0974	0.0215										MODIFIER	1	insertion													1	.	TTA	.	.																					169884775
MYO3B	140469	.	GRCh37	2	171040400	171040401	+	Intron	INS	-	-	AAAAC	rs3066881		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2+5602_2+5603insAAACA			ENST00000408978		3	.	3	0	.	0	MYO3B,intron_variant,,ENST00000334231,;MYO3B,intron_variant,,ENST00000408978,NM_138995.4;MYO3B,intron_variant,,ENST00000409044,NM_001083615.3;MYO3B,intron_variant,,ENST00000484338,;MYO3B,intron_variant,,ENST00000438642,;MYO3B,intron_variant,,ENST00000317935,;MYO3B,intron_variant,,ENST00000409940,;	AAAAC	ENSG00000071909	ENST00000408978	Transcript	intron_variant						rs3066881	1		1	MYO3B	HGNC	15576	protein_coding	YES	CCDS42773.1	ENSP00000386213	Q8WXR4		UPI000020907B	NM_138995.4				1/34			0.1573	0.5432		0.5635	0.506	0.5511										MODIFIER	1	insertion														.	TTA	.	.																					171040400
METTL8	79828	.	GRCh37	2	172269237	172269237	+	Intron	DEL	A	A	-	rs536551109		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.-12-20530del			ENST00000375258		3	.	3	0	.	0	METTL8,intron_variant,,ENST00000375258,NM_024770.3;METTL8,intron_variant,,ENST00000392599,;METTL8,intron_variant,,ENST00000442541,;METTL8,intron_variant,,ENST00000442778,;METTL8,intron_variant,,ENST00000453846,;METTL8,intron_variant,,ENST00000460188,;METTL8,intron_variant,,ENST00000460539,;METTL8,intron_variant,,ENST00000462821,;METTL8,intron_variant,,ENST00000392604,;METTL8,intron_variant,,ENST00000447486,;	-	ENSG00000123600	ENST00000375258	Transcript	intron_variant						rs536551109	1		-1	METTL8	HGNC	25856	protein_coding	YES		ENSP00000364407		E7ETE0,C9JE69,C9J6U8,C9J3F1,B3KW44	UPI0000D4CA51	NM_024770.3				1/9																		MODIFIER	1	deletion														.	AGAA	.	.																					172269236
RPL21P38	0	.	GRCh37	2	172439500	172439500	+	5'Flank	DEL	C	C	-	rs59090785		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENST00000418090		6	.	6	0	.	0	RPL21P38,upstream_gene_variant,,ENST00000418090,;	-	ENSG00000233934	ENST00000418090	Transcript	upstream_gene_variant						rs59090785	1	4103	1	RPL21P38	HGNC	36349	processed_pseudogene	YES													0.4168	0.4251		0.5833	0.3012	0.4448										MODIFIER	1	deletion														.	GGCC	.	.																					172439499
PLEKHA3	65977	.	GRCh37	2	179346570	179346570	+	Intron	DEL	G	G	-	rs5836653		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.40+945del			ENST00000234453		49	.	9	49	.	0	PLEKHA3,intron_variant,,ENST00000234453,NM_019091.3;FKBP7,upstream_gene_variant,,ENST00000424785,NM_001135212.1,NM_181342.2;FKBP7,upstream_gene_variant,,ENST00000434643,;PLEKHA3,upstream_gene_variant,,ENST00000461474,;FKBP7,upstream_gene_variant,,ENST00000464248,;FKBP7,upstream_gene_variant,,ENST00000470945,;PLEKHA3,intron_variant,,ENST00000453653,;FKBP7,upstream_gene_variant,,ENST00000233092,;FKBP7,upstream_gene_variant,,ENST00000412612,;FKBP7,upstream_gene_variant,,ENST00000419184,;FKBP7,upstream_gene_variant,,ENST00000435079,;,regulatory_region_variant,,ENSR00000126975,;	-	ENSG00000116095	ENST00000234453	Transcript	intron_variant						rs5836653,COSV51845801	1		1	PLEKHA3	HGNC	14338	protein_coding	YES	CCDS33336.1	ENSP00000234453	Q9HB20		UPI000000DA8A	NM_019091.3				1/7			0.4002	0.2752		0.5685	0.2078	0.4192				0,1						MODIFIER	1	deletion			0,1											.	TTGG	.	.																					179346569
TTN	7273	.	GRCh37	2	179425272	179425272	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.85587del	p.Asn28529LysfsTer9	p.N28529Kfs*9	ENST00000589042	326/363	44	.	27	50	.	50	TTN,frameshift_variant,p.Asn28529LysfsTer9,ENST00000589042,NM_001267550.1;TTN,frameshift_variant,p.Asn26888LysfsTer9,ENST00000591111,;TTN,frameshift_variant,p.Asn25961LysfsTer9,ENST00000342992,NM_133378.4,NM_001256850.1;TTN,frameshift_variant,p.Asn19656LysfsTer9,ENST00000342175,NM_133437.3;TTN,frameshift_variant,p.Asn19589LysfsTer9,ENST00000359218,NM_133432.3;TTN,frameshift_variant,p.Asn19464LysfsTer9,ENST00000460472,NM_003319.4;TTN-AS1,intron_variant,,ENST00000419746,;TTN-AS1,intron_variant,,ENST00000438095,;TTN-AS1,intron_variant,,ENST00000456053,;TTN-AS1,intron_variant,,ENST00000585451,;TTN-AS1,intron_variant,,ENST00000586452,;TTN-AS1,intron_variant,,ENST00000586707,;TTN-AS1,intron_variant,,ENST00000586831,;TTN-AS1,intron_variant,,ENST00000590807,;TTN-AS1,intron_variant,,ENST00000590932,;TTN-AS1,intron_variant,,ENST00000591332,;TTN-AS1,intron_variant,,ENST00000592600,;TTN-AS1,intron_variant,,ENST00000592630,;TTN-AS1,intron_variant,,ENST00000592689,;TTN-AS1,intron_variant,,ENST00000592750,;	-	ENSG00000155657	ENST00000589042	Transcript	frameshift_variant	85812/109224	85587/107976	28529/35991	N/X	aaT/aa	COSV60002004	1		-1	TTN	HGNC	12403	protein_coding	YES	CCDS59435.1	ENSP00000467141	Q8WZ42	C9JQJ2,A2TKE6	UPI000264F4A1	NM_001267550.1			326/363		Gene3D:2.60.40.10,Pfam:PF00041,PROSITE_profiles:PS50853,PANTHER:PTHR13817,PANTHER:PTHR13817:SF6,SMART:SM00060,Superfamily:SSF49265											1						HIGH	1	deletion			1										1	.	TTAT	.	.																					179425271
AC080125.1	0	.	GRCh37	2	186415459	186415459	+	5'Flank	DEL	A	A	-	rs35355854		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000414888		4	.	4	0	.	0	AC080125.1,upstream_gene_variant,,ENST00000414888,;	-	ENSG00000225406	ENST00000414888	Transcript	upstream_gene_variant						rs35355854	1	2914	-1	AC080125.1	Clone_based_vega_gene		processed_pseudogene	YES													0.4395	0.6095		0.494	0.5835	0.4826										MODIFIER	1	deletion														.	AGAA	.	.																					186415458
Unknown	0	.	GRCh37	2	186450039	186450039	+	IGR	DEL	A	A	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					6	4	2	4	4	0		-				intergenic_variant							1																																			MODIFIER	1	deletion														.	CTAG	.	.																					186450038
NAB1	4664	.	GRCh37	2	191519380	191519381	+	Intron	INS	-	-	TA	rs57840299		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-196-1322_-196-1321insAT			ENST00000337386		3	.	3	0	.	0	NAB1,intron_variant,,ENST00000337386,NM_005966.3;NAB1,intron_variant,,ENST00000357215,;NAB1,intron_variant,,ENST00000409581,;NAB1,intron_variant,,ENST00000416973,;NAB1,intron_variant,,ENST00000423076,;NAB1,intron_variant,,ENST00000423376,;NAB1,intron_variant,,ENST00000426601,;NAB1,intron_variant,,ENST00000448811,;NAB1,upstream_gene_variant,,ENST00000409641,;	TA	ENSG00000138386	ENST00000337386	Transcript	intron_variant						rs57840299	1		1	NAB1	HGNC	7626	protein_coding	YES	CCDS2307.1	ENSP00000336894	Q13506	C9JL92,C9JJ42,C9JID4,C9JFF6,C9J3V0	UPI0000001C43	NM_005966.3				2/9			0.6687	0.9179		0.998	0.9513	0.9243										MODIFIER	1	insertion														.	TCT	.	.																					191519380
Unknown	0	.	GRCh37	2	193208651	193208652	+	IGR	INS	-	-	TT	rs33954683		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TT				intergenic_variant						rs33954683	1																				0.4319	0.9323		0.995	0.9712	0.9744										MODIFIER	1	insertion														.	AAT	.	.																					193208651
Unknown	0	.	GRCh37	2	195006035	195006036	+	IGR	DEL	TG	TG	-	rs3071078		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																					3	.	3	0	.	0		-				intergenic_variant						rs3071078	1																				0.6248	0.7248		0.9087	0.7068	0.7168										MODIFIER	1	deletion														.	TTTGT	.	.																					195006034
Unknown	0	.	GRCh37	2	196288946	196288946	+	IGR	DEL	T	T	-	rs11313909		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	4	0	.	0		-				intergenic_variant						rs11313909	1																				0.8419	0.889		0.8879	0.9871	0.9571										MODIFIER	1	deletion														.	CATT	.	.																					196288945
ANKRD44	91526	.	GRCh37	2	197973566	197973571	+	Intron	DEL	AACAAC	AACAAC	-	rs138617040		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AACAAC	AACAAC																c.985+1919_985+1924del			ENST00000409919		4	.	4	0	.	0	ANKRD44,intron_variant,,ENST00000282272,NM_001195144.1;ANKRD44,intron_variant,,ENST00000328737,;ANKRD44,intron_variant,,ENST00000337207,;ANKRD44,intron_variant,,ENST00000409153,;ANKRD44,intron_variant,,ENST00000409919,NM_153697.2;ANKRD44,intron_variant,,ENST00000422886,;ANKRD44,intron_variant,,ENST00000424317,;ANKRD44,intron_variant,,ENST00000450567,;ANKRD44,intron_variant,,ENST00000539527,;ANKRD44,intron_variant,,ENST00000473081,;,regulatory_region_variant,,ENSR00001204136,;	-	ENSG00000065413	ENST00000409919	Transcript	intron_variant						rs138617040	1		-1	ANKRD44	HGNC	25259	protein_coding	YES	CCDS33355.2	ENSP00000387233	Q8N8A2	C9JY51	UPI000004FDEC	NM_153697.2				9/9			0.73	0.951		0.9871	0.9622	0.9622										MODIFIER	1	deletion														.	AAAACAACA	.	.																					197973565
Unknown	0	.	GRCh37	2	200413298	200413299	+	IGR	INS	-	-	C	rs201700718		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		C				intergenic_variant						rs201700718	1																				0.0083	0.0245			0.0239	0.0031										MODIFIER	1	insertion														.	CAC	.	.																					200413298
AC079354.1	100652824	.	GRCh37	2	202969851	202969851	+	Intron	DEL	G	G	-	rs35737687		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.1325-630del			ENST00000541917		6	.	6	3	.	0	AC079354.1,intron_variant,,ENST00000295844,;AC079354.1,intron_variant,,ENST00000498697,;AC079354.1,intron_variant,,ENST00000541917,;AC079354.1,intron_variant,,ENST00000409515,;AC079354.1,intron_variant,,ENST00000459709,;	-	ENSG00000182329	ENST00000541917	Transcript	intron_variant						rs35737687	1		1	AC079354.1	Clone_based_vega_gene		protein_coding	YES		ENSP00000437957		F5H626	UPI00020659C3					8/14			0.031	0.3242		0.1181	0.3638	0.316										MODIFIER	1	deletion														.	AAGG	.	.																					202969850
Unknown	0	.	GRCh37	2	205028973	205028974	+	IGR	INS	-	-	GAAAT	rs58321186		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		GAAAT				intergenic_variant						rs58321186	1																				0.8457	0.8386		0.7718	0.9135	0.6442										MODIFIER	1	insertion														.	AGG	.	.																					205028973
ENSR00001634091	0	.	GRCh37	2	206826212	206826212	+	IGR	DEL	C	C	-	rs146425845		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENSR00001634091		4	.	4	0	.	0	,regulatory_region_variant,,ENSR00001634091,;	-		ENSR00001634091	RegulatoryFeature	regulatory_region_variant						rs146425845	1																				0.0862	0.1542		0.3948	0.1511	0.3906										MODIFIER	1	deletion														.	TGCC	.	.																					206826211
snoU13	0	.	GRCh37	2	208934791	208934791	+	3'Flank	DEL	T	T	-	rs11322544		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000459385		3	.	3	0	.	0	snoU13,downstream_gene_variant,,ENST00000459385,;	-	ENSG00000238582	ENST00000459385	Transcript	downstream_gene_variant						rs11322544	1	3994	-1	snoU13	RFAM		snoRNA	YES													0.2943	0.696		0.7212	0.5934	0.6861										MODIFIER	1	deletion														.	ACTT	.	.																					208934790
PTH2R	5746	.	GRCh37	2	209696259	209696259	+	Intron	DEL	A	A	-	rs61284288		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.*532+7198del			ENST00000419079		3	.	3	0	.	0	PTH2R,intron_variant,,ENST00000419079,;	-	ENSG00000144407	ENST00000419079	Transcript	intron_variant,NMD_transcript_variant						rs61284288	1		1	PTH2R	HGNC	9609	nonsense_mediated_decay			ENSP00000393930			UPI000198C666					6/6			0.9107	0.7406		0.4881	0.7416	0.772										MODIFIER	1	deletion														.	TTAA	.	.																					209696258
AC010887.1	0	.	GRCh37	2	218036819	218036819	+	5'Flank	DEL	G	G	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																			ENST00000516040		6	4	2	4	4	0	AC010887.1,upstream_gene_variant,,ENST00000516040,;	-	ENSG00000251849	ENST00000516040	Transcript	upstream_gene_variant							1	4402	1	AC010887.1	Clone_based_ensembl_gene		miRNA	YES																												MODIFIER	1	deletion														.	CTGC	.	.																					218036818
Unknown	0	.	GRCh37	2	220664192	220664193	+	IGR	INS	-	-	C	rs60053437		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		C				intergenic_variant						rs60053437	1																				0.9992	1		1	1	0.999										MODIFIER	1	insertion														.	CTC	.	.																					220664192
EPHA4	2043	.	GRCh37	2	222343539	222343539	+	Intron	DEL	A	A	-	rs3835965		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1318+3533del			ENST00000281821		6	4	2	4	4	0	EPHA4,intron_variant,,ENST00000281821,NM_004438.3;EPHA4,intron_variant,,ENST00000392071,;EPHA4,intron_variant,,ENST00000409854,;EPHA4,intron_variant,,ENST00000409938,;EPHA4,intron_variant,,ENST00000441679,;EPHA4,intron_variant,,ENST00000443796,;EPHA4,downstream_gene_variant,,ENST00000463446,;,regulatory_region_variant,,ENSR00001209087,;,regulatory_region_variant,,ENSR00001635676,;	-	ENSG00000116106	ENST00000281821	Transcript	intron_variant						rs3835965	1		-1	EPHA4	HGNC	3388	protein_coding	YES	CCDS2447.1	ENSP00000281821	P54764	Q584H6,Q53TA0,F5GZZ5,E9PG71,C9JIX8,C9JEM6	UPI000012A077	NM_004438.3				5/17		0.4167	0.3956	0.3732		0.5357	0.3996	0.3712										MODIFIER	1	deletion													1	.	CCAG	.	.																					222343538
PID1	55022	.	GRCh37	2	229958485	229958485	+	Intron	DEL	G	G	-	rs34755349		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.270+62049del			ENST00000392054		3	.	3	0	.	0	PID1,intron_variant,,ENST00000354069,;PID1,intron_variant,,ENST00000392054,NM_017933.4;PID1,intron_variant,,ENST00000392055,NM_001100818.1;PID1,intron_variant,,ENST00000409462,;PID1,intron_variant,,ENST00000482518,;PID1,intron_variant,,ENST00000534952,;	-	ENSG00000153823	ENST00000392054	Transcript	intron_variant						rs34755349,COSV62473135	1		-1	PID1	HGNC	26084	protein_coding	YES	CCDS2471.1	ENSP00000375907	Q7Z2X4	Q4ZG81	UPI00001C0AF7	NM_017933.4				3/3		0.5921	0.2602	0.611		0.6796	0.7694	0.7546				0,1						MODIFIER	1	deletion			0,1											.	AAGA	.	.																					229958484
SP140L	93349	.	GRCh37	2	231239031	231239031	+	Intron	DEL	A	A	-	rs35573735		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.637+2679del			ENST00000415673		3	.	3	0	.	0	SP140L,intron_variant,,ENST00000243810,;SP140L,intron_variant,,ENST00000396563,;SP140L,intron_variant,,ENST00000415673,NM_138402.4;SP140L,intron_variant,,ENST00000444636,;SP140L,downstream_gene_variant,,ENST00000458341,;SP140L,intron_variant,,ENST00000483728,;	-	ENSG00000185404	ENST00000415673	Transcript	intron_variant						rs35573735	1		1	SP140L	HGNC	25105	protein_coding	YES	CCDS46538.1	ENSP00000397911	Q9H930		UPI000020974D	NM_138402.4				7/18																		MODIFIER	1	deletion														.	TCAA	.	.																					231239030
COX20P2	0	.	GRCh37	2	231824383	231824383	+	3'Flank	DEL	T	T	-	rs35915113		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000452636		3	.	3	0	.	0	GPR55,intron_variant,,ENST00000392039,;COX20P2,downstream_gene_variant,,ENST00000452636,;	-	ENSG00000235013	ENST00000452636	Transcript	downstream_gene_variant						rs35915113	1	1718	1	COX20P2	HGNC	43772	processed_pseudogene	YES																												MODIFIER	1	deletion														.	TATT	.	.																					231824382
Unknown	0	.	GRCh37	2	233363352	233363353	+	IGR	INS	-	-	CATCATCATCATCATCAT	rs61676235		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		CATCATCATCATCATCAT				intergenic_variant						rs61676235	1																																			MODIFIER	1	insertion														.	TCC	.	.																					233363352
ENSR00001637121	0	.	GRCh37	2	235453245	235453328	+	IGR	DEL	GGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGGAAGGAGAGAGGGAGAGAGGGAGGAAGGAAGGAA	GGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGGAAGGAGAGAGGGAGAGAGGGAGGAAGGAAGGAA	-	rs1559308472		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGGAAGGAGAGAGGGAGAGAGGGAGGAAGGAAGGAA	GGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGGAAGGAGAGAGGGAGAGAGGGAGGAAGGAAGGAA																			ENSR00001637121		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001637121,;	-		ENSR00001637121	RegulatoryFeature	regulatory_region_variant						rs1559308472	1																																			MODIFIER	1	deletion														.	AGGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGGAAGGAGAGAGGGAGAGAGGGAGGAAGGAAGGAAG	.	.																					235453244
Unknown	0	.	GRCh37	2	236175109	236175110	+	IGR	INS	-	-	TGAAAGGGAATGATGAATAGCGAGTGTCAGACATGCACATTGGCCACC	rs1553598589		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TGAAAGGGAATGATGAATAGCGAGTGTCAGACATGCACATTGGCCACC				intergenic_variant						rs1553598589	1																																			MODIFIER	1	insertion														.	GGT	.	.																					236175109
NDUFA10	4705	.	GRCh37	2	240852484	240852485	+	Intron	INS	-	-	A	rs34313648		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.295-17754_295-17753insT			ENST00000419408		5	.	3	4	.	0	NDUFA10,intron_variant,,ENST00000419408,;,regulatory_region_variant,,ENSR00001637886,;	A	ENSG00000130414	ENST00000419408	Transcript	intron_variant						rs34313648	1		-1	NDUFA10	HGNC	7684	protein_coding			ENSP00000408055		H7C2W5	UPI000173A5FD					4/5		0.1815	0.329	0.134		0.0734	0.1491	0.1605										MODIFIER	1	insertion													1	.	GGC	.	.																					240852484
KIF1A	547	.	GRCh37	2	241726174	241726174	+	Intron	DEL	A	A	-	rs138509440		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.430-244del			ENST00000498729		6	2	4	4	4	0	KIF1A,intron_variant,,ENST00000320389,NM_004321.6;KIF1A,intron_variant,,ENST00000404283,;KIF1A,intron_variant,,ENST00000498729,NM_001244008.1;KIF1A,upstream_gene_variant,,ENST00000428768,;KIF1A,downstream_gene_variant,,ENST00000448728,;	-	ENSG00000130294	ENST00000498729	Transcript	intron_variant						rs138509440,COSV57487541	1		-1	KIF1A	HGNC	888	protein_coding	YES	CCDS58757.1	ENSP00000438388	Q12756	G1UI30,C9JBH1	UPI0002065B81	NM_001244008.1				5/49												0,1						MODIFIER	1	deletion			0,1										1	.	AGAG	.	.																					241726173
AC093642.5	728323	.	GRCh37	2	243056967	243056967	+	Intron	DEL	T	T	-	rs879228101		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																n.413+76del			ENST00000456398		18	.	3	14	.	0	AC093642.5,intron_variant,,ENST00000403324,;AC093642.5,intron_variant,,ENST00000431796,;AC093642.5,intron_variant,,ENST00000442213,;AC093642.5,intron_variant,,ENST00000456398,;AC093642.5,intron_variant,,ENST00000444990,;AC093642.5,intron_variant,,ENST00000416103,;AC093642.5,intron_variant,,ENST00000453598,;	-	ENSG00000220804	ENST00000456398	Transcript	intron_variant,non_coding_transcript_variant						rs879228101	1		1	AC093642.5	Clone_based_vega_gene		processed_transcript	YES										3/7																		MODIFIER	1	deletion														.	TCTT	.	.																					243056966
AC090044.1	101927215	.	GRCh37	3	891600	891600	+	3'Flank	DEL	G	G	-	rs34025936		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																			ENST00000420823		3	.	3	0	.	0	AC090044.1,downstream_gene_variant,,ENST00000420823,;	-	ENSG00000224957	ENST00000420823	Transcript	downstream_gene_variant						rs34025936	1	3902	1	AC090044.1	Clone_based_vega_gene		lincRNA	YES													0.1248	0.2968		0.3234	0.1859	0.089										MODIFIER	1	deletion														.	TTGG	.	.																					891599
Unknown	0	.	GRCh37	3	1603496	1603500	+	IGR	DEL	TTTTT	TTTTT	-	rs59704285		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTTT	TTTTT																					3	.	3	0	.	0		-				intergenic_variant						rs59704285	1																				0.9569	0.9697		0.9841	0.9602	0.955										MODIFIER	1	deletion														.	ACTTTTTT	.	.																					1603495
CNTN4	152330	.	GRCh37	3	2563497	2563498	+	Intron	INS	-	-	GAT	rs146802640		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-88-49600_-88-49598dup			ENST00000397461		4	.	4	0	.	0	CNTN4,intron_variant,,ENST00000397461,NM_001206955.1;CNTN4,intron_variant,,ENST00000418658,NM_175607.2;CNTN4,intron_variant,,ENST00000422330,;CNTN4,intron_variant,,ENST00000434053,;CNTN4,intron_variant,,ENST00000455083,;CNTN4,intron_variant,,ENST00000427741,;CNTN4,intron_variant,,ENST00000430505,;CNTN4,intron_variant,,ENST00000438282,;	GAT	ENSG00000144619	ENST00000397461	Transcript	intron_variant						rs146802640	1		1	CNTN4	HGNC	2174	protein_coding	YES	CCDS43041.1	ENSP00000380602	Q8IWV2	G3XAD4,C9JMQ2,C9JGK9	UPI000007446C	NM_001206955.1				2/23				0.0072			0.0229	0.0031										MODIFIER	1	insertion														.	TAG	.	.																					2563497
Unknown	0	.	GRCh37	3	5657817	5657820	+	IGR	DEL	TCAT	TCAT	-	rs60971344		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCAT	TCAT																					3	.	3	0	.	0		-				intergenic_variant						rs60971344	1																				0.5091	0.7176		0.7748	0.6282	0.6196										MODIFIER	1	deletion														.	AATCATT	.	.																					5657816
AC027119.1	0	.	GRCh37	3	6137452	6137464	+	Intron	DEL	TAGAGTTCTCTCT	TAGAGTTCTCTCT	-	rs58964339		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAGAGTTCTCTCT	TAGAGTTCTCTCT																n.323-28207_323-28195del			ENST00000425894		3	.	3	0	.	0	AC027119.1,intron_variant,,ENST00000425894,;	-	ENSG00000229642	ENST00000425894	Transcript	intron_variant,non_coding_transcript_variant						rs58964339	1		1	AC027119.1	Clone_based_vega_gene		lincRNA	YES										2/2																		MODIFIER	1	deletion														.	TCTAGAGTTCTCTCTT	.	.																					6137451
GRM7	2917	.	GRCh37	3	6962243	6962244	+	Intron	DEL	AA	AA	-	rs35421703		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																c.519+58662_519+58663del			ENST00000357716		3	.	3	0	.	0	GRM7,intron_variant,,ENST00000357716,NM_000844.3;GRM7,intron_variant,,ENST00000389336,;GRM7,intron_variant,,ENST00000402647,;GRM7,intron_variant,,ENST00000403881,;GRM7,intron_variant,,ENST00000448328,;GRM7,intron_variant,,ENST00000486284,NM_181874.2;GRM7,intron_variant,,ENST00000389335,;GRM7,intron_variant,,ENST00000435689,;GRM7,intron_variant,,ENST00000440923,;GRM7,intron_variant,,ENST00000443259,;GRM7,intron_variant,,ENST00000467425,;	-	ENSG00000196277	ENST00000357716	Transcript	intron_variant						rs35421703	1		1	GRM7	HGNC	4599	protein_coding	YES	CCDS43042.1	ENSP00000350348	Q14831	C9JU97	UPI000004A7E3	NM_000844.3				1/9																		MODIFIER	1	deletion														.	TCAAA	.	.																					6962242
VGLL4	9686	.	GRCh37	3	11742837	11742837	+	Intron	DEL	A	A	-	rs34493914		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.64+1608del			ENST00000273038		5	.	5	0	.	0	VGLL4,intron_variant,,ENST00000273038,NM_014667.2;VGLL4,intron_variant,,ENST00000404339,NM_001284390.1;VGLL4,intron_variant,,ENST00000417206,;VGLL4,intron_variant,,ENST00000418000,;VGLL4,intron_variant,,ENST00000419541,;VGLL4,intron_variant,,ENST00000445411,;VGLL4,intron_variant,,ENST00000463387,;VGLL4,intron_variant,,ENST00000417466,;VGLL4,intron_variant,,ENST00000426568,;	-	ENSG00000144560	ENST00000273038	Transcript	intron_variant						rs34493914	1		-1	VGLL4	HGNC	28966	protein_coding		CCDS2606.1	ENSP00000273038	Q14135	Q0H0I7,G5E9M9,E7EWF5,E7EUJ2,E7EQU6,C9JX59,C9JBN2	UPI000013FB7A	NM_014667.2				2/5		0.3688	0.2791	0.3905		0.3046	0.5219	0.3834										MODIFIER		deletion														.	AGAC	.	.																					11742836
TAMM41	132001	.	GRCh37	3	11872180	11872181	+	Intron	INS	-	-	A	rs1331894879		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.412-843dup			ENST00000273037		4	.	4	0	.	0	TAMM41,intron_variant,,ENST00000273037,NM_138807.2;TAMM41,intron_variant,,ENST00000444133,;TAMM41,intron_variant,,ENST00000455809,NM_001284401.1;TAMM41,intron_variant,,ENST00000411947,;TAMM41,intron_variant,,ENST00000457498,;TAMM41,downstream_gene_variant,,ENST00000417723,;TAMM41,upstream_gene_variant,,ENST00000460246,;	A	ENSG00000144559	ENST00000273037	Transcript	intron_variant						rs1331894879	1		-1	TAMM41	HGNC	25187	protein_coding	YES	CCDS2607.1	ENSP00000273037	Q96BW9		UPI0000070263	NM_138807.2				3/6																		MODIFIER	1	insertion														.	ACA	.	.																					11872180
CCDC174	51244	.	GRCh37	3	14703402	14703410	+	Intron	DEL	ATAATTACA	ATAATTACA	-	rs55915506		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATAATTACA	ATAATTACA																c.485+206_485+214del			ENST00000383794		3	.	3	0	.	0	CCDC174,intron_variant,,ENST00000303688,;CCDC174,intron_variant,,ENST00000383794,NM_016474.4;CCDC174,non_coding_transcript_exon_variant,,ENST00000463438,;CCDC174,intron_variant,,ENST00000465759,;	-	ENSG00000154781	ENST00000383794	Transcript	intron_variant						rs55915506	1		1	CCDC174	HGNC	28033	protein_coding	YES	CCDS2620.2	ENSP00000373304	Q6PII3		UPI00004120DD	NM_016474.4				5/10			0.1029	0.3746		0.4593	0.5547	0.6605										MODIFIER	1	deletion													1	.	ACATAATTACAA	.	.																					14703401
Unknown	0	.	GRCh37	3	16088099	16088101	+	IGR	DEL	TGC	TGC	-	rs66961708		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGC	TGC																					3	.	3	0	.	0		-				intergenic_variant						rs66961708	1																																			MODIFIER	1	deletion														.	GGTGCT	.	.																					16088098
DAZL	1618	.	GRCh37	3	16640700	16640702	+	Intron	DEL	AAC	AAC	-	rs151248271		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAC	AAC																c.64-597_64-595del			ENST00000250863		5	.	5	0	.	0	DAZL,intron_variant,,ENST00000250863,NM_001190811.1;DAZL,intron_variant,,ENST00000399444,NM_001351.3;DAZL,intron_variant,,ENST00000454457,;	-	ENSG00000092345	ENST00000250863	Transcript	intron_variant						rs151248271	1		-1	DAZL	HGNC	2685	protein_coding	YES	CCDS54556.1	ENSP00000250863	Q92904		UPI0000412129	NM_001190811.1				1/10			0.0514	0.2392		0.4742	0.1014	0.184										MODIFIER	1	deletion														.	AAAACA	.	.																					16640699
AC023798.1	0	.	GRCh37	3	21876261	21876262	+	3'Flank	INS	-	-	TGGATCT	rs3073148		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000408457		3	.	3	0	.	0	AC023798.1,downstream_gene_variant,,ENST00000408457,;ZNF385D,intron_variant,,ENST00000494108,;ZNF385D,intron_variant,,ENST00000494118,;,regulatory_region_variant,,ENSR00001655591,;	TGGATCT	ENSG00000221384	ENST00000408457	Transcript	downstream_gene_variant						rs3073148	1	4932	1	AC023798.1	Clone_based_ensembl_gene		miRNA	YES													0.8464	0.7392		0.7907	0.826	0.8037										MODIFIER	1	insertion														.	AAT	.	.																					21876261
Unknown	0	.	GRCh37	3	22491376	22491377	+	IGR	INS	-	-	A	rs35818672		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	3	.	0		A				intergenic_variant						rs35818672	1																				0.8578	0.3343		0.5625	0.4056	0.3303										MODIFIER	1	insertion														.	ATA	.	.																					22491376
Unknown	0	.	GRCh37	3	23049233	23049234	+	IGR	INS	-	-	ATTT	rs5847213		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		ATTT				intergenic_variant						rs5847213	1																				0.2738	0.2507		0.4097	0.3628	0.2055										MODIFIER	1	insertion														.	ACA	.	.																					23049233
AC133680.1	0	.	GRCh37	3	25004909	25004911	+	Intron	DEL	TTG	TTG	-	rs34215998		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTG	TTG																n.346-96703_346-96701del			ENST00000455576		3	.	3	0	.	0	AC133680.1,intron_variant,,ENST00000455576,;	-	ENSG00000237838	ENST00000455576	Transcript	intron_variant,non_coding_transcript_variant						rs34215998	1		1	AC133680.1	Clone_based_vega_gene		lincRNA	YES										4/5																		MODIFIER	1	deletion														.	CCTTGT	.	.																					25004908
ZCWPW2	152098	.	GRCh37	3	28397829	28397830	+	Intron	DEL	AT	AT	-	rs144403273		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																c.-134+7136_-134+7137del			ENST00000383768		3	.	3	0	.	0	ZCWPW2,intron_variant,,ENST00000383768,;ZCWPW2,intron_variant,,ENST00000420223,;	-	ENSG00000206559	ENST00000383768	Transcript	intron_variant						rs144403273	1		1	ZCWPW2	HGNC	23574	protein_coding	YES	CCDS33723.1	ENSP00000373278	Q504Y3	C9JFK0	UPI0000161ABF					1/9			0.4115	0.5288		0.1796	0.5169	0.2975										MODIFIER	1	deletion														.	AAATA	.	.																					28397828
GADL1	339896	.	GRCh37	3	30842299	30842308	+	Intron	DEL	ACACACACAC	ACACACACAC	-	rs35529398		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACACACAC	ACACACACAC																c.1250+73_1250+82del			ENST00000282538		3	.	3	0	.	0	GADL1,3_prime_UTR_variant,,ENST00000454381,;GADL1,intron_variant,,ENST00000282538,NM_207359.2;	-	ENSG00000144644	ENST00000282538	Transcript	intron_variant						rs35529398	1		-1	GADL1	HGNC	27949	protein_coding	YES	CCDS2649.2	ENSP00000282538	Q6ZQY3		UPI000022BF90	NM_207359.2				12/14																		MODIFIER	1	deletion														.	AGACACACACACA	.	.																					30842298
AC104308.2	0	.	GRCh37	3	35912146	35912147	+	5'Flank	INS	-	-	T	rs34091172		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000454621		3	.	3	0	.	0	AC104308.2,upstream_gene_variant,,ENST00000454621,;	T	ENSG00000226489	ENST00000454621	Transcript	upstream_gene_variant						rs34091172	1	1211	1	AC104308.2	Clone_based_vega_gene		processed_pseudogene	YES													0.5325	0.1787		0.0248	0.2545	0.135										MODIFIER	1	insertion														.	GAT	.	.																					35912146
Unknown	0	.	GRCh37	3	40784545	40784545	+	IGR	DEL	C	C	-	rs34681741		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					6	.	6	3	.	0		-				intergenic_variant						rs34681741	1																				0.0257	0.3746		0.4931	0.326	0.5174										MODIFIER	1	deletion														.	CTCC	.	.																					40784544
Unknown	0	.	GRCh37	3	45401697	45401697	+	IGR	DEL	T	T	-	rs60641963		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs60641963	1																																			MODIFIER	1	deletion														.	CATT	.	.																					45401696
KIF9	64147	.	GRCh37	3	47272536	47272537	+	Intron	INS	-	-	T	rs143983005		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2323-2345_2323-2344insA			ENST00000335044		3	.	3	0	.	0	KIF9,intron_variant,,ENST00000265529,;KIF9,intron_variant,,ENST00000335044,NM_001134878.1,NM_182902.3;KIF9,intron_variant,,ENST00000444589,NM_022342.4;KIF9,intron_variant,,ENST00000452770,;KIF9,downstream_gene_variant,,ENST00000352910,;KIF9-AS1,intron_variant,,ENST00000429315,;	T	ENSG00000088727	ENST00000335044	Transcript	intron_variant						rs143983005	1		-1	KIF9	HGNC	16666	protein_coding	YES	CCDS2752.1	ENSP00000333942	Q9HAQ2		UPI000012DE55	NM_001134878.1,NM_182902.3				20/20		0.1695	0.0166	0.1599		0.3175	0.1501	0.2505										MODIFIER	1	insertion														.	AAA	.	.																					47272536
KLHL18	23276	.	GRCh37	3	47358134	47358135	+	Intron	DEL	TG	TG	-	rs71098474		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																c.130-3002_130-3001del			ENST00000232766		8	4	4	6	6	0	KLHL18,intron_variant,,ENST00000232766,NM_025010.4;KLHL18,intron_variant,,ENST00000437353,;KLHL18,intron_variant,,ENST00000455924,;KLHL18,intron_variant,,ENST00000433449,;KLHL18,intron_variant,,ENST00000442272,;KLHL18,intron_variant,,ENST00000461084,;,regulatory_region_variant,,ENSR00001658401,;	-	ENSG00000114648	ENST00000232766	Transcript	intron_variant						rs71098474	1		1	KLHL18	HGNC	29120	protein_coding	YES	CCDS33749.1	ENSP00000232766	O94889	Q6PJF0,C9J4G4,B4DHW4	UPI00004703A5	NM_025010.4				1/9																		MODIFIER	1	deletion														.	TATGT	.	.																					47358133
DHX30	22907	.	GRCh37	3	47878589	47878590	+	Intron	INS	-	-	GAGGCTTATGCTT	rs11270376		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.367-3769_367-3768insGCTTGAGGCTTAT			ENST00000445061		3	.	3	0	.	0	DHX30,intron_variant,,ENST00000348968,;DHX30,intron_variant,,ENST00000445061,NM_138615.2;DHX30,intron_variant,,ENST00000446256,NM_014966.3;DHX30,intron_variant,,ENST00000457607,;DHX30,intron_variant,,ENST00000395745,;DHX30,intron_variant,,ENST00000441384,;	GAGGCTTATGCTT	ENSG00000132153	ENST00000445061	Transcript	intron_variant						rs11270376	1		1	DHX30	HGNC	16716	protein_coding	YES	CCDS2759.1	ENSP00000405620	Q7L2E3	H7BXY3	UPI000007112B	NM_138615.2				6/21			0.3676	0.5865		0.7063	0.6839	0.5613										MODIFIER	1	insertion													1	.	AAG	.	.																					47878589
PRKAR2A	5576	.	GRCh37	3	48794052	48794052	+	Intron	DEL	A	A	-	rs562679450		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.874-175del			ENST00000265563		11	.	3	10	.	0	PRKAR2A,intron_variant,,ENST00000265563,NM_004157.2;PRKAR2A,intron_variant,,ENST00000296446,;PRKAR2A,intron_variant,,ENST00000437821,;PRKAR2A,intron_variant,,ENST00000438535,;PRKAR2A,intron_variant,,ENST00000454963,;PRKAR2A,upstream_gene_variant,,ENST00000457914,;	-	ENSG00000114302	ENST00000265563	Transcript	intron_variant						rs562679450	1		-1	PRKAR2A	HGNC	9391	protein_coding	YES	CCDS2778.1	ENSP00000265563	P13861		UPI0000161B64	NM_004157.2				8/10																		MODIFIER	1	deletion														.	GGAA	.	.																					48794051
PRKAR2A	5576	.	GRCh37	3	48811940	48811940	+	Intron	DEL	A	A	-	rs113619599		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.543-1399del			ENST00000265563		3	.	3	0	.	0	PRKAR2A,intron_variant,,ENST00000265563,NM_004157.2;PRKAR2A,intron_variant,,ENST00000296446,;PRKAR2A,intron_variant,,ENST00000437821,;PRKAR2A,intron_variant,,ENST00000454963,;	-	ENSG00000114302	ENST00000265563	Transcript	intron_variant						rs113619599	1		-1	PRKAR2A	HGNC	9391	protein_coding	YES	CCDS2778.1	ENSP00000265563	P13861		UPI0000161B64	NM_004157.2				5/10																		MODIFIER	1	deletion														.	GGAA	.	.																					48811939
RBM6	10180	.	GRCh37	3	50108948	50108949	+	Intron	INS	-	-	AGTC	rs55914752		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.3116+964_3116+967dup			ENST00000266022		6	.	3	3	.	0	RBM6,intron_variant,,ENST00000266022,NM_005777.2;RBM6,intron_variant,,ENST00000421682,;RBM6,intron_variant,,ENST00000422955,;RBM6,intron_variant,,ENST00000442092,NM_001167582.1;RBM6,intron_variant,,ENST00000443081,;RBM6,intron_variant,,ENST00000539992,;RBM6,intron_variant,,ENST00000419610,;RBM6,intron_variant,,ENST00000434592,;RBM6,intron_variant,,ENST00000454079,;	AGTC	ENSG00000004534	ENST00000266022	Transcript	intron_variant						rs55914752	1		1	RBM6	HGNC	9903	protein_coding	YES	CCDS2809.1	ENSP00000266022	P78332	E9PGM9,C9JSL1,C9JMC8,C9JII0,B4DNY1	UPI000013D6C0	NM_005777.2				19/20			0.236	0.2017		0.0149	0.2565	0.0501										MODIFIER	1	insertion														.	TGA	.	.																					50108948
ITIH4	3700	.	GRCh37	3	52866086	52866086	+	5'Flank	DEL	T	T	-	rs34438387		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000266041		3	.	3	0	.	0	ITIH4,upstream_gene_variant,,ENST00000266041,NM_002218.4;ITIH4,upstream_gene_variant,,ENST00000346281,NM_001166449.1;TMEM110,downstream_gene_variant,,ENST00000355083,NM_198563.2;ITIH4,upstream_gene_variant,,ENST00000406595,;ITIH4,upstream_gene_variant,,ENST00000434759,;MUSTN1,downstream_gene_variant,,ENST00000446157,NM_205853.3;TMEM110,downstream_gene_variant,,ENST00000482155,;ITIH4,upstream_gene_variant,,ENST00000485816,;MUSTN1,downstream_gene_variant,,ENST00000486659,;TMEM110-MUSTN1,downstream_gene_variant,,ENST00000504329,NM_001198974.2;TMEM110-MUSTN1,downstream_gene_variant,,ENST00000514466,;RP5-966M1.6,intron_variant,,ENST00000513520,;RP5-966M1.6,intron_variant,,ENST00000468472,;ITIH4,upstream_gene_variant,,ENST00000473904,;ITIH4,upstream_gene_variant,,ENST00000491663,;TMEM110-MUSTN1,downstream_gene_variant,,ENST00000495552,;ITIH4,upstream_gene_variant,,ENST00000537897,;,regulatory_region_variant,,ENSR00000396030,;	-	ENSG00000055955	ENST00000266041	Transcript	upstream_gene_variant						rs34438387	1	1331	-1	ITIH4	HGNC	6169	protein_coding	YES	CCDS2865.1	ENSP00000266041	Q14624		UPI000013D6C3	NM_002218.4																						MODIFIER	1	deletion														.	CCTT	.	.																					52866085
FAM208A	23272	.	GRCh37	3	56694518	56694519	+	Intron	DEL	AA	AA	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																c.1368+240_1368+241del			ENST00000493960		8	.	3	8	.	0	FAM208A,intron_variant,,ENST00000355628,;FAM208A,intron_variant,,ENST00000431842,NM_015224.3;FAM208A,intron_variant,,ENST00000493960,NM_001112736.1;FAM208A,downstream_gene_variant,,ENST00000478052,;	-	ENSG00000163946	ENST00000493960	Transcript	intron_variant							1		-1	FAM208A	HGNC	30314	protein_coding	YES	CCDS46853.1	ENSP00000417509	Q9UK61		UPI0000422561	NM_001112736.1				11/23																		MODIFIER	1	deletion														.	TCAAA	.	.																					56694517
PDHB	5162	.	GRCh37	3	58416770	58416771	+	Intron	INS	-	TTA	TTA	rs34834843		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.304-102_304-101insTAA			ENST00000302746		3	.	0	4	.	4	PDHB,intron_variant,,ENST00000302746,NM_000925.3,NM_001173468.1;PDHB,intron_variant,,ENST00000383714,;PDHB,intron_variant,,ENST00000474765,;PDHB,intron_variant,,ENST00000485460,;RP11-802O23.3,downstream_gene_variant,,ENST00000607214,;PDHB,non_coding_transcript_exon_variant,,ENST00000479945,;PDHB,intron_variant,,ENST00000461692,;PDHB,intron_variant,,ENST00000469364,;PDHB,intron_variant,,ENST00000480626,;PDHB,downstream_gene_variant,,ENST00000469827,;PDHB,downstream_gene_variant,,ENST00000482894,;	TTA	ENSG00000168291	ENST00000302746	Transcript	intron_variant						rs34834843	1		-1	PDHB	HGNC	8808	protein_coding	YES	CCDS2890.1	ENSP00000307241	P11177		UPI000013E81D	NM_000925.3,NM_001173468.1				5/9			0.1989	0.2839		0.001	0.3757	0.1708										MODIFIER	1	insertion													1	.	ATT	.	.																					58416770
Unknown	0	.	GRCh37	3	59237401	59237402	+	IGR	INS	-	-	GT	rs113763541		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		GT				intergenic_variant						rs113763541	1																				0.4811	0.6873		0.4663	0.668	0.5787										MODIFIER	1	insertion														.	ACG	.	.																					59237401
C3orf14	57415	.	GRCh37	3	62318806	62318807	+	Intron	DEL	TG	TG	-	rs113412493		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																c.253-105_253-104del			ENST00000494481		18	.	3	23	.	0	C3orf14,intron_variant,,ENST00000232519,;C3orf14,intron_variant,,ENST00000462069,;C3orf14,intron_variant,,ENST00000494481,;C3orf14,intron_variant,,ENST00000542214,NM_020685.3;C3orf14,downstream_gene_variant,,ENST00000465142,;PTPRG-AS1,intron_variant,,ENST00000490916,;PTPRG-AS1,intron_variant,,ENST00000495542,;,regulatory_region_variant,,ENSR00001660131,;	-	ENSG00000114405	ENST00000494481	Transcript	intron_variant						rs113412493	1		1	C3orf14	HGNC	25024	protein_coding	YES	CCDS2896.1	ENSP00000418086	Q9HBI5	C9JY17	UPI00000729BA					5/5																		MODIFIER	1	deletion														.	TATGT	.	.																					62318805
SYNPR	132204	.	GRCh37	3	63228977	63228978	+	Intron	INS	-	-	A	rs34619289		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.67-9192dup			ENST00000478456		6	.	6	0	.	0	SYNPR,intron_variant,,ENST00000478456,;	A	ENSG00000163630	ENST00000478456	Transcript	intron_variant,non_coding_transcript_variant						rs34619289	1		1	SYNPR	HGNC	16507	processed_transcript											1/4			0.4705	0.5346		0.0526	0.5944	0.3415										MODIFIER	1	insertion														.	GTA	.	.																					63228977
FAM19A4	151647	.	GRCh37	3	68838847	68838848	+	Intron	INS	-	-	T	rs11425987		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.131-36679dup			ENST00000295569		3	.	3	0	.	0	FAM19A4,intron_variant,,ENST00000295569,NM_182522.4,NM_001005527.2;FAM19A4,intron_variant,,ENST00000495737,;	T	ENSG00000163377	ENST00000295569	Transcript	intron_variant						rs11425987	1		-1	FAM19A4	HGNC	21591	protein_coding	YES	CCDS2907.1	ENSP00000295569	Q96LR4	C9JUW7	UPI0000071129	NM_182522.4,NM_001005527.2				3/5			0.0635	0.2651		0.0685	0.3797	0.3078										MODIFIER	1	insertion														.	AAT	.	.																					68838847
Unknown	0	.	GRCh37	3	69685406	69685407	+	IGR	INS	-	-	T	rs140221257		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	3	3	.	0		T				intergenic_variant						rs140221257	1																				0.0711	0.134		0.3016	0.171	0.2822										MODIFIER	1	insertion														.	GGT	.	.																					69685406
RP11-803B1.8	0	.	GRCh37	3	75510803	75510804	+	3'Flank	DEL	AG	AG	-	rs568194685		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																			ENST00000608169		3	.	3	0	.	0	RP11-803B1.8,downstream_gene_variant,,ENST00000608169,;ENPP7P2,intron_variant,,ENST00000462675,;	-	ENSG00000272690	ENST00000608169	Transcript	downstream_gene_variant						rs568194685	1	4166	1	RP11-803B1.8	Clone_based_vega_gene		lincRNA	YES																												MODIFIER		deletion														.	GCAGA	.	.																					75510802
Unknown	0	.	GRCh37	3	84000102	84000102	+	IGR	DEL	A	A	-	rs200313086		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	4	0	.	0		-				intergenic_variant						rs200313086	1																																			MODIFIER	1	deletion														.	TGAA	.	.																					84000101
CADM2	253559	.	GRCh37	3	85160797	85160801	+	Intron	DEL	TGATG	TGATG	-	rs143497305		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGATG	TGATG																c.61+151978_61+151982del			ENST00000383699		3	.	3	0	.	0	CADM2,intron_variant,,ENST00000383699,NM_001167675.1,NM_001256504.1,NM_001256505.1;CADM2,intron_variant,,ENST00000407528,NM_001167674.1;	-	ENSG00000175161	ENST00000383699	Transcript	intron_variant						rs143497305	1		1	CADM2	HGNC	29849	protein_coding		CCDS54613.1	ENSP00000373200	Q8N3J6	G3XHN7,G3XHN4	UPI0000035DF5	NM_001167675.1,NM_001256504.1,NM_001256505.1				1/9		0.1118	0.295	0.0548		0.0427	0.0398	0.0501										MODIFIER		deletion														.	GTTGATGG	.	.																					85160796
Unknown	0	.	GRCh37	3	87428524	87428525	+	IGR	INS	-	-	CTAA	rs58731669		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		CTAA				intergenic_variant						rs58731669	1																				0.2065	0.8631		0.6915	0.9145	0.8119										MODIFIER	1	insertion														.	ACC	.	.																					87428524
Unknown	0	.	GRCh37	3	99000880	99000882	+	IGR	DEL	CAG	CAG	-	rs34008791		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAG	CAG																					3	.	3	0	.	0		-				intergenic_variant						rs34008791	1																				0.7519	0.7695		0.751	0.66	0.547										MODIFIER	1	deletion														.	ACCAGC	.	.																					99000879
Unknown	0	.	GRCh37	3	102587763	102587764	+	IGR	INS	-	-	TTTAT	rs60749388		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TTTAT				intergenic_variant						rs60749388	1																				0.8714	0.8761		0.875	0.8082	0.9008										MODIFIER	1	insertion														.	ACT	.	.																					102587763
Unknown	0	.	GRCh37	3	102913805	102913806	+	IGR	INS	-	-	AAAAC	rs10685749		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		AAAAC				intergenic_variant						rs10685749	1																																			MODIFIER	1	insertion														.	AAA	.	.																					102913805
CBLB	868	.	GRCh37	3	105466662	105466663	+	Intron	INS	-	-	A	rs3836271		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.724-1781dup			ENST00000264122		3	.	3	0	.	0	CBLB,intron_variant,,ENST00000264122,NM_170662.3;CBLB,intron_variant,,ENST00000394027,;CBLB,intron_variant,,ENST00000403724,;CBLB,intron_variant,,ENST00000405772,;CBLB,intron_variant,,ENST00000545639,;,regulatory_region_variant,,ENSR00001663132,;	A	ENSG00000114423	ENST00000264122	Transcript	intron_variant						rs3836271	1		-1	CBLB	HGNC	1542	protein_coding	YES	CCDS2948.1	ENSP00000264122	Q13191	C9JU85,B5MC15	UPI00001AE89F	NM_170662.3				5/18			0.0257	0.072		0.2946	0.0835	0.1145										MODIFIER	1	insertion													1	.	TGA	.	.																					105466662
CD96	10225	.	GRCh37	3	111227323	111227324	+	Intron	INS	-	-	G	rs79216832		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-98-33451dup			ENST00000460744		3	.	3	0	.	0	CD96,intron_variant,,ENST00000460744,;	G	ENSG00000153283	ENST00000460744	Transcript	intron_variant						rs79216832	1		1	CD96	HGNC	16892	protein_coding			ENSP00000475194		U3KPT0	UPI00038BAF4B					3/4			0.1233	0.134		0.0635	0.167	0.1053										MODIFIER	1	insertion													1	.	TTG	.	.																					111227323
CD200R1L	344807	.	GRCh37	3	112540499	112540499	+	Intron	DEL	T	T	-	rs10715617		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.680-1757del			ENST00000398214		3	.	3	0	.	0	CD200R1L,intron_variant,,ENST00000398214,NM_001008784.2;CD200R1L,intron_variant,,ENST00000448932,NM_001199215.1;CD200R1L,intron_variant,,ENST00000488794,;CD200R1L,intron_variant,,ENST00000486723,;	-	ENSG00000206531	ENST00000398214	Transcript	intron_variant						rs10715617	1		-1	CD200R1L	HGNC	24665	protein_coding	YES	CCDS43131.1	ENSP00000381272	Q6Q8B3		UPI000042263C	NM_001008784.2				4/5			0.8268	0.9539		0.8155	0.9364	0.8354										MODIFIER	1	deletion														.	TGTT	.	.																					112540498
LSAMP	4045	.	GRCh37	3	115799680	115799681	+	Intron	INS	-	-	AG	rs10661529		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.388+5490_388+5491insCT			ENST00000490035		6	.	6	0	.	0	LSAMP,intron_variant,,ENST00000333617,;LSAMP,intron_variant,,ENST00000474851,;LSAMP,intron_variant,,ENST00000490035,NM_002338.3;LSAMP,intron_variant,,ENST00000539563,;	AG	ENSG00000185565	ENST00000490035	Transcript	intron_variant						rs10661529	1		-1	LSAMP	HGNC	6705	protein_coding	YES	CCDS2982.1	ENSP00000419000	Q13449		UPI00000746A0	NM_002338.3				2/6			0.9705	0.9986		1	1	1										MODIFIER	1	insertion														.	TAA	.	.																					115799680
LSAMP	4045	.	GRCh37	3	115851290	115851290	+	Intron	DEL	T	T	-	rs35299311		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.156-45887del			ENST00000490035		4	.	4	0	.	0	LSAMP,intron_variant,,ENST00000333617,;LSAMP,intron_variant,,ENST00000474851,;LSAMP,intron_variant,,ENST00000490035,NM_002338.3;LSAMP,intron_variant,,ENST00000539563,;	-	ENSG00000185565	ENST00000490035	Transcript	intron_variant						rs35299311	1		-1	LSAMP	HGNC	6705	protein_coding	YES	CCDS2982.1	ENSP00000419000	Q13449		UPI00000746A0	NM_002338.3				1/6		0.5519	0.3041	0.5331		0.7401	0.6183	0.638										MODIFIER	1	deletion														.	CCTG	.	.																					115851289
PDIA5	10954	.	GRCh37	3	122879295	122879296	+	Intron	INS	-	-	G	rs5852324		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1345-869dup			ENST00000316218		5	.	3	4	.	0	PDIA5,intron_variant,,ENST00000316218,NM_006810.3;PDIA5,intron_variant,,ENST00000467157,;PDIA5,intron_variant,,ENST00000469649,;PDIA5,intron_variant,,ENST00000489923,;	G	ENSG00000065485	ENST00000316218	Transcript	intron_variant						rs5852324	1		1	PDIA5	HGNC	24811	protein_coding	YES	CCDS3020.1	ENSP00000323313	Q14554	C9JY10	UPI000013148A	NM_006810.3				15/16			0.2927	0.3055		0.3472	0.2932	0.4407										MODIFIER	1	insertion														.	GCG	.	.																					122879295
KALRN	8997	.	GRCh37	3	124160680	124160680	+	Intron	DEL	A	A	-	rs11303558		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.3193-100del			ENST00000240874		5	.	5	0	.	0	KALRN,intron_variant,,ENST00000240874,NM_003947.4;KALRN,intron_variant,,ENST00000354186,;KALRN,intron_variant,,ENST00000360013,NM_001024660.3;KALRN,intron_variant,,ENST00000460856,;KALRN,intron_variant,,ENST00000393501,;	-	ENSG00000160145	ENST00000240874	Transcript	intron_variant						rs11303558	1		1	KALRN	HGNC	4814	protein_coding	YES	CCDS3027.1	ENSP00000240874	O60229		UPI000012C095	NM_003947.4				18/33			0.5295	0.4063		0.4206	0.4573	0.4673										MODIFIER	1	deletion													1	.	AGAA	.	.																					124160679
Unknown	0	.	GRCh37	3	126821413	126821414	+	IGR	INS	-	-	G	rs113174537		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	6	0	.	0		G				intergenic_variant						rs113174537	1																				0.2504	0.2075		0.4087	0.2455	0.32										MODIFIER	1	insertion														.	GTG	.	.																					126821413
ENSR00000397326	0	.	GRCh37	3	127017206	127017206	+	IGR	DEL	A	A	-	rs66736235		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENSR00000397326		5	.	5	0	.	0	,regulatory_region_variant,,ENSR00000397326,;,regulatory_region_variant,,ENSR00001665375,;	-		ENSR00000397326	RegulatoryFeature	regulatory_region_variant						rs66736235	1																				0.7526	0.6427		0.7698	0.5547	0.6155										MODIFIER	1	deletion														.	TTAA	.	.																					127017205
NEK11	79858	.	GRCh37	3	130769722	130769723	+	Intron	INS	-	-	AAAT	rs3072325		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.170+21000_170+21001insAAAT			ENST00000383366		5	.	5	0	.	0	NEK11,intron_variant,,ENST00000356918,;NEK11,intron_variant,,ENST00000383366,NM_024800.4;NEK11,intron_variant,,ENST00000412440,;NEK11,intron_variant,,ENST00000429253,;NEK11,intron_variant,,ENST00000507910,;NEK11,intron_variant,,ENST00000508196,;NEK11,intron_variant,,ENST00000510688,NM_001146003.1;NEK11,intron_variant,,ENST00000510769,;NEK11,intron_variant,,ENST00000511262,NM_145910.3;RP11-265F19.1,downstream_gene_variant,,ENST00000506476,;RP11-265F19.1,downstream_gene_variant,,ENST00000511339,;RP11-265F19.1,downstream_gene_variant,,ENST00000513940,;NEK11,intron_variant,,ENST00000506695,;NEK11,intron_variant,,ENST00000510474,;NEK11,intron_variant,,ENST00000514915,;	AAAT	ENSG00000114670	ENST00000383366	Transcript	intron_variant						rs3072325	1		1	NEK11	HGNC	18593	protein_coding	YES	CCDS3069.1	ENSP00000372857	Q8NG66		UPI000013F25D	NM_024800.4				3/17			0.8941	0.7983		0.5823	0.9404	0.909										MODIFIER	1	insertion														.	AAT	.	.																					130769722
NEK11	79858	.	GRCh37	3	130773173	130773174	+	Intron	INS	-	-	A	rs944570151		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.170+24462dup			ENST00000383366		4	.	4	0	.	0	NEK11,intron_variant,,ENST00000356918,;NEK11,intron_variant,,ENST00000383366,NM_024800.4;NEK11,intron_variant,,ENST00000412440,;NEK11,intron_variant,,ENST00000429253,;NEK11,intron_variant,,ENST00000507910,;NEK11,intron_variant,,ENST00000508196,;NEK11,intron_variant,,ENST00000510688,NM_001146003.1;NEK11,intron_variant,,ENST00000510769,;NEK11,intron_variant,,ENST00000511262,NM_145910.3;RP11-265F19.1,intron_variant,,ENST00000506476,;RP11-265F19.1,intron_variant,,ENST00000511339,;RP11-265F19.1,intron_variant,,ENST00000513940,;NEK11,intron_variant,,ENST00000506695,;NEK11,intron_variant,,ENST00000510474,;NEK11,intron_variant,,ENST00000514915,;	A	ENSG00000114670	ENST00000383366	Transcript	intron_variant						rs944570151	1		1	NEK11	HGNC	18593	protein_coding	YES	CCDS3069.1	ENSP00000372857	Q8NG66		UPI000013F25D	NM_024800.4				3/17																		MODIFIER	1	insertion														.	AGA	.	.																					130773173
CPNE4	131034	.	GRCh37	3	131644397	131644398	+	Intron	INS	-	-	AAGGA	rs10634142		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-1-20110_-1-20109insTCCTT			ENST00000512055		6	.	6	0	.	0	CPNE4,5_prime_UTR_variant,,ENST00000505881,;CPNE4,intron_variant,,ENST00000429747,NM_130808.1;CPNE4,intron_variant,,ENST00000502818,;CPNE4,intron_variant,,ENST00000505957,;CPNE4,intron_variant,,ENST00000511604,;CPNE4,intron_variant,,ENST00000512055,;CPNE4,intron_variant,,ENST00000512332,;CPNE4,intron_variant,,ENST00000514999,;	AAGGA	ENSG00000196353	ENST00000512055	Transcript	intron_variant						rs10634142	1		-1	CPNE4	HGNC	2317	protein_coding	YES	CCDS3072.1	ENSP00000421705	Q96A23	Q4G168,D6RI99,D6RFY4,D6RCT2	UPI0000127C14					5/19																		MODIFIER	1	insertion														.	TGG	.	.																					131644397
ACAD11	84129	.	GRCh37	3	132375693	132375694	+	Intron	INS	-	-	T	rs200968218		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.149+2753dup			ENST00000264990		4	.	4	0	.	0	ACAD11,intron_variant,,ENST00000264990,NM_032169.4;UBA5,intron_variant,,ENST00000264991,NM_198329.2;ACAD11,intron_variant,,ENST00000355458,;ACAD11,intron_variant,,ENST00000481970,;ACAD11,intron_variant,,ENST00000545291,;UBA5,upstream_gene_variant,,ENST00000356232,NM_024818.3;UBA5,upstream_gene_variant,,ENST00000464068,;UBA5,upstream_gene_variant,,ENST00000468022,;UBA5,upstream_gene_variant,,ENST00000473651,;UBA5,upstream_gene_variant,,ENST00000493720,;UBA5,upstream_gene_variant,,ENST00000494238,;ACAD11,intron_variant,,ENST00000489991,;UBA5,upstream_gene_variant,,ENST00000480955,;ACAD11,intron_variant,,ENST00000469042,;NPHP3,intron_variant,,ENST00000471702,;ACAD11,intron_variant,,ENST00000485198,;ACAD11,intron_variant,,ENST00000496418,;UBA5,upstream_gene_variant,,ENST00000464101,;UBA5,upstream_gene_variant,,ENST00000505777,;	T	ENSG00000240303	ENST00000264990	Transcript	intron_variant						rs200968218	1		-1	ACAD11	HGNC	30211	protein_coding	YES	CCDS3074.1	ENSP00000264990	Q709F0	Q08AE9,B4DQ41	UPI00003671B7	NM_032169.4				1/19																		MODIFIER	1	insertion														.	TGT	.	.																					132375693
CLSTN2	64084	.	GRCh37	3	139994119	139994120	+	Intron	INS	-	-	T	rs5852974		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.232+99215dup			ENST00000458420		5	.	5	0	.	0	CLSTN2,intron_variant,,ENST00000458420,NM_022131.2;CLSTN2,intron_variant,,ENST00000511524,;	T	ENSG00000158258	ENST00000458420	Transcript	intron_variant						rs5852974	1		1	CLSTN2	HGNC	17448	protein_coding	YES	CCDS3112.1	ENSP00000402460	Q9H4D0	B3KUA5,B3KU27	UPI00001B0051	NM_022131.2				2/16			0.6694	0.9395		0.9206	0.9076	0.8712										MODIFIER	1	insertion														.	AGT	.	.																					139994119
SLC25A36	55186	.	GRCh37	3	140678385	140678385	+	Splice_Region	DEL	A	A	-	rs76812029		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.284+17del			ENST00000324194		3	.	3	0	.	0	SLC25A36,splice_region_variant,,ENST00000324194,;SLC25A36,splice_region_variant,,ENST00000446041,NM_018155.2,NM_001104647.1;SLC25A36,splice_region_variant,,ENST00000507429,;SLC25A36,intron_variant,,ENST00000453248,;SLC25A36,intron_variant,,ENST00000513887,;SLC25A36,splice_region_variant,,ENST00000393015,;SLC25A36,splice_region_variant,,ENST00000502594,;SLC25A36,splice_region_variant,,ENST00000512023,;SLC25A36,splice_region_variant,,ENST00000512506,;SLC25A36,intron_variant,,ENST00000515813,;SLC25A36,downstream_gene_variant,,ENST00000502756,;	-	ENSG00000114120	ENST00000324194	Transcript	splice_region_variant,intron_variant						rs76812029	1		1	SLC25A36	HGNC	25554	protein_coding	YES	CCDS46927.1	ENSP00000320688	Q96CQ1		UPI000006D558					3/6									0.2647	0.279								LOW	1	deletion														.	GTAA	.	.												0.4193	0.3411	0.3975	0.4193	0.3957	0.4525	0.4108	0.4234	0.4332	140678384
Unknown	0	.	GRCh37	3	141952055	141952056	+	IGR	INS	-	-	AAC	rs66999446		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AAC				intergenic_variant						rs66999446	1																				0.4395	0.2133		0.0635	0.2137	0.1063										MODIFIER	1	insertion														.	CAA	.	.																					141952055
RP11-680B3.2	0	.	GRCh37	3	148651630	148651653	+	Intron	DEL	CACCTTATTTTGATTTAGAACTCC	CACCTTATTTTGATTTAGAACTCC	-	rs67625441		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CACCTTATTTTGATTTAGAACTCC	CACCTTATTTTGATTTAGAACTCC																n.67-22514_67-22491del			ENST00000488190		3	.	3	0	.	0	RP11-680B3.2,intron_variant,,ENST00000488190,;	-	ENSG00000240521	ENST00000488190	Transcript	intron_variant,non_coding_transcript_variant						rs67625441	1		-1	RP11-680B3.2	Clone_based_vega_gene		antisense	YES										1/4			0.7383	0.6571		0.5804	0.6541	0.5235										MODIFIER	1	deletion														.	TTCACCTTATTTTGATTTAGAACTCCC	.	.																					148651629
ANKUB1	389161	.	GRCh37	3	149494764	149494764	+	Intron	DEL	A	A	-	rs11322234		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.451+3262del			ENST00000446160		4	.	4	0	.	0	ANKUB1,intron_variant,,ENST00000383050,;ANKUB1,intron_variant,,ENST00000446160,NM_001144960.1;ANKUB1,intron_variant,,ENST00000462519,;RNU6-507P,downstream_gene_variant,,ENST00000516045,;ANKUB1,downstream_gene_variant,,ENST00000462561,;ANKUB1,downstream_gene_variant,,ENST00000474224,;ANKUB1,downstream_gene_variant,,ENST00000481585,;ANKUB1,intron_variant,,ENST00000484019,;ANKUB1,downstream_gene_variant,,ENST00000474404,;	-	ENSG00000206199	ENST00000446160	Transcript	intron_variant						rs11322234	1		-1	ANKUB1	HGNC	29642	protein_coding	YES		ENSP00000387907		E9PHT4	UPI0000DD7B6F	NM_001144960.1				3/5			0.8147	0.5043		0.3105	0.4254	0.4192										MODIFIER	1	deletion														.	TCAA	.	.																					149494763
IFT80	57560	.	GRCh37	3	159970364	159970365	+	3'Flank	DEL	AC	AC	-	rs141772637		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																			ENST00000326448		4	.	4	0	.	0	IFT80,downstream_gene_variant,,ENST00000326448,NM_020800.2;IFT80,downstream_gene_variant,,ENST00000483465,NM_001190242.1;RP11-432B6.3,intron_variant,,ENST00000483754,;	-	ENSG00000068885	ENST00000326448	Transcript	downstream_gene_variant						rs141772637	1	4409	-1	IFT80	HGNC	29262	protein_coding	YES	CCDS3188.1	ENSP00000312778	Q9P2H3	C9JUJ1,C9JUI1,C9JSB1,C9J6I5,C9J6G8,C9J627,C9IZR2	UPI0000160F16	NM_020800.2							0.0023	0.0317		0.0308	0.0636	0.0368										MODIFIER	1	deletion													1	.	ATACA	.	.																					159970363
Unknown	0	.	GRCh37	3	163172512	163172512	+	IGR	DEL	T	T	-	rs11339888		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	3	3	.	0		-				intergenic_variant						rs11339888	1																				0.0129	0.1715		0.0208	0.2584	0.1483										MODIFIER	1	deletion														.	GGTT	.	.																					163172511
Unknown	0	.	GRCh37	3	166498431	166498432	+	IGR	INS	-	-	T	rs201375924		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					7	.	4	3	.	0		T				intergenic_variant						rs201375924	1																																			MODIFIER	1	insertion														.	AGT	.	.																					166498431
Unknown	0	.	GRCh37	3	169420146	169420146	+	IGR	DEL	C	C	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					4	.	4	3	.	0		-				intergenic_variant							1																																			MODIFIER	1	deletion														.	CTCC	.	.																					169420145
Unknown	0	.	GRCh37	3	171679983	171679983	+	IGR	DEL	A	A	-	rs527947934		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs527947934	1																																			MODIFIER	1	deletion														.	TCAA	.	.																					171679982
TBL1XR1	79718	.	GRCh37	3	176891246	176891247	+	Intron	DEL	CT	CT	-	rs532066507		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CT	CT																c.-122+22881_-122+22882del			ENST00000430069		3	.	3	0	.	0	TBL1XR1,intron_variant,,ENST00000352800,;TBL1XR1,intron_variant,,ENST00000413084,;TBL1XR1,intron_variant,,ENST00000422066,;TBL1XR1,intron_variant,,ENST00000422442,;TBL1XR1,intron_variant,,ENST00000424913,;TBL1XR1,intron_variant,,ENST00000427349,;TBL1XR1,intron_variant,,ENST00000428970,;TBL1XR1,intron_variant,,ENST00000430069,;TBL1XR1,intron_variant,,ENST00000431421,;TBL1XR1,intron_variant,,ENST00000431674,;TBL1XR1,intron_variant,,ENST00000437738,;TBL1XR1,intron_variant,,ENST00000443315,;TBL1XR1,intron_variant,,ENST00000450267,;TBL1XR1,intron_variant,,ENST00000457928,NM_024665.4;	-	ENSG00000177565	ENST00000430069	Transcript	intron_variant						rs532066507	1		-1	TBL1XR1	HGNC	29529	protein_coding	YES	CCDS46961.1	ENSP00000405574	Q9BZK7	C9JY82,C9JTW8,C9JLJ1,C9JEC9,C9JCW4,C9JCK0,C9JBN1,C9J903,C9J7E1,C9J3H2,C9IYU9	UPI0000136A71					1/15																		MODIFIER	1	deletion													1	.	CCCTG	.	.																					176891245
ENSR00000307701	0	.	GRCh37	3	179033779	179033792	+	IGR	DEL	GTGTGTGTGTGTGA	GTGTGTGTGTGTGA	-	rs141895903		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GTGTGTGTGTGTGA	GTGTGTGTGTGTGA																			ENSR00000307701		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00000307701,;,regulatory_region_variant,,ENSR00001670402,;,TF_binding_site_variant,,ENSM00885286330,;,TF_binding_site_variant,,ENSM00835401617,;,TF_binding_site_variant,,ENSM00908028710,;,TF_binding_site_variant,,ENSM00525547454,;,TF_binding_site_variant,,ENSM00826607244,;,TF_binding_site_variant,,ENSM00908979066,;,TF_binding_site_variant,,ENSM00909008431,;,TF_binding_site_variant,,ENSM00687464333,;	-		ENSR00000307701	RegulatoryFeature	regulatory_region_variant						rs141895903	1																																			MODIFIER		deletion														.	GTGTGTGTGTGTGTGAT	.	.																					179033778
ENSR00001281119	0	.	GRCh37	3	181951919	181951920	+	IGR	INS	-	-	C	rs11381023		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001281119		4	.	4	0	.	0	,regulatory_region_variant,,ENSR00001281119,;	C		ENSR00001281119	RegulatoryFeature	regulatory_region_variant						rs11381023	1																				0.8729	0.33		0.6429	0.3121	0.407										MODIFIER	1	insertion														.	CAC	.	.																					181951919
EPHB3	2049	.	GRCh37	3	184276159	184276159	+	5'Flank	DEL	C	C	-	rs11330305		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENST00000330394		7	.	4	4	.	0	EIF2B5,intron_variant,,ENST00000444495,;EPHB3,upstream_gene_variant,,ENST00000330394,NM_004443.3;EIF2B5-AS1,upstream_gene_variant,,ENST00000421870,;,regulatory_region_variant,,ENSR00001670911,;	-	ENSG00000182580	ENST00000330394	Transcript	upstream_gene_variant						rs11330305	1	3413	1	EPHB3	HGNC	3394	protein_coding	YES	CCDS3268.1	ENSP00000332118	P54753	D3DNT9	UPI0000161C94	NM_004443.3							0.5318	0.2378		0.0933	0.4016	0.3661										MODIFIER	1	deletion														.	GTCC	.	.																					184276158
IGF2BP2	10644	.	GRCh37	3	185505521	185505521	+	Intron	DEL	A	A	-	rs5855073		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.239+35420del			ENST00000382199		3	.	3	0	.	0	IGF2BP2,intron_variant,,ENST00000346192,NM_001007225.1;IGF2BP2,intron_variant,,ENST00000382199,NM_006548.4;IGF2BP2,intron_variant,,ENST00000421047,;IGF2BP2,intron_variant,,ENST00000457616,;IGF2BP2,intron_variant,,ENST00000461957,;IGF2BP2,intron_variant,,ENST00000466476,;IGF2BP2,intron_variant,,ENST00000493302,;,regulatory_region_variant,,ENSR00001281993,;	-	ENSG00000073792	ENST00000382199	Transcript	intron_variant						rs5855073	1		-1	IGF2BP2	HGNC	28867	protein_coding	YES	CCDS3273.2	ENSP00000371634	Q9Y6M1		UPI000013C5B6	NM_006548.4				2/15			0.674	0.3055		0.2718	0.3141	0.4591										MODIFIER	1	deletion													1	.	TCAA	.	.																					185505520
LPP	4026	.	GRCh37	3	188242730	188242735	+	Intron	DEL	TCCTTC	TCCTTC	-	rs759936614		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCCTTC	TCCTTC																c.429+155_429+160del			ENST00000312675		8	5	3	6	6	0	LPP,intron_variant,,ENST00000312675,NM_005578.3,NM_001167672.1;LPP,intron_variant,,ENST00000416784,;LPP,intron_variant,,ENST00000448637,;LPP,intron_variant,,ENST00000543006,NM_001167671.1,NM_001167672.1;LPP,downstream_gene_variant,,ENST00000420410,;LPP,intron_variant,,ENST00000484468,;LPP,intron_variant,,ENST00000494233,;LPP,downstream_gene_variant,,ENST00000474472,;	-	ENSG00000145012	ENST00000312675	Transcript	intron_variant						rs759936614	1		1	LPP	HGNC	6679	protein_coding	YES	CCDS3291.1	ENSP00000318089	Q93052	C9JT42,C9JIY7,C9JE51,C9J5C8,C9J4E3,C9J3U9,C9J2R5,C9J1K7,B7Z871	UPI000002E034	NM_005578.3,NM_001167672.1				5/10																		MODIFIER	1	deletion													1	.	CTTCCTTCC	.	.																					188242729
LPP	4026	.	GRCh37	3	188609143	188609143	+	3'Flank	DEL	T	T	-	rs10713217		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000312675		4	.	4	0	.	0	LPP,downstream_gene_variant,,ENST00000312675,NM_005578.3,NM_001167672.1;LPP,downstream_gene_variant,,ENST00000543006,NM_001167671.1,NM_001167672.1;	-	ENSG00000145012	ENST00000312675	Transcript	downstream_gene_variant						rs10713217	1	683	1	LPP	HGNC	6679	protein_coding	YES	CCDS3291.1	ENSP00000318089	Q93052	C9JT42,C9JIY7,C9JE51,C9J5C8,C9J4E3,C9J3U9,C9J2R5,C9J1K7,B7Z871	UPI000002E034	NM_005578.3,NM_001167672.1							0.9561	0.8732		0.9593	0.7863	0.8814										MODIFIER	1	deletion													1	.	CCTT	.	.																					188609142
AC067718.1	0	.	GRCh37	3	189858863	189858885	+	5'Flank	DEL	TGGTCTGGGAAGGAGTATAAATT	TGGTCTGGGAAGGAGTATAAATT	-	rs146774400		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGGTCTGGGAAGGAGTATAAATT	TGGTCTGGGAAGGAGTATAAATT																			ENST00000516924		3	.	3	0	.	0	AC067718.1,upstream_gene_variant,,ENST00000516924,;LEPREL1-AS1,intron_variant,,ENST00000412203,;	-	ENSG00000252733	ENST00000516924	Transcript	upstream_gene_variant						rs146774400	1	2560	1	AC067718.1	Clone_based_ensembl_gene		miRNA	YES												0.4613	0.4463	0.5389		0.251	0.6461	0.453										MODIFIER		deletion														.	TCTGGTCTGGGAAGGAGTATAAATTG	.	.																					189858862
ATP13A4	84239	.	GRCh37	3	193130296	193130311	+	Intron	DEL	ACACACACACACACAC	ACACACACACACACAC	-	rs58979821		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACACACACACACAC	ACACACACACACACAC																c.3015-151_3015-136del			ENST00000342695		3	.	3	9	.	1	ATP13A4,intron_variant,,ENST00000342695,NM_032279.2;ATP13A4,intron_variant,,ENST00000392443,;ATP13A4,intron_variant,,ENST00000400270,;ATP13A4,upstream_gene_variant,,ENST00000482964,;ATP13A4,intron_variant,,ENST00000428352,;ATP13A4,intron_variant,,ENST00000450950,;	-	ENSG00000127249	ENST00000342695	Transcript	intron_variant						rs58979821	1		-1	ATP13A4	HGNC	25422	protein_coding	YES	CCDS3304.2	ENSP00000339182	Q4VNC1		UPI0000520D50	NM_032279.2				26/29																		MODIFIER	1	deletion														.	AAACACACACACACACACA	.	.																					193130295
DLG1	1739	.	GRCh37	3	196786504	196786505	+	Intron	INS	-	-	CACTAGTCACTATTTACACTAGTCA	rs71623333		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2582+255_2582+256insTGACTAGTGTAAATAGTGACTAGTG			ENST00000346964		3	.	3	0	.	0	DLG1,intron_variant,,ENST00000314062,;DLG1,intron_variant,,ENST00000346964,NM_004087.2;DLG1,intron_variant,,ENST00000357674,NM_001204386.1;DLG1,intron_variant,,ENST00000392382,;DLG1,intron_variant,,ENST00000419354,;DLG1,intron_variant,,ENST00000422288,;DLG1,intron_variant,,ENST00000443183,NM_001204387.1;DLG1,intron_variant,,ENST00000448528,NM_001098424.1;DLG1,intron_variant,,ENST00000450955,;DLG1,intron_variant,,ENST00000452595,NM_001204388.1;DLG1,intron_variant,,ENST00000469371,;DLG1,intron_variant,,ENST00000475394,;	CACTAGTCACTATTTACACTAGTCA	ENSG00000075711	ENST00000346964	Transcript	intron_variant						rs71623333	1		-1	DLG1	HGNC	2900	protein_coding	YES	CCDS3327.1	ENSP00000345731	Q12959	F2Z2L0,C9JUA9,C9JN61,C9J110,A8MUT6	UPI000013CD24	NM_004087.2				24/25			0.7731	0.7161		0.8254	0.7505	0.7751										MODIFIER	1	insertion													1	.	GCC	.	.																					196786504
WHSC1	7468	.	GRCh37	4	1935820	1935821	+	Intron	INS	-	-	T	rs1169656491		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1556-1041dup			ENST00000382895		4	.	4	0	.	0	WHSC1,intron_variant,,ENST00000382891,NM_133335.3;WHSC1,intron_variant,,ENST00000382892,NM_133331.2;WHSC1,intron_variant,,ENST00000382895,NM_133330.2;WHSC1,intron_variant,,ENST00000398261,NM_133334.2;WHSC1,intron_variant,,ENST00000420906,NM_007331.1;WHSC1,intron_variant,,ENST00000503128,;WHSC1,intron_variant,,ENST00000508803,NM_001042424.2;WHSC1,intron_variant,,ENST00000514045,;WHSC1,intron_variant,,ENST00000513726,;WHSC1,intron_variant,,ENST00000312087,;WHSC1,intron_variant,,ENST00000353275,;WHSC1,intron_variant,,ENST00000511904,;	T	ENSG00000109685	ENST00000382895	Transcript	intron_variant						rs1169656491	1		1	WHSC1	HGNC	12766	protein_coding	YES	CCDS33940.1	ENSP00000372351	O96028	D6RIS1,D6RFE7,D6R9V2	UPI0000073F57	NM_133330.2				8/23																		MODIFIER	1	insertion													1	.	CGT	.	.																					1935820
RGS12	6002	.	GRCh37	4	3370157	3370162	+	Intron	DEL	GTGTGG	GTGTGG	-	rs72235502		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GTGTGG	GTGTGG																c.1999-17983_1999-17978del			ENST00000344733		6	4	2	5	5	0	RGS12,intron_variant,,ENST00000306648,;RGS12,intron_variant,,ENST00000336727,NM_002926.3;RGS12,intron_variant,,ENST00000344733,NM_198229.2;RGS12,intron_variant,,ENST00000382788,;RGS12,intron_variant,,ENST00000543385,;RGS12,upstream_gene_variant,,ENST00000338806,NM_198227.1;RGS12,intron_variant,,ENST00000511805,;RGS12,intron_variant,,ENST00000513784,;RGS12,intron_variant,,ENST00000506631,;RGS12,intron_variant,,ENST00000514268,;RGS12,upstream_gene_variant,,ENST00000506998,;	-	ENSG00000159788	ENST00000344733	Transcript	intron_variant						rs72235502	1		1	RGS12	HGNC	9994	protein_coding	YES	CCDS3366.1	ENSP00000339381	O14924	Q69YN1,Q56A82,E9PBG5	UPI0000133830	NM_198229.2				3/17																		MODIFIER	1	deletion														.	GTGTGTGGG	.	.																					3370156
LINC00955	0	.	GRCh37	4	3585546	3585547	+	Intron	DEL	AT	AT	-	rs5855805		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																c.-31-4055_-31-4054del			ENST00000514422		4	.	4	0	.	0	LINC00955,intron_variant,,ENST00000514422,;LINC00955,intron_variant,,ENST00000502775,;	-	ENSG00000216560	ENST00000514422	Transcript	intron_variant						rs5855805	1		1	LINC00955	HGNC	26644	protein_coding	YES		ENSP00000427553		E7ETJ0	UPI0000160C3E					1/2																		MODIFIER	1	deletion														.	CGATA	.	.																					3585545
Unknown	0	.	GRCh37	4	3601952	3601952	+	IGR	DEL	T	T	-	rs67516442		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					7	.	3	10	.	0		-				intergenic_variant						rs67516442	1																																			MODIFIER	1	deletion														.	ACTT	.	.																					3601951
Unknown	0	.	GRCh37	4	3610868	3610868	+	IGR	DEL	A	A	-	rs11321586		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs11321586	1																																			MODIFIER	1	deletion														.	CCAA	.	.																					3610867
Unknown	0	.	GRCh37	4	3622445	3622446	+	IGR	INS	-	-	G	rs113544798		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	4	4	.	0		G				intergenic_variant						rs113544798	1																																			MODIFIER	1	insertion														.	GAG	.	.																					3622445
ZBTB49	166793	.	GRCh37	4	4306671	4306672	+	Intron	INS	-	-	AGT	rs10623694		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1256-1194_1256-1193insAGT			ENST00000337872		6	4	2	4	4	0	ZBTB49,intron_variant,,ENST00000337872,NM_145291.3;ZBTB49,intron_variant,,ENST00000355834,;ZBTB49,intron_variant,,ENST00000504302,;ZBTB49,intron_variant,,ENST00000538529,;ZBTB49,downstream_gene_variant,,ENST00000502918,;ZBTB49,intron_variant,,ENST00000503703,;ZBTB49,intron_variant,,ENST00000511458,;ZBTB49,intron_variant,,ENST00000515012,;	AGT	ENSG00000168826	ENST00000337872	Transcript	intron_variant						rs10623694	1		1	ZBTB49	HGNC	19883	protein_coding	YES	CCDS3375.1	ENSP00000338807	Q6ZSB9	Q32MK9,D6RJ00	UPI000022C559	NM_145291.3				3/7			0.8434	0.8775		0.7589	0.834	0.771										MODIFIER	1	insertion														.	AGG	.	.																					4306671
MSX1	4487	.	GRCh37	4	4864405	4864405	+	Intron	DEL	T	T	-	rs33929633		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.470-15del			ENST00000382723		3	.	3	0	.	0	MSX1,intron_variant,,ENST00000382723,NM_002448.3;MSX1,intron_variant,,ENST00000468421,;,regulatory_region_variant,,ENSR00001673369,;	-	ENSG00000163132	ENST00000382723	Transcript	intron_variant						rs33929633	1		1	MSX1	HGNC	7391	protein_coding	YES	CCDS3378.2	ENSP00000372170	P28360	E9KY19,E9KY18,E9KY17,E9KY16,E9KY15,E9KY14,E9KY13,E9KY12,E9KY11,E9KY10,E9KY09,E9KY08,E9KY07,E9KY06,E9KY05,E9KY04,E9KY03,E9KY02,E9KY01,E9KY00,E9KXZ9,E9KXZ8,E9KXZ7,E9KXZ6,E9KXZ5,E9KXZ4,E9KXZ3,E9KXZ2,E9KXZ1,E9KXZ0,E9KXY9,E9KXY8,E9KXY7,E9KXY6,E9KXY5,E9KXY4,E9KXY3,E9KXY2,E9KXY1,E9KXY0,E9KXX9,E9KXX8,E9KXX7,E9KXX6,E9KXX5,E9KXX4,E9KXX3,E9KXX2,E9KXX1,E9KXX0,E9KXW9,E9KXW8,E9KXW7,E9KXW6,E9KXW5,E9KXW4,E9KXW3,E9KXW2,E9KXW1,E9KXW0,E9KXV9,E9KXV8,E9KXV7,E9KXV6,E9KXV5,E9KXV4,E9KXV3,E9KXV2,E9KXV1,E9KXV0,E9KXU9,E9KXU8,E9KXU7,E9KXU6,E9KXU5,E9KXU4,E9KXU3,E9KXU2,E9KXU1,E9KXU0,E9KXT9,E9KXT8,E9KXT7,E9KXT6,E9KXT5,E9KXT4,E9KXT3,E9KXT2,E9KXT1,E9KXT0,E9KXS9,E9KXS8,E9KXS7,E9KXS6,A0SZU5	UPI0000D474F4	NM_002448.3				1/1			0.2579	0.1614		0.0615	0.2326	0.2055	0.2537	0.2419								MODIFIER	1	deletion													1	.	GCTT	.	.												0.2167	0.2539	0.1284	0.4022	0.04753	0.2663	0.2359	0.243	0.2371	4864404
AFAP1	60312	.	GRCh37	4	7849826	7849827	+	Intron	INS	-	-	GAAGGGAG	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.335-4750_335-4749insCTCCCTTC			ENST00000420658		3	.	3	0	.	0	AFAP1,intron_variant,,ENST00000358461,NM_198595.2;AFAP1,intron_variant,,ENST00000360265,;AFAP1,intron_variant,,ENST00000382543,;AFAP1,intron_variant,,ENST00000420658,NM_001134647.1;AFAP1,intron_variant,,ENST00000513856,;	GAAGGGAG	ENSG00000196526	ENST00000420658	Transcript	intron_variant							1		-1	AFAP1	HGNC	24017	protein_coding	YES	CCDS47010.1	ENSP00000410689	Q8N556		UPI000048041E	NM_001134647.1				4/17																		MODIFIER	1	insertion														.	AAG	.	.																					7849826
DRD5	1816	.	GRCh37	4	9779175	9779176	+	5'Flank	INS	-	-	GT	rs35243947		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000304374		4	.	4	0	.	0	DRD5,upstream_gene_variant,,ENST00000304374,NM_000798.4;SLC2A9,intron_variant,,ENST00000508585,;SLC2A9,downstream_gene_variant,,ENST00000503803,;	GT	ENSG00000169676	ENST00000304374	Transcript	upstream_gene_variant						rs35243947	1	4082	1	DRD5	HGNC	3026	protein_coding	YES	CCDS3405.1	ENSP00000306129	P21918		UPI000004E905	NM_000798.4							0.8941	0.8545		0.8185	0.9573	0.8262										MODIFIER	1	insertion													1	.	CAG	.	.																					9779175
SLC2A9	56606	.	GRCh37	4	10013292	10013295	+	Intron	DEL	AGAC	AGAC	-	rs3834235		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGAC	AGAC																c.249+7304_249+7307del			ENST00000264784		7	.	7	0	.	0	SLC2A9,intron_variant,,ENST00000264784,NM_020041.2;SLC2A9,intron_variant,,ENST00000309065,NM_001001290.1;SLC2A9,intron_variant,,ENST00000506583,;SLC2A9,intron_variant,,ENST00000513129,;RP11-448G15.1,downstream_gene_variant,,ENST00000503493,;SLC2A9,intron_variant,,ENST00000505104,;SLC2A9,intron_variant,,ENST00000505506,;SLC2A9,intron_variant,,ENST00000506839,;,regulatory_region_variant,,ENSR00001674062,;	-	ENSG00000109667	ENST00000264784	Transcript	intron_variant						rs3834235	1		-1	SLC2A9	HGNC	13446	protein_coding	YES	CCDS3407.1	ENSP00000264784	Q9NRM0		UPI000013D56E	NM_020041.2				2/11			0.149	0.4409		0.4177	0.5278	0.6033										MODIFIER	1	deletion													1	.	TTAGACA	.	.																					10013291
AC006499.7	0	.	GRCh37	4	10171748	10171752	+	5'Flank	DEL	GGGGG	GGGGG	-	rs10533635		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GGGGG	GGGGG																			ENST00000511169		3	.	3	0	.	0	AC006499.7,upstream_gene_variant,,ENST00000511169,;,regulatory_region_variant,,ENSR00001674084,;	-	ENSG00000251296	ENST00000511169	Transcript	upstream_gene_variant						rs10533635	1	2359	-1	AC006499.7	Clone_based_vega_gene		processed_pseudogene	YES																												MODIFIER	1	deletion														.	CTGGGGGG	.	.																					10171747
Unknown	0	.	GRCh37	4	12098942	12098943	+	IGR	INS	-	-	A	rs35619061		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		A				intergenic_variant						rs35619061	1																				0.093	0.3991		0.624	0.4066	0.3405										MODIFIER	1	insertion														.	ATA	.	.																					12098942
RP11-341G5.1	101929071	.	GRCh37	4	13861795	13861796	+	Intron	INS	-	-	A	rs201390920		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.349+30337dup			ENST00000510907		3	.	3	0	.	0	RP11-341G5.1,intron_variant,,ENST00000503532,;RP11-341G5.1,intron_variant,,ENST00000510907,;,regulatory_region_variant,,ENSR00001288287,;,regulatory_region_variant,,ENSR00001288288,;	A	ENSG00000250634	ENST00000510907	Transcript	intron_variant,non_coding_transcript_variant						rs201390920	1		1	RP11-341G5.1	Clone_based_vega_gene		lincRNA	YES										3/3																		MODIFIER	1	insertion														.	TTA	.	.																					13861795
LINC00504	0	.	GRCh37	4	14538046	14538052	+	Intron	DEL	CAGGAGG	CAGGAGG	-	rs144927943		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAGGAGG	CAGGAGG																n.461+35719_461+35725del			ENST00000505089		3	.	3	0	.	0	LINC00504,intron_variant,,ENST00000505089,;LINC00504,intron_variant,,ENST00000509654,;LINC00504,intron_variant,,ENST00000515031,;,regulatory_region_variant,,ENSR00001288433,;	-	ENSG00000248360	ENST00000505089	Transcript	intron_variant,non_coding_transcript_variant						rs144927943	1		-1	LINC00504	HGNC	43555	lincRNA	YES										5/6			0.2905	0.634		0.7351	0.6581	0.4632										MODIFIER	1	deletion														.	CTCAGGAGGC	.	.																					14538045
PROM1	8842	.	GRCh37	4	16001915	16001915	+	Intron	DEL	T	T	-	rs569735780		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1578+204del			ENST00000510224		4	.	3	6	.	0	PROM1,intron_variant,,ENST00000447510,NM_006017.2;PROM1,intron_variant,,ENST00000505450,NM_001145848.1;PROM1,intron_variant,,ENST00000508167,NM_001145847.1;PROM1,intron_variant,,ENST00000510224,;PROM1,intron_variant,,ENST00000539194,NM_001145850.1,NM_001145852.1;PROM1,intron_variant,,ENST00000540805,NM_001145849.1,NM_001145851.1;PROM1,intron_variant,,ENST00000543373,;PROM1,downstream_gene_variant,,ENST00000511153,;	-	ENSG00000007062	ENST00000510224	Transcript	intron_variant						rs569735780	1		-1	PROM1	HGNC	9454	protein_coding	YES	CCDS47029.1	ENSP00000426809	O43490	D6RIF3,D6RBI0	UPI000004ECD6					14/27																		MODIFIER	1	deletion													1	.	TATT	.	.																					16001914
LCORL	254251	.	GRCh37	4	17943476	17943476	+	Intron	DEL	T	T	-	rs10716443		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.430+20050del			ENST00000382226		3	.	3	0	.	0	LCORL,intron_variant,,ENST00000326877,NM_153686.7;LCORL,intron_variant,,ENST00000382224,;LCORL,intron_variant,,ENST00000382226,NM_001166139.1;LCORL,intron_variant,,ENST00000539056,;LCORL,intron_variant,,ENST00000510121,;LCORL,intron_variant,,ENST00000510451,;	-	ENSG00000178177	ENST00000382226	Transcript	intron_variant						rs10716443	1		-1	LCORL	HGNC	30776	protein_coding	YES	CCDS54749.1	ENSP00000371661	Q8N3X6	C9JI46	UPI00015E0F98	NM_001166139.1				4/6			0.6649	0.5677		0.4524	0.6292	0.5951										MODIFIER	1	deletion														.	AATT	.	.																					17943475
RP11-3J1.1	0	.	GRCh37	4	19226696	19226697	+	Intron	INS	-	-	A	rs34431881		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.450-52548dup			ENST00000505347		3	.	3	0	.	0	RP11-3J1.1,intron_variant,,ENST00000505347,;,regulatory_region_variant,,ENSR00001674861,;	A	ENSG00000248238	ENST00000505347	Transcript	intron_variant,non_coding_transcript_variant						rs34431881	1		-1	RP11-3J1.1	Clone_based_vega_gene		lincRNA	YES										2/2			0.4191	0.3372		0.4236	0.5189	0.5297										MODIFIER	1	insertion														.	TTA	.	.																					19226696
RP11-3J1.1	0	.	GRCh37	4	19424519	19424521	+	Intron	DEL	AAG	AAG	-	rs56006506		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAG	AAG																n.349+33748_349+33750del			ENST00000505347		3	.	3	0	.	0	RP11-3J1.1,intron_variant,,ENST00000505347,;	-	ENSG00000248238	ENST00000505347	Transcript	intron_variant,non_coding_transcript_variant						rs56006506	1		-1	RP11-3J1.1	Clone_based_vega_gene		lincRNA	YES										1/2																		MODIFIER	1	deletion														.	AAAAGA	.	.																					19424518
KCNIP4	80333	.	GRCh37	4	21097243	21097244	+	Intron	DEL	TA	TA	-	rs60360345		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TA	TA																c.62-212912_62-212911del			ENST00000382152		3	.	3	0	.	0	KCNIP4,intron_variant,,ENST00000382148,NM_001035003.1;KCNIP4,intron_variant,,ENST00000382150,NM_147183.3;KCNIP4,intron_variant,,ENST00000382152,NM_025221.5;KCNIP4,intron_variant,,ENST00000447367,NM_147182.3,NM_147181.3;KCNIP4,intron_variant,,ENST00000509207,NM_001035004.1;KCNIP4,intron_variant,,ENST00000515786,;	-	ENSG00000185774	ENST00000382152	Transcript	intron_variant						rs60360345	1		-1	KCNIP4	HGNC	30083	protein_coding	YES	CCDS43216.1	ENSP00000371587	Q6PIL6		UPI000004A274	NM_025221.5				1/8			0.1437	0.1527		0.2262	0.2018	0.136										MODIFIER	1	deletion														.	GCTAT	.	.																					21097242
KCNIP4	80333	.	GRCh37	4	21699660	21699660	+	Intron	DEL	T	T	-	rs34358099		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.61+250534del			ENST00000382152		7	.	5	4	.	0	KCNIP4,intron_variant,,ENST00000382152,NM_025221.5;KCNIP4,intron_variant,,ENST00000447367,NM_147182.3,NM_147181.3;KCNIP4,upstream_gene_variant,,ENST00000382148,NM_001035003.1;RP11-556G22.2,intron_variant,,ENST00000511835,;KCNIP4,intron_variant,,ENST00000515786,;,regulatory_region_variant,,ENSR00000166624,;	-	ENSG00000185774	ENST00000382152	Transcript	intron_variant						rs34358099	1		-1	KCNIP4	HGNC	30083	protein_coding	YES	CCDS43216.1	ENSP00000371587	Q6PIL6		UPI000004A274	NM_025221.5				1/8			0.9039	0.5562		0.3026	0.6103	0.4417										MODIFIER	1	deletion														.	CCTT	.	.																					21699659
PPARGC1A	10891	.	GRCh37	4	23900707	23900709	+	Intron	DEL	CCC	CCC	-	rs35314800		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCC	CCC																n.52+181_52+183del			ENST00000507342		4	.	4	0	.	0	PPARGC1A,intron_variant,,ENST00000507342,;PPARGC1A,intron_variant,,ENST00000514494,;	-	ENSG00000109819	ENST00000507342	Transcript	intron_variant,non_coding_transcript_variant						rs35314800	1		-1	PPARGC1A	HGNC	9237	processed_transcript											1/3			0.9864	0.6138		0.6478	0.827	0.7454										MODIFIER		deletion													1	.	CACCCC	.	.																					23900706
AC092846.1	0	.	GRCh37	4	24420976	24420979	+	3'Flank	DEL	GTGT	GTGT	-	rs35447720		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GTGT	GTGT																			ENST00000410330		3	.	3	0	.	0	AC092846.1,downstream_gene_variant,,ENST00000410330,;,regulatory_region_variant,,ENSR00000309241,;,regulatory_region_variant,,ENSR00001675175,;	-	ENSG00000222262	ENST00000410330	Transcript	downstream_gene_variant						rs35447720	1	1820	-1	AC092846.1	Clone_based_ensembl_gene		miRNA	YES													0.2511	0.2666		0.2867	0.3857	0.2464										MODIFIER	1	deletion														.	AAGTGTG	.	.																					24420975
Unknown	0	.	GRCh37	4	36755885	36755885	+	IGR	DEL	A	A	-	rs56236281		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs56236281	1																				0.1634	0.4524		0.4038	0.6332	0.6125										MODIFIER	1	deletion														.	ATAA	.	.																					36755884
KLHL5	51088	.	GRCh37	4	39126784	39126785	+	3'Flank	INS	-	-	A	rs36042316		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000504108		3	.	3	0	.	0	KLHL5,intron_variant,,ENST00000359687,;KLHL5,intron_variant,,ENST00000515612,;KLHL5,downstream_gene_variant,,ENST00000261425,NM_001007075.2;KLHL5,downstream_gene_variant,,ENST00000261426,NM_199039.3;KLHL5,downstream_gene_variant,,ENST00000504108,NM_015990.4;KLHL5,downstream_gene_variant,,ENST00000508137,NM_001171654.1;RP11-360F5.1,intron_variant,,ENST00000509449,;	A	ENSG00000109790	ENST00000504108	Transcript	downstream_gene_variant						rs36042316	1	3959	1	KLHL5	HGNC	6356	protein_coding	YES	CCDS33974.1	ENSP00000423897	Q96PQ7	Q642I3	UPI000013D185	NM_015990.4							0.3328	0.5922		0.494	0.5746	0.5348										MODIFIER	1	insertion														.	GGA	.	.																					39126784
Unknown	0	.	GRCh37	4	41867714	41867714	+	IGR	DEL	T	T	-	rs543626264		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	4	0	.	0		-				intergenic_variant						rs543626264	1																																			MODIFIER	1	deletion														.	GATT	.	.																					41867713
GNPDA2	132789	.	GRCh37	4	44727783	44727784	+	Intron	INS	-	-	ACG	rs3046153		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-36+707_-36+708insCGT			ENST00000295448		3	.	3	0	.	0	GNPDA2,intron_variant,,ENST00000295448,NM_138335.2;GNPDA2,intron_variant,,ENST00000507534,NM_001270881.1;GNPDA2,intron_variant,,ENST00000507917,NM_001270880.1;GNPDA2,intron_variant,,ENST00000509756,;GNPDA2,intron_variant,,ENST00000511187,;,regulatory_region_variant,,ENSR00000167984,;	ACG	ENSG00000163281	ENST00000295448	Transcript	intron_variant						rs3046153	1		-1	GNPDA2	HGNC	21526	protein_coding	YES	CCDS3469.1	ENSP00000295448	Q8TDQ7		UPI000004D013	NM_138335.2				1/6			0.4864	0.6499		0.627	0.8419	0.8098										MODIFIER	1	insertion														.	TCA	.	.																					44727783
Unknown	0	.	GRCh37	4	44812172	44812172	+	IGR	DEL	T	T	-	rs34692237		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs34692237	1																				0.2368	0.1585		0.2292	0.2634	0.3405										MODIFIER	1	deletion														.	CCTT	.	.																					44812171
NFXL1	152518	.	GRCh37	4	47901156	47901159	+	Intron	DEL	AAAA	AAAA	-	rs3057881		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAA	AAAA																c.827-22_827-19del			ENST00000507489		3	.	3	0	.	0	NFXL1,intron_variant,,ENST00000329043,;NFXL1,intron_variant,,ENST00000381538,NM_152995.5,NM_001278623.1;NFXL1,intron_variant,,ENST00000507489,NM_001278624.1;NFXL1,intron_variant,,ENST00000464756,;NFXL1,intron_variant,,ENST00000507131,;	-	ENSG00000170448	ENST00000507489	Transcript	intron_variant						rs3057881	1		-1	NFXL1	HGNC	18726	protein_coding	YES	CCDS3478.2	ENSP00000422037	Q6ZNB6		UPI000020BC5D	NM_001278624.1				6/22																		MODIFIER	1	deletion														.	GCAAAAA	.	.												0.1746	0.1514	0.1913	0.1718	0.1127	0.1448	0.1892	0.1901	0.1834	47901155
FRYL	285527	.	GRCh37	4	48555678	48555679	+	Intron	INS	-	-	C	rs202224827		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.4267-279_4267-278insG			ENST00000358350		3	.	3	0	.	0	FRYL,intron_variant,,ENST00000264319,;FRYL,intron_variant,,ENST00000358350,NM_015030.1;FRYL,intron_variant,,ENST00000503238,;FRYL,intron_variant,,ENST00000507711,;FRYL,intron_variant,,ENST00000507873,;FRYL,intron_variant,,ENST00000514617,;FRYL,intron_variant,,ENST00000537810,;FRYL,upstream_gene_variant,,ENST00000502925,;	C	ENSG00000075539	ENST00000358350	Transcript	intron_variant						rs202224827	1		-1	FRYL	HGNC	29127	protein_coding	YES	CCDS43227.1	ENSP00000351113	O94915		UPI0000EBC149	NM_015030.1				35/63																		MODIFIER	1	insertion														.	AAA	.	.																					48555678
FRYL	285527	.	GRCh37	4	48778170	48778170	+	Intron	DEL	T	T	-	rs1257854116		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.-384+3925del			ENST00000358350		3	.	3	0	.	0	FRYL,intron_variant,,ENST00000264319,;FRYL,intron_variant,,ENST00000358350,NM_015030.1;FRYL,intron_variant,,ENST00000507711,;FRYL,intron_variant,,ENST00000537810,;FRYL,intron_variant,,ENST00000502520,;FRYL,intron_variant,,ENST00000505437,;FRYL,intron_variant,,ENST00000509886,;FRYL,intron_variant,,ENST00000514783,;FRYL,intron_variant,,ENST00000515684,;,regulatory_region_variant,,ENSR00001676941,;	-	ENSG00000075539	ENST00000358350	Transcript	intron_variant						rs1257854116	1		-1	FRYL	HGNC	29127	protein_coding	YES	CCDS43227.1	ENSP00000351113	O94915		UPI0000EBC149	NM_015030.1				1/63																		MODIFIER	1	deletion														.	TCTT	.	.																					48778169
Unknown	0	.	GRCh37	4	49106196	49106197	+	IGR	INS	-	-	G	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					17	11	6	8	0	0		G				intergenic_variant							1																																			MODIFIER	1	insertion														.	TTC	.	.																					49106196
Unknown	0	.	GRCh37	4	49156943	49156947	+	IGR	DEL	CATTC	CATTC	-	rs61727951		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CATTC	CATTC																					6	4	2	15	15	0		-				intergenic_variant						rs61727951	1																				0.2148	0.7147		0.2986	0.7157	0.4785										MODIFIER	1	deletion														.	TGCATTCC	.	.																					49156942
Unknown	0	.	GRCh37	4	49318646	49318647	+	IGR	INS	-	-	CCG	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	4	2	4	4	0		CCG				intergenic_variant							1																																			MODIFIER	1	insertion														.	CAC	.	.																					49318646
DCUN1D4	23142	.	GRCh37	4	52752611	52752611	+	Intron	DEL	T	T	-	rs1032194159		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.344-115del			ENST00000334635		4	.	4	0	.	0	DCUN1D4,intron_variant,,ENST00000334635,NM_001040402.1,NM_001287757.1,NM_001287755.1;DCUN1D4,intron_variant,,ENST00000381437,;DCUN1D4,intron_variant,,ENST00000381441,NM_015115.2;DCUN1D4,intron_variant,,ENST00000451288,;DCUN1D4,intron_variant,,ENST00000505403,;DCUN1D4,intron_variant,,ENST00000504113,;DCUN1D4,intron_variant,,ENST00000507659,;DCUN1D4,intron_variant,,ENST00000510587,;DCUN1D4,intron_variant,,ENST00000477560,;DCUN1D4,intron_variant,,ENST00000502930,;DCUN1D4,intron_variant,,ENST00000504923,;DCUN1D4,intron_variant,,ENST00000507741,;DCUN1D4,intron_variant,,ENST00000509068,;DCUN1D4,intron_variant,,ENST00000509376,;DCUN1D4,upstream_gene_variant,,ENST00000505634,;	-	ENSG00000109184	ENST00000334635	Transcript	intron_variant						rs1032194159	1		1	DCUN1D4	HGNC	28998	protein_coding	YES	CCDS33982.1	ENSP00000334625	Q92564	B4DH26	UPI00001C1E10	NM_001040402.1,NM_001287757.1,NM_001287755.1				5/10																		MODIFIER	1	deletion														.	GATT	.	.																					52752610
CHIC2	26511	.	GRCh37	4	54876121	54876122	+	3'UTR	INS	-	-	A	rs34881525		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.*140dup			ENST00000263921	6/6	15	.	3	15	.	0	CHIC2,3_prime_UTR_variant,,ENST00000263921,NM_012110.3;CHIC2,3_prime_UTR_variant,,ENST00000512964,;FIP1L1,intron_variant,,ENST00000507166,;CHIC2,downstream_gene_variant,,ENST00000510894,;	A	ENSG00000109220	ENST00000263921	Transcript	3_prime_UTR_variant	1028-1029/1194					rs34881525	1		-1	CHIC2	HGNC	1935	protein_coding	YES	CCDS3493.1	ENSP00000263921	Q9UKJ5		UPI0000072E65	NM_012110.3			6/6																			MODIFIER	1	insertion													1	.	TTA	.	.																					54876121
RP11-622J8.1	0	.	GRCh37	4	60044633	60044634	+	3'Flank	DEL	GT	GT	-	rs34665779		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																			ENST00000512546		3	.	3	0	.	0	RP11-622J8.1,downstream_gene_variant,,ENST00000512546,;	-	ENSG00000249111	ENST00000512546	Transcript	downstream_gene_variant						rs34665779	1	2769	1	RP11-622J8.1	Clone_based_vega_gene		lincRNA	YES													0.379	0.1037		0.1577	0.0746	0.136										MODIFIER	1	deletion														.	TGGTG	.	.																					60044632
Unknown	0	.	GRCh37	4	63633395	63633395	+	IGR	DEL	G	G	-	rs35223929		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					5	.	5	0	.	0		-				intergenic_variant						rs35223929	1																				0.6717	0.2104		0.7212	0.1769	0.3957										MODIFIER	1	deletion														.	ATGG	.	.																					63633394
Unknown	0	.	GRCh37	4	66638867	66638869	+	IGR	DEL	GCA	GCA	-	rs139904534		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GCA	GCA																					6	4	2	6	6	0		-				intergenic_variant						rs139904534	1																																			MODIFIER	1	deletion														.	ATGCAG	.	.																					66638866
UBA6-AS1	550112	.	GRCh37	4	68661342	68661343	+	Intron	INS	-	-	GATAGATAGATA	rs61358309		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.1905+40390_1905+40401dup			ENST00000500538		3	.	3	0	.	0	UBA6-AS1,intron_variant,,ENST00000500538,;	GATAGATAGATA	ENSG00000248049	ENST00000500538	Transcript	intron_variant,non_coding_transcript_variant						rs61358309	1		1	UBA6-AS1	HGNC	49083	antisense	YES										6/7																		MODIFIER	1	insertion														.	TGG	.	.																					68661342
UGT2B17	7367	.	GRCh37	4	69433999	69433999	+	Frame_Shift_Del	DEL	T	T	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.204del	p.Lys68AsnfsTer7	p.K68Nfs*7	ENST00000317746	1/6	28	.	21	40	.	40	UGT2B17,frameshift_variant,p.Lys68AsnfsTer7,ENST00000317746,NM_001077.3;	-	ENSG00000197888	ENST00000317746	Transcript	frameshift_variant	247/2077	204/1593	68/530	K/X	aaA/aa		1		-1	UGT2B17	HGNC	12547	protein_coding	YES	CCDS3523.1	ENSP00000320401	O75795		UPI0000137A9C	NM_001077.3			1/6		Superfamily:SSF53756,Pfam:PF00201,PANTHER:PTHR11926,PANTHER:PTHR11926:SF178																	HIGH	1	deletion													1	.	GATT	.	.																					69433998
RP11-813N20.1	0	.	GRCh37	4	69867747	69867747	+	3'Flank	DEL	T	T	-	rs35106257		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000505092		5	.	4	3	.	0	RP11-813N20.1,downstream_gene_variant,,ENST00000425704,;RP11-813N20.1,downstream_gene_variant,,ENST00000505092,;RP11-468N14.11,upstream_gene_variant,,ENST00000509604,;	-	ENSG00000251685	ENST00000505092	Transcript	downstream_gene_variant						rs35106257	1	2833	-1	RP11-813N20.1	Clone_based_vega_gene		unprocessed_pseudogene	YES													0.1452	0.3545		0.1458	0.6292	0.5654										MODIFIER		deletion														.	TATT	.	.																					69867746
C4orf40	401137	.	GRCh37	4	71035083	71035084	+	3'Flank	DEL	TT	TT	-	rs35990538		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																			ENST00000344526		3	.	3	0	.	0	C4orf40,downstream_gene_variant,,ENST00000344526,NM_214711.3;C4orf40,downstream_gene_variant,,ENST00000502294,;C4orf40,intron_variant,,ENST00000512173,;C4orf40,downstream_gene_variant,,ENST00000509633,;	-	ENSG00000187533	ENST00000344526	Transcript	downstream_gene_variant						rs35990538	1	4427	1	C4orf40	HGNC	33193	protein_coding	YES	CCDS3535.1	ENSP00000343172	Q6MZM9		UPI0000036170	NM_214711.3						0.7472	0.4077	0.8674		0.995	0.8817	0.727										MODIFIER	1	deletion														.	ACTTA	.	.																					71035082
RNU6-891P	0	.	GRCh37	4	71719871	71719872	+	3'Flank	INS	-	-	G	rs11370678		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000384280		3	.	3	0	.	0	RNU6-891P,downstream_gene_variant,,ENST00000384280,;	G	ENSG00000207007	ENST00000384280	Transcript	downstream_gene_variant						rs11370678	1	1914	1	RNU6-891P	HGNC	47854	snRNA	YES													0.8654	0.9914		1	1	1										MODIFIER	1	insertion														.	AAT	.	.																					71719871
GC	2638	.	GRCh37	4	72634193	72634193	+	Intron	DEL	T	T	-	rs375061055		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.186-43del			ENST00000504199		20	.	3	14	.	0	GC,intron_variant,,ENST00000273951,NM_001204306.1,NM_000583.3;GC,intron_variant,,ENST00000504199,NM_001204307.1;GC,intron_variant,,ENST00000506245,;GC,intron_variant,,ENST00000513476,;GC,intron_variant,,ENST00000503472,;GC,intron_variant,,ENST00000505234,;GC,intron_variant,,ENST00000509740,;	-	ENSG00000145321	ENST00000504199	Transcript	intron_variant						rs375061055	1		-1	GC	HGNC	4187	protein_coding	YES	CCDS56332.1	ENSP00000421725	P02774	D6RF20	UPI0001D3B4EE	NM_001204307.1				3/13									0.1011	0.09542								MODIFIER	1	deletion													1	.	GGTT	.	.												0.04799	0.04054	0.05262	0.0623	0.0488	0.02249	0.05001	0.05665	0.05554	72634192
RCHY1	25898	.	GRCh37	4	76438206	76438207	+	Intron	INS	-	-	G	rs111447343		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.90+1200dup			ENST00000324439		6	.	6	0	.	0	RCHY1,intron_variant,,ENST00000324439,;RCHY1,intron_variant,,ENST00000380840,;RCHY1,intron_variant,,ENST00000451788,NM_001278538.1,NM_001278536.1,NM_001009922.2,NM_015436.3,NM_001278539.1;RCHY1,intron_variant,,ENST00000507014,NM_001278537.1;RCHY1,intron_variant,,ENST00000512706,;RCHY1,intron_variant,,ENST00000513257,;THAP6,upstream_gene_variant,,ENST00000311638,NM_144721.4;THAP6,upstream_gene_variant,,ENST00000380837,;THAP6,upstream_gene_variant,,ENST00000502620,;THAP6,upstream_gene_variant,,ENST00000504190,;THAP6,upstream_gene_variant,,ENST00000504218,;THAP6,upstream_gene_variant,,ENST00000506261,;THAP6,upstream_gene_variant,,ENST00000507556,;THAP6,upstream_gene_variant,,ENST00000507557,;THAP6,upstream_gene_variant,,ENST00000507885,;THAP6,upstream_gene_variant,,ENST00000508105,;THAP6,upstream_gene_variant,,ENST00000514480,;RCHY1,intron_variant,,ENST00000514021,;RCHY1,intron_variant,,ENST00000504085,;RCHY1,intron_variant,,ENST00000505105,;RCHY1,intron_variant,,ENST00000513083,;RCHY1,intron_variant,,ENST00000513909,;RCHY1,intron_variant,,ENST00000514589,;THAP6,upstream_gene_variant,,ENST00000503831,;THAP6,upstream_gene_variant,,ENST00000504384,;RCHY1,upstream_gene_variant,,ENST00000505514,;,regulatory_region_variant,,ENSR00000169398,;,TF_binding_site_variant,,ENSM00650856806,;	G	ENSG00000163743	ENST00000324439	Transcript	intron_variant						rs111447343	1		-1	RCHY1	HGNC	17479	protein_coding	YES	CCDS3567.1	ENSP00000321239	Q96PM5	G3FDP5,G3FDP4,D6RAF6	UPI000013C366					1/8			0.3775	0.2406		0.2212	0.2187	0.2464										MODIFIER	1	insertion														.	ATG	.	.																					76438206
FAM47E	100129583	.	GRCh37	4	77147265	77147266	+	Intron	INS	-	-	A	rs55720841		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.81+8427dup			ENST00000339906		7	.	7	0	.	0	FAM47E,intron_variant,,ENST00000339906,;FAM47E,intron_variant,,ENST00000510197,NM_001242936.1;FAM47E,intron_variant,,ENST00000512895,;	A	ENSG00000189157	ENST00000339906	Transcript	intron_variant						rs55720841	1		1	FAM47E	HGNC	34343	protein_coding		CCDS58907.1	ENSP00000340401	Q6ZV65		UPI0000D6157B					1/6			0.4251	0.5749		0.2331	0.7893	0.5276										MODIFIER	1	insertion														.	TCA	.	.																					77147265
SEC31A	22872	.	GRCh37	4	83775866	83775866	+	Intron	DEL	A	A	-	rs79298254		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.2008+190del			ENST00000395310		6	.	4	5	.	0	SEC31A,intron_variant,,ENST00000264405,;SEC31A,intron_variant,,ENST00000311785,NM_001077206.2;SEC31A,intron_variant,,ENST00000326950,NM_016211.3;SEC31A,intron_variant,,ENST00000348405,;SEC31A,intron_variant,,ENST00000355196,;SEC31A,intron_variant,,ENST00000395310,NM_001077207.2,NM_014933.3,NM_001077208.2;SEC31A,intron_variant,,ENST00000432794,;SEC31A,intron_variant,,ENST00000443462,NM_001191049.1;SEC31A,intron_variant,,ENST00000448323,;SEC31A,intron_variant,,ENST00000500777,;SEC31A,intron_variant,,ENST00000505472,;SEC31A,intron_variant,,ENST00000505984,;SEC31A,intron_variant,,ENST00000507828,;SEC31A,intron_variant,,ENST00000508479,;SEC31A,intron_variant,,ENST00000508502,;SEC31A,intron_variant,,ENST00000509142,;SEC31A,intron_variant,,ENST00000510167,;SEC31A,intron_variant,,ENST00000512664,;SEC31A,intron_variant,,ENST00000513858,;SEC31A,downstream_gene_variant,,ENST00000503226,;SEC31A,downstream_gene_variant,,ENST00000512732,;	-	ENSG00000138674	ENST00000395310	Transcript	intron_variant						rs79298254	1		-1	SEC31A	HGNC	17052	protein_coding	YES	CCDS3596.1	ENSP00000378721	O94979	U3KQC9,D6REC0,D6REA9,D6RE64,D6RCQ9,D6RBT0	UPI000003E7E1	NM_001077207.2,NM_014933.3,NM_001077208.2				17/26			0.2254	0.6556		0.3482	0.5577	0.3763										MODIFIER	1	deletion														.	TTAA	.	.																					83775865
AGPAT9	84803	.	GRCh37	4	84506769	84506769	+	Intron	DEL	T	T	-	rs202185390		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.480-1627del			ENST00000395226		3	.	3	0	.	0	AGPAT9,intron_variant,,ENST00000264409,NM_032717.4,NM_001256422.1;AGPAT9,intron_variant,,ENST00000395226,NM_001256421.1;AGPAT9,upstream_gene_variant,,ENST00000513683,;	-	ENSG00000138678	ENST00000395226	Transcript	intron_variant						rs202185390	1		1	AGPAT9	HGNC	28157	protein_coding	YES	CCDS3606.1	ENSP00000378651	Q53EU6		UPI000004B62F	NM_001256421.1				4/12			0.1127	0.2853		0.3462	0.2734	0.3149										MODIFIER	1	deletion														.	TCTT	.	.																					84506768
RP11-42A4.1	0	.	GRCh37	4	85302293	85302294	+	5'Flank	INS	-	-	ATAGTAGTAAT	rs57528290		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000504840		4	.	4	0	.	0	RP11-42A4.1,upstream_gene_variant,,ENST00000504840,;	ATAGTAGTAAT	ENSG00000248749	ENST00000504840	Transcript	upstream_gene_variant						rs57528290	1	951	-1	RP11-42A4.1	Clone_based_vega_gene		lincRNA	YES																												MODIFIER	1	insertion														.	TAA	.	.																					85302293
ARHGAP24	83478	.	GRCh37	4	86652317	86652318	+	Intron	INS	-	-	ACCACATGCTACA	rs11267875		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.268+9195_268+9196insACATGCTACAACC			ENST00000395184		5	.	5	0	.	0	ARHGAP24,intron_variant,,ENST00000395184,NM_001025616.2,NM_001287805.1;ARHGAP24,intron_variant,,ENST00000503995,;ARHGAP24,intron_variant,,ENST00000512201,;	ACCACATGCTACA	ENSG00000138639	ENST00000395184	Transcript	intron_variant						rs11267875	1		1	ARHGAP24	HGNC	25361	protein_coding	YES	CCDS34025.1	ENSP00000378611	Q8N264	D6RHH1,B3KUX7	UPI00001AF1D9	NM_001025616.2,NM_001287805.1				3/9			0.8404	0.9914		0.998	0.999	0.999										MODIFIER	1	insertion													1	.	CCA	.	.																					86652317
HSD17B13	345275	.	GRCh37	4	88220253	88220254	+	3'Flank	INS	-	-	TT	rs35698223		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000328546		3	.	3	0	.	0	HSD17B13,downstream_gene_variant,,ENST00000302219,NM_001136230.1;HSD17B13,downstream_gene_variant,,ENST00000328546,NM_178135.3;MIR5705,downstream_gene_variant,,ENST00000579870,;	TT	ENSG00000170509	ENST00000328546	Transcript	downstream_gene_variant						rs35698223	1	4687	-1	HSD17B13	HGNC	18685	protein_coding	YES	CCDS3618.1	ENSP00000333300	Q7Z5P4		UPI00000350AE	NM_178135.3							0.2579	0.2997		0.3433	0.4085	0.1984										MODIFIER	1	insertion														.	TCT	.	.																					88220253
CCSER1	401145	.	GRCh37	4	91185840	91185840	+	Intron	DEL	T	T	-	rs33922965		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.-41-43546del			ENST00000509176		3	.	3	0	.	0	CCSER1,intron_variant,,ENST00000333691,;CCSER1,intron_variant,,ENST00000432775,NM_207491.2;CCSER1,intron_variant,,ENST00000509176,NM_001145065.1;CCSER1,intron_variant,,ENST00000505073,;	-	ENSG00000184305	ENST00000509176	Transcript	intron_variant						rs33922965	1		1	CCSER1	HGNC	29349	protein_coding	YES	CCDS47099.1	ENSP00000425040	Q9C0I3		UPI00005A6104	NM_001145065.1				1/10			0.8056	0.6945		0.9623	0.6332	0.8292										MODIFIER	1	deletion														.	ACTT	.	.																					91185839
CCSER1	401145	.	GRCh37	4	91346459	91346460	+	Intron	DEL	GA	GA	-	rs769432517		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GA	GA																c.1603+25196_1603+25197del			ENST00000509176		4	.	3	4	.	0	CCSER1,intron_variant,,ENST00000333691,;CCSER1,intron_variant,,ENST00000432775,NM_207491.2;CCSER1,intron_variant,,ENST00000509176,NM_001145065.1;CCSER1,intron_variant,,ENST00000505073,;CCSER1,intron_variant,,ENST00000508086,;CCSER1,intron_variant,,ENST00000514352,;	-	ENSG00000184305	ENST00000509176	Transcript	intron_variant						rs769432517	1		1	CCSER1	HGNC	29349	protein_coding	YES	CCDS47099.1	ENSP00000425040	Q9C0I3		UPI00005A6104	NM_001145065.1				4/10																		MODIFIER	1	deletion														.	AGGAG	.	.																					91346458
RP11-9B6.1	0	.	GRCh37	4	93218845	93218845	+	Intron	DEL	T	T	-	rs35863353		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.45-65del			ENST00000504213		3	.	3	0	.	0	RP11-9B6.1,intron_variant,,ENST00000504213,;	-	ENSG00000248511	ENST00000504213	Transcript	intron_variant						rs35863353	1		-1	RP11-9B6.1	Clone_based_vega_gene		protein_coding	YES		ENSP00000425801		D6RIX9	UPI0000EE2C70					2/2			0.0257	0.0749		0.0109	0.0865	0.0665										MODIFIER	1	deletion														.	TATT	.	.																					93218844
GRID2	2895	.	GRCh37	4	94544464	94544464	+	Intron	DEL	T	T	-	rs147269640		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.2194-2956del			ENST00000282020		3	.	3	0	.	0	GRID2,intron_variant,,ENST00000282020,NM_001510.2;GRID2,intron_variant,,ENST00000510992,NM_001286838.1;	-	ENSG00000152208	ENST00000282020	Transcript	intron_variant						rs147269640	1		1	GRID2	HGNC	4576	protein_coding	YES	CCDS3637.1	ENSP00000282020	O43424	Q4W5S4,Q4W5L9,Q4W5F4,Q4W5B7,D6R976	UPI00001AEA78	NM_001510.2				13/15		0.2194	0.1354	0.2262		0.3978	0.0994	0.2679										MODIFIER	1	deletion													1	.	CCTG	.	.																					94544463
RP11-398J16.1	0	.	GRCh37	4	95291353	95291354	+	3'Flank	INS	-	-	AAGGAAGG	rs57030367		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000478069		6	.	3	4	.	0	RP11-398J16.1,downstream_gene_variant,,ENST00000478069,;	AAGGAAGG	ENSG00000241103	ENST00000478069	Transcript	downstream_gene_variant						rs57030367	1	39	1	RP11-398J16.1	Clone_based_vega_gene		processed_pseudogene	YES													0.4803	0.4366		0.2698	0.6213	0.4335										MODIFIER	1	insertion														.	AAA	.	.																					95291353
UNC5C	8633	.	GRCh37	4	96266180	96266181	+	Intron	INS	-	-	TCTT	rs61074276		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.125-9399_125-9398insAAGA			ENST00000453304		3	.	3	0	.	0	UNC5C,intron_variant,,ENST00000453304,NM_003728.3;UNC5C,intron_variant,,ENST00000504962,;UNC5C,intron_variant,,ENST00000506749,;UNC5C,intron_variant,,ENST00000513796,;	TCTT	ENSG00000182168	ENST00000453304	Transcript	intron_variant						rs61074276	1		-1	UNC5C	HGNC	12569	protein_coding	YES	CCDS3643.1	ENSP00000406022	O95185	Q4W5H4	UPI000004E6A5	NM_003728.3				1/15																		MODIFIER	1	insertion														.	ACC	.	.																					96266180
PPP3CA	5530	.	GRCh37	4	102194296	102194297	+	Intron	INS	-	-	ATTA	rs10644136		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.58+73599_58+73600insTAAT			ENST00000394854		3	.	3	0	.	0	PPP3CA,intron_variant,,ENST00000323055,NM_001130692.1;PPP3CA,intron_variant,,ENST00000394853,NM_001130691.1;PPP3CA,intron_variant,,ENST00000394854,NM_000944.4;PPP3CA,intron_variant,,ENST00000507176,;PPP3CA,intron_variant,,ENST00000512215,;PPP3CA,intron_variant,,ENST00000523694,;PPP3CA,intron_variant,,ENST00000525819,;PPP3CA,intron_variant,,ENST00000529324,;	ATTA	ENSG00000138814	ENST00000394854	Transcript	intron_variant						rs10644136	1		-1	PPP3CA	HGNC	9314	protein_coding	YES	CCDS34037.1	ENSP00000378323	Q08209	Q9UMM5,Q9UMB2,E9PPC8,E9PK68,E7ETC2	UPI0000110660	NM_000944.4				1/13			0.9924	0.9352		0.8274	0.8986	0.8528										MODIFIER	1	insertion													1	.	ATA	.	.																					102194296
BANK1	55024	.	GRCh37	4	102716219	102716219	+	Intron	DEL	T	T	-	rs5860693		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.70+4121del			ENST00000322953		4	.	4	0	.	0	BANK1,intron_variant,,ENST00000322953,NM_017935.4;BANK1,intron_variant,,ENST00000428908,NM_001127507.2;BANK1,intron_variant,,ENST00000504592,;BANK1,intron_variant,,ENST00000508653,;	-	ENSG00000153064	ENST00000322953	Transcript	intron_variant						rs5860693	1		1	BANK1	HGNC	18233	protein_coding	YES	CCDS34038.1	ENSP00000320509	Q8NDB2		UPI0000D6159D	NM_017935.4				1/16			0.7617	0.5029		0.5585	0.5567	0.728										MODIFIER	1	deletion													1	.	CATT	.	.																					102716218
SLC39A8	64116	.	GRCh37	4	103218404	103218405	+	Intron	INS	-	-	AC	rs10655738		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.840+7069_840+7070insGT			ENST00000394833		4	.	4	0	.	0	SLC39A8,intron_variant,,ENST00000356736,NM_001135146.1,NM_001135148.1;SLC39A8,intron_variant,,ENST00000394833,NM_022154.5,NM_001135148.1;SLC39A8,intron_variant,,ENST00000424970,NM_001135147.1;SLC39A8,intron_variant,,ENST00000512337,;	AC	ENSG00000138821	ENST00000394833	Transcript	intron_variant						rs10655738	1		-1	SLC39A8	HGNC	20862	protein_coding	YES	CCDS3656.1	ENSP00000378310	Q9C0K1		UPI0000046C4E	NM_022154.5,NM_001135148.1				5/7			0.3873	0.4236		0.4276	0.4453	0.407										MODIFIER	1	insertion													1	.	TAA	.	.																					103218404
Unknown	0	.	GRCh37	4	108254951	108254961	+	IGR	DEL	CTTCTGTTTCA	CTTCTGTTTCA	-	rs138686132		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTTCTGTTTCA	CTTCTGTTTCA																					3	.	3	0	.	0		-				intergenic_variant						rs138686132	1																				0.2012	0.5476		0.5228	0.4245	0.3517										MODIFIER	1	deletion														.	TGCTTCTGTTTCAC	.	.																					108254950
ENSR00001303624	0	.	GRCh37	4	110468509	110468509	+	IGR	DEL	A	A	-	rs138375702		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENSR00001303624		4	.	4	0	.	0	,regulatory_region_variant,,ENSR00001303624,;	-		ENSR00001303624	RegulatoryFeature	regulatory_region_variant						rs138375702	1																																			MODIFIER	1	deletion														.	ACAA	.	.																					110468508
RP11-119H12.4	0	.	GRCh37	4	113744727	113744728	+	5'Flank	INS	-	-	A	rs34386421		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000504528		3	.	3	0	.	0	ANK2,intron_variant,,ENST00000503271,;ANK2,intron_variant,,ENST00000503423,;ANK2,intron_variant,,ENST00000506722,NM_001127493.1;RP11-119H12.4,upstream_gene_variant,,ENST00000413930,;RP11-119H12.4,upstream_gene_variant,,ENST00000504528,;	A	ENSG00000234841	ENST00000504528	Transcript	upstream_gene_variant						rs34386421	1	2735	1	RP11-119H12.4	Clone_based_vega_gene		processed_pseudogene	YES													0.41	0.3977		0.3661	0.3996	0.4233										MODIFIER	1	insertion														.	GCA	.	.																					113744727
Unknown	0	.	GRCh37	4	117504409	117504410	+	IGR	DEL	AA	AA	-	rs367910762		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																					3	.	3	0	.	0		-				intergenic_variant						rs367910762	1																			0.0012	0.0015				0.001	0.0031										MODIFIER	1	deletion														.	ATAAG	.	.																					117504408
AC107399.2	0	.	GRCh37	4	118233381	118233381	+	3'Flank	DEL	T	T	-	rs139761976		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000416680		3	.	3	0	.	0	AC107399.2,downstream_gene_variant,,ENST00000416680,;	-	ENSG00000224932	ENST00000416680	Transcript	downstream_gene_variant						rs139761976	1	2372	-1	AC107399.2	Clone_based_vega_gene		lincRNA	YES												0.1577	0.3048	0.1196		0.0099	0.1899	0.1053										MODIFIER	1	deletion														.	GCTG	.	.																					118233380
ANKRD50	57182	.	GRCh37	4	125606791	125606792	+	Intron	DEL	AT	AT	-	rs146631319		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																c.513-6732_513-6731del			ENST00000504087		3	.	3	0	.	0	ANKRD50,intron_variant,,ENST00000504087,NM_020337.2;ANKRD50,intron_variant,,ENST00000515641,NM_001167882.1;	-	ENSG00000151458	ENST00000504087	Transcript	intron_variant						rs146631319	1		-1	ANKRD50	HGNC	29223	protein_coding	YES	CCDS34060.1	ENSP00000425658	Q9ULJ7	Q8TB46	UPI00002377E8	NM_020337.2				2/4			0.003	0.0375		0.0208	0.0497	0.0521										MODIFIER	1	deletion														.	AGATA	.	.																					125606790
ENSR00001683165	0	.	GRCh37	4	131695869	131695870	+	IGR	INS	-	-	A	rs56757391		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001683165		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001683165,;	A		ENSR00001683165	RegulatoryFeature	regulatory_region_variant						rs56757391	1																				0.615	0.6729		0.6508	0.7207	0.6339										MODIFIER	1	insertion														.	GCA	.	.																					131695869
Unknown	0	.	GRCh37	4	132081135	132081136	+	IGR	INS	-	-	AATC	rs35848035		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	6	0	.	0		AATC				intergenic_variant						rs35848035	1																				0.205	0.6787		0.7956	0.4642	0.4571										MODIFIER	1	insertion														.	TTA	.	.																					132081135
Unknown	0	.	GRCh37	4	132262061	132262064	+	IGR	DEL	CAAT	CAAT	-	rs144799530		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAAT	CAAT																					3	.	3	0	.	0		-				intergenic_variant						rs144799530	1																				0.059	0.0504		0.2659	0.0308	0.0501										MODIFIER	1	deletion														.	ACCAATC	.	.																					132262060
Unknown	0	.	GRCh37	4	135300760	135300761	+	IGR	INS	-	-	A	rs35179144		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		A				intergenic_variant						rs35179144	1																				0.5083	0.5274		0.8879	0.3976	0.547										MODIFIER	1	insertion														.	CTA	.	.																					135300760
RP13-884E18.2	0	.	GRCh37	4	138564454	138564454	+	3'Flank	DEL	A	A	-	rs35304917		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000505454		3	.	3	0	.	0	RP13-884E18.2,downstream_gene_variant,,ENST00000505454,;	-	ENSG00000250126	ENST00000505454	Transcript	downstream_gene_variant						rs35304917	1	1965	-1	RP13-884E18.2	Clone_based_vega_gene		lincRNA	YES													0.4039	0.1455		0.1151	0.165	0.1769										MODIFIER	1	deletion														.	AGAA	.	.																					138564453
ENSR00001308670	0	.	GRCh37	4	141741072	141741073	+	IGR	INS	-	-	A	rs139507114		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001308670		5	.	4	3	.	0	,regulatory_region_variant,,ENSR00001308670,;	A		ENSR00001308670	RegulatoryFeature	regulatory_region_variant						rs139507114	1																				0.0083	0.2075		0.2123	0.1879	0.2117										MODIFIER	1	insertion														.	GTA	.	.																					141741072
SLC10A7	84068	.	GRCh37	4	147333307	147333308	+	Intron	INS	-	-	A	rs11393091		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.435+30627dup			ENST00000335472		3	.	3	0	.	0	SLC10A7,intron_variant,,ENST00000264986,;SLC10A7,intron_variant,,ENST00000335472,NM_001029998.3;SLC10A7,intron_variant,,ENST00000394062,;SLC10A7,intron_variant,,ENST00000432059,;SLC10A7,intron_variant,,ENST00000507030,;SLC10A7,intron_variant,,ENST00000507560,;	A	ENSG00000120519	ENST00000335472	Transcript	intron_variant						rs11393091	1		-1	SLC10A7	HGNC	23088	protein_coding	YES	CCDS34073.1	ENSP00000334594	Q0GE19	B3KWW2	UPI000020B547	NM_001029998.3				5/11			0.4682	0.6686		0.7837	0.4831	0.6902										MODIFIER	1	insertion													1	.	CCA	.	.																					147333307
FAM160A1	729830	.	GRCh37	4	152373930	152373930	+	Intron	DEL	A	A	-	rs112360226		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.-355-1911del			ENST00000435205		3	.	3	0	.	0	FAM160A1,intron_variant,,ENST00000435205,NM_001109977.1;FAM160A1,intron_variant,,ENST00000503146,;FAM160A1,intron_variant,,ENST00000513086,;FAM160A1,intron_variant,,ENST00000513962,;FAM160A1,intron_variant,,ENST00000508198,;FAM160A1,intron_variant,,ENST00000511501,;	-	ENSG00000164142	ENST00000435205	Transcript	intron_variant						rs112360226	1		1	FAM160A1	HGNC	34237	protein_coding	YES	CCDS47146.1	ENSP00000413196	Q05DH4	D6RF38,D6RBF5,D6RAG2	UPI00015DE720	NM_001109977.1				1/13			0.5197	0.4337		0.378	0.5308	0.3855										MODIFIER	1	deletion														.	TCAA	.	.																					152373929
ENSR00001311166	0	.	GRCh37	4	154050665	154050666	+	IGR	INS	-	-	CCC	rs200259042		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001311166		21	16	5	16	0	0	,regulatory_region_variant,,ENSR00001311166,;,regulatory_region_variant,,ENSR00001685057,;	CCC		ENSR00001311166	RegulatoryFeature	regulatory_region_variant						rs200259042	1																																			MODIFIER	1	insertion														.	CAC	.	.																					154050665
Unknown	0	.	GRCh37	4	157498834	157498835	+	IGR	INS	-	-	T	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	4	2	4	4	0		T				intergenic_variant							1																																			MODIFIER	1	insertion														.	GAG	.	.																					157498834
C4orf45	152940	.	GRCh37	4	159875511	159875513	+	Intron	DEL	CTC	CTC	-	rs72050234		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTC	CTC																c.356+5925_356+5927del			ENST00000434826		4	.	4	0	.	0	C4orf45,intron_variant,,ENST00000434826,NM_152543.2;C4orf45,intron_variant,,ENST00000505647,;C4orf45,intron_variant,,ENST00000508011,;	-	ENSG00000164123	ENST00000434826	Transcript	intron_variant						rs72050234	1		-1	C4orf45	HGNC	26342	protein_coding	YES	CCDS47156.1	ENSP00000412215	Q96LM5		UPI000022C48A	NM_152543.2				3/4			1	1		1	1	1										MODIFIER	1	deletion														.	TTCTCC	.	.																					159875510
Unknown	0	.	GRCh37	4	161373034	161373035	+	IGR	INS	-	-	T	rs35941273		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs35941273	1																				0.3222	0.3458		0.1915	0.5487	0.4601										MODIFIER	1	insertion														.	GAT	.	.																					161373034
Unknown	0	.	GRCh37	4	161418165	161418166	+	IGR	INS	-	-	AAAAT	rs58677653		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AAAAT				intergenic_variant						rs58677653	1																				0.9039	0.9914		1	0.999	1										MODIFIER	1	insertion														.	ACA	.	.																					161418165
RP11-502M1.2	0	.	GRCh37	4	161475333	161475334	+	Intron	INS	-	-	GAAAT	rs144334235		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.845+51_845+55dup			ENST00000512652		3	.	3	0	.	0	RP11-502M1.2,intron_variant,,ENST00000512652,;	GAAAT	ENSG00000249425	ENST00000512652	Transcript	intron_variant,non_coding_transcript_variant						rs144334235	1		1	RP11-502M1.2	Clone_based_vega_gene		lincRNA	YES										4/4			0.5068	0.2709		0.2222	0.3201	0.1861										MODIFIER	1	insertion														.	AAG	.	.																					161475333
Unknown	0	.	GRCh37	4	163716146	163716146	+	IGR	DEL	A	A	-	rs5863580		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs5863580	1																																			MODIFIER	1	deletion														.	TCAA	.	.																					163716145
Unknown	0	.	GRCh37	4	164180804	164180805	+	IGR	INS	-	-	A	rs147681020		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		A				intergenic_variant						rs147681020	1																				0.2602	0.7493		0.3571	0.8221	0.684										MODIFIER	1	insertion														.	AGA	.	.																					164180804
TRIM61	391712	.	GRCh37	4	165886599	165886602	+	Intron	DEL	TTTT	TTTT	-	rs70952674		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTT	TTTT																c.525+4028_525+4031del			ENST00000329314		3	.	3	0	.	0	TRIM61,intron_variant,,ENST00000329314,NM_001012414.2;RP11-366M4.8,intron_variant,,ENST00000596751,;RP11-366M4.11,downstream_gene_variant,,ENST00000508856,;	-	ENSG00000183439	ENST00000329314	Transcript	intron_variant						rs70952674	1		-1	TRIM61	HGNC	24339	protein_coding	YES	CCDS34093.1	ENSP00000332288	Q5EBN2		UPI00004CEC1B	NM_001012414.2				3/4			0.025	0.2651		0.0764	0.1531	0.1667										MODIFIER	1	deletion														.	GCTTTTT	.	.																					165886598
PALLD	23022	.	GRCh37	4	169604080	169604081	+	Intron	INS	-	-	A	rs148598962		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1155-57dup			ENST00000505667		25	.	9	20	.	0	PALLD,intron_variant,,ENST00000261509,NM_001166108.1,NM_016081.3;PALLD,intron_variant,,ENST00000333488,;PALLD,intron_variant,,ENST00000335742,;PALLD,intron_variant,,ENST00000503457,;PALLD,intron_variant,,ENST00000504519,;PALLD,intron_variant,,ENST00000505667,;PALLD,intron_variant,,ENST00000508898,;PALLD,intron_variant,,ENST00000512127,NM_001166109.1;PALLD,intron_variant,,ENST00000513245,;RNU6-1336P,downstream_gene_variant,,ENST00000383886,;	A	ENSG00000129116	ENST00000505667	Transcript	intron_variant						rs148598962	1		1	PALLD	HGNC	17068	protein_coding	YES	CCDS54818.1	ENSP00000425556	Q8WX93	Q4W5A6,D6RBH5,D6RBB1,D6R9Z5,D6R948	UPI000189A85C					4/21																		MODIFIER	1	insertion													1	.	CTA	.	.																					169604080
PALLD	23022	.	GRCh37	4	169698667	169698669	+	Intron	DEL	CAG	CAG	-	rs77308434		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAG	CAG																c.1964+65595_1964+65597del			ENST00000505667		3	.	3	0	.	0	PALLD,intron_variant,,ENST00000261509,NM_001166108.1,NM_016081.3;PALLD,intron_variant,,ENST00000335742,;PALLD,intron_variant,,ENST00000505667,;PALLD,intron_variant,,ENST00000510998,;PALLD,intron_variant,,ENST00000512127,NM_001166109.1;,regulatory_region_variant,,ENSR00001313564,;	-	ENSG00000129116	ENST00000505667	Transcript	intron_variant						rs77308434	1		1	PALLD	HGNC	17068	protein_coding	YES	CCDS54818.1	ENSP00000425556	Q8WX93	Q4W5A6,D6RBH5,D6RBB1,D6R9Z5,D6R948	UPI000189A85C					10/21			0.0431	0.1081		0.0347	0.1958	0.1237										MODIFIER	1	deletion													1	.	CCCAGC	.	.																					169698666
Unknown	0	.	GRCh37	4	171117532	171117540	+	IGR	DEL	ACCCAGAAG	ACCCAGAAG	-	rs59663744		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACCCAGAAG	ACCCAGAAG																					5	.	3	3	.	0		-				intergenic_variant						rs59663744	1																																			MODIFIER	1	deletion														.	CAACCCAGAAGG	.	.																					171117531
Unknown	0	.	GRCh37	4	172460969	172460969	+	IGR	DEL	G	G	-	rs35095431		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					7	.	4	3	.	0		-				intergenic_variant						rs35095431	1																				0.8215	0.7378		0.4633	0.836	0.7352										MODIFIER	1	deletion														.	TTGG	.	.																					172460968
GALNTL6	442117	.	GRCh37	4	172868064	172868064	+	Intron	DEL	C	C	-	rs5864099		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.138+132196del			ENST00000506823		4	.	4	0	.	0	GALNTL6,intron_variant,,ENST00000506823,NM_001034845.2;	-	ENSG00000174473	ENST00000506823	Transcript	intron_variant						rs5864099	1		1	GALNTL6	HGNC	33844	protein_coding	YES	CCDS34104.1	ENSP00000423313	Q49A17	E5D8G0	UPI000058EB5C	NM_001034845.2				2/12			0.5045	0.8559		0.6647	0.8181	0.6922										MODIFIER	1	deletion														.	TTCC	.	.																					172868063
GALNTL6	442117	.	GRCh37	4	173304053	173304053	+	Intron	DEL	T	T	-	rs74311265		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.553+34218del			ENST00000506823		4	.	3	3	.	0	GALNTL6,intron_variant,,ENST00000506823,NM_001034845.2;GALNTL6,intron_variant,,ENST00000508122,;GALNTL6,intron_variant,,ENST00000457021,;RP11-485C11.1,upstream_gene_variant,,ENST00000513791,;	-	ENSG00000174473	ENST00000506823	Transcript	intron_variant						rs74311265	1		1	GALNTL6	HGNC	33844	protein_coding	YES	CCDS34104.1	ENSP00000423313	Q49A17	E5D8G0	UPI000058EB5C	NM_001034845.2				5/12			0.0408	0.5591		0.4524	0.4831	0.6748										MODIFIER	1	deletion														.	TGTT	.	.																					173304052
GALNT7	51809	.	GRCh37	4	174235080	174235081	+	Intron	DEL	AT	AT	-	rs138768800		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																c.1390-15_1390-14del			ENST00000265000		5	.	5	0	.	0	GALNT7,intron_variant,,ENST00000265000,NM_017423.2;GALNT7,intron_variant,,ENST00000503213,;GALNT7,intron_variant,,ENST00000505308,;GALNT7,intron_variant,,ENST00000506317,;GALNT7,upstream_gene_variant,,ENST00000515862,;	-	ENSG00000109586	ENST00000265000	Transcript	intron_variant						rs138768800	1		1	GALNT7	HGNC	4129	protein_coding	YES	CCDS3815.1	ENSP00000265000	Q86SF2	Q4W5F7	UPI000000DB3C	NM_017423.2				8/11									0.2408	0.2236								MODIFIER	1	deletion														.	CGATA	.	.												0.06856	0.05503	0.07581	0.04766	0.03254	0.04967	0.08758	0.0498	0.05022	174235079
FBXO8	26269	.	GRCh37	4	175173827	175173828	+	Intron	INS	-	-	AT	rs35890245		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.456+7022_456+7023insAT			ENST00000393674		3	.	3	0	.	0	FBXO8,intron_variant,,ENST00000393674,NM_012180.2;FBXO8,intron_variant,,ENST00000503293,;FBXO8,intron_variant,,ENST00000513696,;FBXO8,intron_variant,,ENST00000515664,;	AT	ENSG00000164117	ENST00000393674	Transcript	intron_variant						rs35890245,COSV67031470	1		-1	FBXO8	HGNC	13587	protein_coding	YES	CCDS3820.1	ENSP00000377280	Q9NRD0	D6RIC0	UPI000012A588	NM_012180.2				3/5		0.2204	0.1301	0.245		0.0387	0.4583	0.2679				0,1						MODIFIER	1	insertion			0,1											.	ACG	.	.																					175173827
Unknown	0	.	GRCh37	4	175314763	175314763	+	IGR	DEL	T	T	-	rs35350725		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	4	0	.	0		-				intergenic_variant						rs35350725	1																				0.1929	0.1729		0.5159	0.1272	0.1063										MODIFIER	1	deletion														.	CATT	.	.																					175314762
Unknown	0	.	GRCh37	4	175522969	175522970	+	IGR	DEL	AG	AG	-	rs57888486		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																					3	.	3	0	.	0		-				intergenic_variant						rs57888486	1																				0.0998	0.3862		0.5466	0.326	0.362										MODIFIER	1	deletion														.	ATAGA	.	.																					175522968
ASB5	140458	.	GRCh37	4	177184524	177184525	+	Intron	DEL	TC	TC	-	rs67569639		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TC	TC																c.196+5539_196+5540del			ENST00000296525		3	.	3	0	.	0	ASB5,intron_variant,,ENST00000296525,NM_080874.3;	-	ENSG00000164122	ENST00000296525	Transcript	intron_variant						rs67569639	1		-1	ASB5	HGNC	17180	protein_coding	YES	CCDS3827.1	ENSP00000296525	Q8WWX0	Q5HYF3,D6R9Q2	UPI00000015CF	NM_080874.3				1/6			0.5537	0.7118		0.4692	0.668	0.4949										MODIFIER	1	deletion														.	AGTCT	.	.																					177184523
Unknown	0	.	GRCh37	4	179313609	179313609	+	IGR	DEL	A	A	-	rs33933163		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					8	.	8	0	.	0		-				intergenic_variant						rs33933163	1																				0.4576	0.2579		0.2173	0.3907	0.2546										MODIFIER	1	deletion														.	TTAA	.	.																					179313608
Unknown	0	.	GRCh37	4	180502988	180502989	+	IGR	INS	-	-	CGGAC	rs112032477		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	3	3	.	0		CGGAC				intergenic_variant						rs112032477	1																				0.3646	0.3804		0.3165	0.5646	0.4264										MODIFIER	1	insertion														.	AGC	.	.																					180502988
LINC00290	728081	.	GRCh37	4	182061031	182061032	+	Intron	INS	-	-	AA	rs56200248		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.201+15733_201+15734dup			ENST00000512487		3	.	3	0	.	0	LINC00290,intron_variant,,ENST00000512487,;	AA	ENSG00000248197	ENST00000512487	Transcript	intron_variant,non_coding_transcript_variant						rs56200248	1		-1	LINC00290	HGNC	38515	lincRNA	YES										2/2			0.5121	0.6225		0.744	0.6332	0.6155										MODIFIER	1	insertion														.	TTA	.	.																					182061031
Unknown	0	.	GRCh37	4	182513112	182513112	+	IGR	DEL	A	A	-	rs34862010		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs34862010	1																				0.3676	0.4755		0.506	0.5149	0.4141										MODIFIER	1	deletion														.	AGAA	.	.																					182513111
Unknown	0	.	GRCh37	4	183734492	183734493	+	IGR	DEL	CT	CT	-	rs1340749886		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CT	CT																					6	4	2	4	4	0		-				intergenic_variant						rs1340749886	1																																			MODIFIER	1	deletion														.	CACTC	.	.																					183734491
snoU13	0	.	GRCh37	4	184499207	184499208	+	3'Flank	INS	-	-	GT	rs140005671		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000459504		3	.	3	0	.	0	snoU13,downstream_gene_variant,,ENST00000459504,;	GT	ENSG00000239116	ENST00000459504	Transcript	downstream_gene_variant						rs140005671	1	4140	-1	snoU13	RFAM		snoRNA	YES													0.0446	0.0778		0.1994	0.0507	0.0706										MODIFIER	1	insertion														.	CAG	.	.																					184499207
Unknown	0	.	GRCh37	4	184733777	184733777	+	IGR	DEL	G	G	-	rs34670534		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					6	.	6	1	.	0		-				intergenic_variant						rs34670534	1																				0.6104	0.1974		0.0863	0.2286	0.3037										MODIFIER	1	deletion														.	GAGG	.	.																					184733776
STOX2	56977	.	GRCh37	4	184778573	184778574	+	Intron	INS	-	-	AGGACTGGTTATCCTGCAGGACTGGTTATCCCACAGGACTCGTTGCCTCGT	rs70959151		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.413+3586_413+3587insTATCCTGCAGGACTGGTTATCCCACAGGACTCGTTGCCTCGTAGGACTGGT			ENST00000511250		3	.	3	0	.	0	STOX2,intron_variant,,ENST00000511250,;,regulatory_region_variant,,ENSR00001316018,;,regulatory_region_variant,,ENSR00001687213,;	AGGACTGGTTATCCTGCAGGACTGGTTATCCCACAGGACTCGTTGCCTCGT	ENSG00000173320	ENST00000511250	Transcript	intron_variant,non_coding_transcript_variant						rs70959151	1		1	STOX2	HGNC	25450	processed_transcript											1/1																		MODIFIER	1	insertion														.	ACA	.	.																					184778573
SNX25	83891	.	GRCh37	4	186208975	186208976	+	Intron	INS	-	-	G	rs34265529		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.600-191_600-190insG			ENST00000504273		6	3	3	4	4	0	SNX25,intron_variant,,ENST00000264694,NM_031953.2;SNX25,intron_variant,,ENST00000504273,;	G	ENSG00000109762	ENST00000504273	Transcript	intron_variant						rs34265529	1		1	SNX25	HGNC	21883	protein_coding	YES	CCDS34116.1	ENSP00000426255	Q9H3E2	B3KTI8	UPI000020B7BB					5/18		0.4575	0.3979	0.4568		0.5218	0.4225	0.5082										MODIFIER	1	insertion														.	AAT	.	.																					186208975
RP11-215A19.2	0	.	GRCh37	4	187372083	187372100	+	Intron	DEL	GAGGTCAGGGTGGATCAA	GAGGTCAGGGTGGATCAA	-	rs149353829		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAGGTCAGGGTGGATCAA	GAGGTCAGGGTGGATCAA																c.130-23848_130-23831del			ENST00000509111		3	.	3	0	.	0	RP11-215A19.2,intron_variant,,ENST00000509111,;F11-AS1,intron_variant,,ENST00000505103,;F11-AS1,intron_variant,,ENST00000508110,;F11-AS1,intron_variant,,ENST00000508287,;	-	ENSG00000272297	ENST00000509111	Transcript	intron_variant						rs149353829	1		-1	RP11-215A19.2	Clone_based_vega_gene		protein_coding	YES		ENSP00000422449			UPI0001D3BA95					1/1			0.2095	0.5245		0.2688	0.5924	0.4264										MODIFIER	1	deletion														.	ACGAGGTCAGGGTGGATCAAG	.	.																					187372082
FAT1	2195	.	GRCh37	4	187525941	187525942	+	Intron	INS	-	-	GAT	rs70964972		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.10351-216_10351-214dup			ENST00000441802		5	.	5	0	.	0	FAT1,intron_variant,,ENST00000441802,NM_005245.3;FAT1,upstream_gene_variant,,ENST00000503253,;FAT1,downstream_gene_variant,,ENST00000508035,;	GAT	ENSG00000083857	ENST00000441802	Transcript	intron_variant						rs70964972	1		-1	FAT1	HGNC	3595	protein_coding	YES	CCDS47177.1	ENSP00000406229	Q14517	D6RCE4	UPI000051946B	NM_005245.3				17/26			0.2625	0.4092		0.3294	0.3668	0.4928										MODIFIER	1	insertion													1	.	AGG	.	.																					187525941
Unknown	0	.	GRCh37	4	190595397	190595397	+	IGR	DEL	G	G	-	rs11323146		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					6	.	3	6	.	0		-				intergenic_variant						rs11323146	1																			0.3381	0.4349	0.2968		0.2063	0.3936	0.3149										MODIFIER	1	deletion														.	AAGT	.	.																					190595396
Unknown	0	.	GRCh37	4	190678704	190678704	+	IGR	DEL	T	T	-	rs1350879135		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					8	.	3	8	.	7		-				intergenic_variant						rs1350879135	1																																			MODIFIER	1	deletion														.	AATT	.	.																					190678703
EXOC3	11336	.	GRCh37	5	451250	451251	+	Intron	INS	-	-	T	rs36111924		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.365-2227dup			ENST00000512944		3	.	3	0	.	0	EXOC3,intron_variant,,ENST00000315013,;EXOC3,intron_variant,,ENST00000512944,NM_007277.4;EXOC3,downstream_gene_variant,,ENST00000508022,;EXOC3,downstream_gene_variant,,ENST00000510441,;EXOC3,intron_variant,,ENST00000515601,;EXOC3,upstream_gene_variant,,ENST00000503889,;	T	ENSG00000180104	ENST00000512944	Transcript	intron_variant						rs36111924	1		1	EXOC3	HGNC	30378	protein_coding	YES	CCDS54830.1	ENSP00000425587	O60645	Q69YP2,D6RBR9,B2RE06	UPI000004A021	NM_007277.4				3/12																		MODIFIER	1	insertion														.	CAT	.	.																					451250
SLC12A7	10723	.	GRCh37	5	1076520	1076530	+	Intron	DEL	CAGGTTCCAGC	CAGGTTCCAGC	-	rs111668454		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAGGTTCCAGC	CAGGTTCCAGC																c.1749-179_1749-169del			ENST00000264930		3	.	3	0	.	0	SLC12A7,intron_variant,,ENST00000264930,NM_006598.2;SLC12A7,upstream_gene_variant,,ENST00000513223,;SLC12A7,intron_variant,,ENST00000504576,;SLC12A7,downstream_gene_variant,,ENST00000510943,;	-	ENSG00000113504	ENST00000264930	Transcript	intron_variant						rs111668454	1		-1	SLC12A7	HGNC	10915	protein_coding	YES	CCDS34129.1	ENSP00000264930	Q9Y666		UPI0000141815	NM_006598.2				13/23																		MODIFIER	1	deletion														.	CTCAGGTTCCAGCC	.	.																					1076519
SLC12A7	10723	.	GRCh37	5	1093630	1093631	+	Intron	INS	-	-	T	rs373251745		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.342+17_342+18insA			ENST00000264930		19	14	5	17	0	0	SLC12A7,intron_variant,,ENST00000264930,NM_006598.2;	T	ENSG00000113504	ENST00000264930	Transcript	intron_variant						rs373251745	1		-1	SLC12A7	HGNC	10915	protein_coding	YES	CCDS34129.1	ENSP00000264930	Q9Y666		UPI0000141815	NM_006598.2				3/23																		MODIFIER	1	insertion														.	ACG	.	.												4.827e-05	8.728e-05					0.0001014			1093630
SDHAP3	0	.	GRCh37	5	1572590	1572591	+	Intron	INS	-	-	G	rs367918923		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.549+1706dup			ENST00000413529		13	.	4	19	.	0	SDHAP3,intron_variant,,ENST00000413529,;SDHAP3,intron_variant,,ENST00000515467,;	G	ENSG00000185986	ENST00000413529	Transcript	intron_variant,non_coding_transcript_variant						rs367918923	1		-1	SDHAP3	HGNC	18781	transcribed_unprocessed_pseudogene	YES										3/3																		MODIFIER	1	insertion														.	CAG	.	.																					1572590
RP11-259O2.1	0	.	GRCh37	5	1929327	1929328	+	5'Flank	INS	-	-	TG	rs55808914		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000511693		4	.	4	0	.	0	RP11-259O2.1,upstream_gene_variant,,ENST00000511693,;	TG	ENSG00000248994	ENST00000511693	Transcript	upstream_gene_variant						rs55808914	1	4649	1	RP11-259O2.1	Clone_based_vega_gene		lincRNA	YES													0.8873	0.7075		0.5764	0.8121	0.6534										MODIFIER	1	insertion														.	GTT	.	.																					1929327
Unknown	0	.	GRCh37	5	4307893	4307893	+	IGR	DEL	T	T	-	rs5865547		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs5865547	1																				0.7027	0.4135		0.2798	0.4433	0.4714										MODIFIER	1	deletion														.	GATT	.	.																					4307892
Unknown	0	.	GRCh37	5	6542484	6542485	+	IGR	DEL	AT	AT	-	rs3996732		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																					3	.	3	0	.	0		-				intergenic_variant						rs3996732	1																				0.5393	0.3862		0.2431	0.3598	0.2955										MODIFIER	1	deletion														.	AAATA	.	.																					6542483
RP11-417J1.3	0	.	GRCh37	5	8615341	8615352	+	5'Flank	DEL	ACACACAGACAC	ACACACAGACAC	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACACAGACAC	ACACACAGACAC																			ENST00000510642		4	.	4	0	.	0	RP11-417J1.3,upstream_gene_variant,,ENST00000510642,;MTND6P2,downstream_gene_variant,,ENST00000512226,;	-	ENSG00000248765	ENST00000510642	Transcript	upstream_gene_variant							1	3938	1	RP11-417J1.3	Clone_based_vega_gene		processed_pseudogene	YES																												MODIFIER	1	deletion														.	ATACACACAGACACA	.	.																					8615340
Unknown	0	.	GRCh37	5	14892756	14892757	+	IGR	INS	-	-	C	rs5866124		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		C				intergenic_variant						rs5866124	1																				0.2383	0.3559		0.3552	0.4901	0.2945										MODIFIER	1	insertion														.	CAC	.	.																					14892756
AC016575.1	0	.	GRCh37	5	14910099	14910100	+	3'Flank	INS	-	-	AG	rs34952654		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000390747		5	.	5	0	.	0	AC016575.1,downstream_gene_variant,,ENST00000390747,;	AG	ENSG00000212036	ENST00000390747	Transcript	downstream_gene_variant						rs34952654	1	567	-1	AC016575.1	Clone_based_ensembl_gene		miRNA	YES													0.966	0.8213		0.7907	0.7346	0.8753										MODIFIER	1	insertion														.	AAA	.	.																					14910099
RP1-137K24.1	101929454	.	GRCh37	5	15213009	15213010	+	Intron	INS	-	-	AGG	rs34184953		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.248-20452_248-20451insCCT			ENST00000511443		5	.	3	4	.	0	RP1-137K24.1,intron_variant,,ENST00000511443,;	AGG	ENSG00000248486	ENST00000511443	Transcript	intron_variant,non_coding_transcript_variant						rs34184953	1		-1	RP1-137K24.1	Clone_based_vega_gene		lincRNA	YES										2/2			0.2973	0.2867		0.1756	0.4274	0.2117										MODIFIER	1	insertion														.	ATA	.	.																					15213009
FAM134B	54463	.	GRCh37	5	16550384	16550385	+	Intron	INS	-	-	A	rs5866190		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.458+15487dup			ENST00000306320		3	.	3	0	.	0	FAM134B,intron_variant,,ENST00000306320,NM_001034850.2;,regulatory_region_variant,,ENSR00000314092,;,regulatory_region_variant,,ENSR00001689247,;	A	ENSG00000154153	ENST00000306320	Transcript	intron_variant						rs5866190	1		-1	FAM134B	HGNC	25964	protein_coding	YES	CCDS43304.1	ENSP00000304642	Q9H6L5		UPI000006D7DB	NM_001034850.2				3/8			0.084	0.3674		0.3333	0.4205	0.2413										MODIFIER	1	insertion													1	.	TTA	.	.																					16550384
Unknown	0	.	GRCh37	5	18208677	18208678	+	IGR	INS	-	-	A	rs56863259		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		A				intergenic_variant						rs56863259	1																				0.6097	0.3473		0.244	0.2952	0.3845										MODIFIER	1	insertion														.	GGA	.	.																					18208677
Unknown	0	.	GRCh37	5	18607534	18607534	+	IGR	DEL	A	A	-	rs899551211		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	4	0	.	0		-				intergenic_variant						rs899551211	1																																			MODIFIER	1	deletion														.	ATAA	.	.																					18607533
CDH12	1010	.	GRCh37	5	22253313	22253315	+	Intron	DEL	ATT	ATT	-	rs143746831		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATT	ATT																c.-332-40563_-332-40561del			ENST00000382254		4	.	4	2	.	0	CDH12,intron_variant,,ENST00000382254,NM_004061.3;CDH12,intron_variant,,ENST00000504376,;	-	ENSG00000154162	ENST00000382254	Transcript	intron_variant						rs143746831	1		-1	CDH12	HGNC	1751	protein_coding	YES	CCDS3890.1	ENSP00000371689	P55289	B3KRT0	UPI00000622EB	NM_004061.3				3/14			0.0333	0.0389		0.0317	0.0924	0.1687										MODIFIER	1	deletion														.	TAATTA	.	.																					22253312
Unknown	0	.	GRCh37	5	23646718	23646719	+	IGR	DEL	AA	AA	-	rs57736899		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																					3	.	3	0	.	0		-				intergenic_variant						rs57736899	1																																			MODIFIER	1	deletion														.	AGAAA	.	.																					23646717
Unknown	0	.	GRCh37	5	23769008	23769009	+	IGR	INS	-	-	TCTTT	rs71605626		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TCTTT				intergenic_variant						rs71605626	1																				0.6256	0.6599		0.5784	0.7038	0.7147										MODIFIER	1	insertion														.	GCT	.	.																					23769008
CDH6	1004	.	GRCh37	5	31296893	31296893	+	Intron	DEL	C	C	-	rs35538920		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.524-502del			ENST00000265071		5	.	3	3	.	0	CDH6,intron_variant,,ENST00000265071,NM_004932.3;CDH6,intron_variant,,ENST00000514738,;CDH6,intron_variant,,ENST00000508132,;	-	ENSG00000113361	ENST00000265071	Transcript	intron_variant						rs35538920	1		1	CDH6	HGNC	1765	protein_coding	YES	CCDS3894.1	ENSP00000265071	P55285		UPI0000126D9B	NM_004932.3				3/11			0.1362	0.3674		0.3155	0.34	0.1534										MODIFIER	1	deletion														.	ATCC	.	.																					31296892
PDZD2	23037	.	GRCh37	5	31751689	31751690	+	Intron	INS	-	-	T	rs34613055		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-360-47306dup			ENST00000438447		4	.	4	0	.	0	PDZD2,intron_variant,,ENST00000438447,;PDZD2,intron_variant,,ENST00000513910,;RP11-5N11.6,upstream_gene_variant,,ENST00000509629,;RP11-5N11.7,upstream_gene_variant,,ENST00000515522,;PDZD2,intron_variant,,ENST00000502824,;	T	ENSG00000133401	ENST00000438447	Transcript	intron_variant						rs34613055	1		1	PDZD2	HGNC	18486	protein_coding	YES	CCDS34137.1	ENSP00000402033	O15018	B4DGS3	UPI000069648B					1/24			0.1029	0.1441		0.0099	0.1918	0.0552										MODIFIER	1	insertion														.	TGT	.	.																					31751689
MTMR12	54545	.	GRCh37	5	32313741	32313742	+	5'Flank	DEL	TG	TG	-	rs137997250		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																			ENST00000382142		3	.	3	0	.	0	MTMR12,upstream_gene_variant,,ENST00000264934,;MTMR12,upstream_gene_variant,,ENST00000280285,;MTMR12,upstream_gene_variant,,ENST00000382142,NM_001040446.1;RNU6-378P,downstream_gene_variant,,ENST00000384324,;MTMR12,upstream_gene_variant,,ENST00000505419,;MTMR12,upstream_gene_variant,,ENST00000513622,;,regulatory_region_variant,,ENSR00000179064,;	-	ENSG00000150712	ENST00000382142	Transcript	upstream_gene_variant						rs137997250	1	626	-1	MTMR12	HGNC	18191	protein_coding	YES	CCDS34138.1	ENSP00000371577	Q9C0I1		UPI00001678D2	NM_001040446.1																						MODIFIER	1	deletion														.	TTTGT	.	.																					32313740
OSMR	9180	.	GRCh37	5	38935412	38935414	+	3'UTR	DEL	CAA	CAA	-	rs16351		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAA	CAA																c.*1870_*1872del			ENST00000274276	18/18	4	.	4	0	.	0	OSMR,3_prime_UTR_variant,,ENST00000274276,NM_003999.2;RICTOR,downstream_gene_variant,,ENST00000296782,NM_001285439.1;RICTOR,downstream_gene_variant,,ENST00000357387,NM_152756.3;OSMR,intron_variant,,ENST00000508882,;OSMR,intron_variant,,ENST00000509237,;RICTOR,downstream_gene_variant,,ENST00000511516,NM_001285440.1;	-	ENSG00000145623	ENST00000274276	Transcript	3_prime_UTR_variant	5208-5210/5539					rs16351	1		1	OSMR	HGNC	8507	protein_coding	YES	CCDS3928.1	ENSP00000274276	Q99650		UPI000004CAC3	NM_003999.2			18/18				0.7663	0.5202		0.5962	0.6113	0.6452										MODIFIER	1	deletion													1	.	GTCAAC	.	.																					38935411
FST	10468	.	GRCh37	5	52781377	52781378	+	Intron	INS	-	-	T	rs5867881		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.952+320dup			ENST00000256759		22	.	3	25	.	0	FST,intron_variant,,ENST00000256759,NM_013409.2;FST,intron_variant,,ENST00000396947,NM_006350.3;FST,intron_variant,,ENST00000497789,;FST,intron_variant,,ENST00000504226,;FST,downstream_gene_variant,,ENST00000491717,;	TT	ENSG00000134363	ENST00000256759	Transcript	intron_variant						rs5867881	2		1	FST	HGNC	3971	protein_coding	YES	CCDS3959.1	ENSP00000256759	P19883		UPI000012AC56	NM_013409.2				5/5																		MODIFIER	1	sequence_alteration														.	AGTT	.	.																					52781376
Unknown	0	.	GRCh37	5	53058390	53058390	+	IGR	DEL	G	G	-	rs141579796		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					3	.	3	0	.	0		-				intergenic_variant						rs141579796	1																			0.3275	0.3268	0.4827		0.2242	0.4026	0.2474										MODIFIER	1	deletion														.	CAGT	.	.																					53058389
CTD-2031P19.3	441072	.	GRCh37	5	55301873	55301874	+	3'Flank	INS	-	-	A	rs71602930		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000500093		4	.	4	0	.	0	CTD-2031P19.3,downstream_gene_variant,,ENST00000500093,;,regulatory_region_variant,,ENSR00001691906,;	A	ENSG00000227908	ENST00000500093	Transcript	downstream_gene_variant						rs71602930	1	2396	1	CTD-2031P19.3	Clone_based_vega_gene		antisense	YES													0.1248	0.0836		0.0347	0.1103	0.0828										MODIFIER	1	insertion														.	TTA	.	.																					55301873
Unknown	0	.	GRCh37	5	57116881	57116882	+	IGR	INS	-	-	T	rs60987230		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs60987230	1																				0.2753	0.1643		0.2579	0.0895	0.1237										MODIFIER	1	insertion														.	GAT	.	.																					57116881
RAB3C	115827	.	GRCh37	5	57911812	57911813	+	Intron	INS	-	-	AC	rs58004467		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.25-1633_25-1632dup			ENST00000282878		3	.	3	0	.	0	RAB3C,intron_variant,,ENST00000282878,NM_138453.2;RAB3C,intron_variant,,ENST00000513316,;	AC	ENSG00000152932	ENST00000282878	Transcript	intron_variant						rs58004467	1		1	RAB3C	HGNC	30269	protein_coding	YES	CCDS3976.1	ENSP00000282878	Q96E17		UPI0000133178	NM_138453.2				1/4			0.3805	0.4827		0.6677	0.4891	0.5798										MODIFIER	1	insertion														.	AGA	.	.																					57911812
DEPDC1B	55789	.	GRCh37	5	59894839	59894839	+	Intron	DEL	A	A	-	rs58987696		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1428+63del			ENST00000265036		53	.	8	61	.	0	DEPDC1B,intron_variant,,ENST00000265036,NM_018369.2;DEPDC1B,intron_variant,,ENST00000453022,NM_001145208.1;DEPDC1B,intron_variant,,ENST00000545085,;DEPDC1B,intron_variant,,ENST00000512078,;,regulatory_region_variant,,ENSR00001692418,;	-	ENSG00000035499	ENST00000265036	Transcript	intron_variant						rs58987696	2		-1	DEPDC1B	HGNC	24902	protein_coding	YES	CCDS3977.1	ENSP00000265036	Q8WUY9		UPI000020C7D4	NM_018369.2				10/10			0.0265	0.0187		0.0069	0.0199	0.0297										MODIFIER	1	sequence_alteration														.	ATAA	.	.																					59894838
MAST4	375449	.	GRCh37	5	66162033	66162034	+	Intron	INS	-	-	TGCATTT	rs61400765		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.643-33745_643-33739dup			ENST00000403625		3	.	3	0	.	0	MAST4,intron_variant,,ENST00000403625,NM_001164664.1;MAST4,intron_variant,,ENST00000403666,NM_015183.2;MAST4,intron_variant,,ENST00000404260,;MAST4,intron_variant,,ENST00000406039,;MAST4,intron_variant,,ENST00000406374,NM_198828.2;MAST4,intron_variant,,ENST00000411628,;MAST4,intron_variant,,ENST00000432817,;MAST4,intron_variant,,ENST00000434115,;MAST4,intron_variant,,ENST00000450827,;MAST4,intron_variant,,ENST00000452953,;MAST4,intron_variant,,ENST00000490016,;MAST4,intron_variant,,ENST00000470421,;	TGCATTT	ENSG00000069020	ENST00000403625	Transcript	intron_variant						rs61400765	1		1	MAST4	HGNC	19037	protein_coding	YES	CCDS54861.1	ENSP00000385727		J3QT34	UPI000173A2B0	NM_001164664.1				3/28			0.2557	0.4813		0.2579	0.6431	0.4857										MODIFIER	1	insertion														.	TCT	.	.																					66162033
ENSR00001329423	0	.	GRCh37	5	71375472	71375472	+	IGR	DEL	T	T	-	rs11299534		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENSR00001329423		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001329423,;	-		ENSR00001329423	RegulatoryFeature	regulatory_region_variant						rs11299534	1																				0.7148	0.6254		0.8085	0.5278	0.6943										MODIFIER	1	deletion														.	CCTT	.	.																					71375471
MAP1B	4131	.	GRCh37	5	71421032	71421034	+	Intron	DEL	AGG	AGG	-	rs139815234		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGG	AGG																c.286+9408_286+9410del			ENST00000296755		4	.	3	2	.	0	MAP1B,intron_variant,,ENST00000296755,NM_005909.3;MAP1B,intron_variant,,ENST00000511641,;MAP1B,intron_variant,,ENST00000512974,;MAP1B,intron_variant,,ENST00000513526,;,regulatory_region_variant,,ENSR00001329439,;	-	ENSG00000131711	ENST00000296755	Transcript	intron_variant						rs139815234	1		1	MAP1B	HGNC	6836	protein_coding	YES	CCDS4012.1	ENSP00000296755	P46821	D6RGJ3,D6RA40	UPI000013E382	NM_005909.3				2/6				0.0951		0.0952	0.0547	0.1554										MODIFIER	1	deletion													1	.	CTAGGA	.	.																					71421031
ARHGEF28	64283	.	GRCh37	5	73151925	73151925	+	Intron	DEL	T	T	-	rs11288253		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1791-1551del			ENST00000545377		4	.	4	0	.	0	ARHGEF28,intron_variant,,ENST00000287898,;ARHGEF28,intron_variant,,ENST00000296794,;ARHGEF28,intron_variant,,ENST00000296799,NM_001244364.1;ARHGEF28,intron_variant,,ENST00000426542,;ARHGEF28,intron_variant,,ENST00000437974,;ARHGEF28,intron_variant,,ENST00000513042,NM_001177693.1;ARHGEF28,intron_variant,,ENST00000545377,NM_001080479.2;	-	ENSG00000214944	ENST00000545377	Transcript	intron_variant						rs11288253	1		1	ARHGEF28	HGNC	30322	protein_coding	YES	CCDS47231.2	ENSP00000441913	Q8N1W1	D6RAP0	UPI00004DF58E	NM_001080479.2				14/36			0.0832	0.3256		0.0744	0.2654	0.1933										MODIFIER	1	deletion														.	TATT	.	.																					73151924
COL4A3BP	10087	.	GRCh37	5	74680298	74680299	+	Intron	DEL	GA	GA	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GA	GA																c.1872+168_1872+169del			ENST00000380494		3	.	3	0	.	0	COL4A3BP,intron_variant,,ENST00000261415,NM_031361.2;COL4A3BP,intron_variant,,ENST00000357457,;COL4A3BP,intron_variant,,ENST00000380494,NM_001130105.1;COL4A3BP,intron_variant,,ENST00000405807,NM_005713.2;COL4A3BP,upstream_gene_variant,,ENST00000508809,;COL4A3BP,intron_variant,,ENST00000508692,;	-	ENSG00000113163	ENST00000380494	Transcript	intron_variant							1		-1	COL4A3BP	HGNC	2205	protein_coding	YES	CCDS47235.1	ENSP00000369862	Q9Y5P4		UPI00003E5FC3	NM_001130105.1				15/18																		MODIFIER	1	deletion														.	CTGAA	.	.																					74680297
RPL7P23	0	.	GRCh37	5	76880952	76880953	+	3'Flank	INS	-	-	A	rs537337720		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000593668		3	.	3	0	.	0	WDR41,intron_variant,,ENST00000509971,;WDR41,intron_variant,,ENST00000509858,;RPL7P23,downstream_gene_variant,,ENST00000493874,;RPL7P23,downstream_gene_variant,,ENST00000593668,;	A	ENSG00000244363	ENST00000593668	Transcript	downstream_gene_variant						rs537337720	1	1942	1	RPL7P23	HGNC	35658	processed_pseudogene	YES																												MODIFIER	1	insertion														.	AGA	.	.																					76880952
SCAMP1	9522	.	GRCh37	5	77758850	77758851	+	Intron	INS	-	-	G	rs35082026		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.852+3665_852+3666insG			ENST00000538629		4	.	4	0	.	0	SCAMP1,intron_variant,,ENST00000538629,NM_004866.4;SCAMP1,intron_variant,,ENST00000320280,;SCAMP1,intron_variant,,ENST00000339292,;SCAMP1,intron_variant,,ENST00000506858,;SCAMP1,intron_variant,,ENST00000508822,;SCAMP1,intron_variant,,ENST00000509998,;	G	ENSG00000085365	ENST00000538629	Transcript	intron_variant						rs35082026	1		1	SCAMP1	HGNC	10563	protein_coding	YES		ENSP00000475496		U3KQ30	UPI00001B94D7	NM_004866.4				8/8		0.7256	0.8593	0.5202		0.627	0.7694	0.7474										MODIFIER	1	insertion														.	TTT	.	.																					77758850
BHMT2	23743	.	GRCh37	5	78384181	78384182	+	Intron	INS	-	-	TG	rs202040828		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1011-96_1011-95dup			ENST00000255192		7	4	3	4	4	0	BHMT2,intron_variant,,ENST00000255192,NM_017614.4;BHMT2,intron_variant,,ENST00000521567,NM_001178005.1;DMGDH,intron_variant,,ENST00000520388,;	TG	ENSG00000132840	ENST00000255192	Transcript	intron_variant						rs202040828	1		1	BHMT2	HGNC	1048	protein_coding	YES	CCDS4045.1	ENSP00000255192	Q9H2M3	E5RH96	UPI00000701B9	NM_017614.4				7/7																		MODIFIER	1	insertion														.	ACT	.	.																					78384181
Unknown	0	.	GRCh37	5	85974803	85974804	+	IGR	DEL	TT	TT	-	rs11293434		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																					3	.	3	0	.	0		-				intergenic_variant						rs11293434	1																																			MODIFIER	1	deletion														.	AATTT	.	.																					85974802
GPR98	84059	.	GRCh37	5	89879663	89879664	+	Intron	DEL	AT	AT	-	rs3041942		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																c.22+24929_22+24930del			ENST00000405460		5	.	5	0	.	0	GPR98,intron_variant,,ENST00000405460,NM_032119.3;GPR98,intron_variant,,ENST00000508842,;	-	ENSG00000164199	ENST00000405460	Transcript	intron_variant						rs3041942	1		1	GPR98	HGNC	17416	protein_coding	YES	CCDS47246.1	ENSP00000384582	Q8WXG9		UPI00002127A7	NM_032119.3				1/89		0.4503	0.3623	0.3646		0.5754	0.4742	0.4765										MODIFIER	1	deletion													1	.	AAATG	.	.																					89879662
MCTP1	79772	.	GRCh37	5	94372615	94372616	+	Intron	INS	-	-	TCACTCACTCAC	rs141556044		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.721-19439_721-19428dup			ENST00000515393		6	.	6	0	.	0	MCTP1,intron_variant,,ENST00000312216,NM_001002796.2;MCTP1,intron_variant,,ENST00000429576,;MCTP1,intron_variant,,ENST00000503301,;MCTP1,intron_variant,,ENST00000505208,;MCTP1,intron_variant,,ENST00000505465,;MCTP1,intron_variant,,ENST00000508509,;MCTP1,intron_variant,,ENST00000510732,;MCTP1,intron_variant,,ENST00000512425,;MCTP1,intron_variant,,ENST00000515393,NM_024717.4;MCTP1,intron_variant,,ENST00000513695,;MCTP1,intron_variant,,ENST00000513857,;,regulatory_region_variant,,ENSR00001695685,;	TCACTCACTCAC	ENSG00000175471	ENST00000515393	Transcript	intron_variant						rs141556044	1		-1	MCTP1	HGNC	26183	protein_coding	YES	CCDS34203.1	ENSP00000424126	Q6DN14	E5RJR1	UPI0000D6165C	NM_024717.4				1/22			0.5242	0.8573		0.8879	0.9235	0.8906										MODIFIER	1	insertion														.	TTT	.	.																					94372615
CAST	831	.	GRCh37	5	96072163	96072166	+	Intron	DEL	AAAC	AAAC	-	rs34594086		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAC	AAAC																c.576+227_576+230del			ENST00000395812		8	.	8	0	.	0	CAST,intron_variant,,ENST00000309190,NM_173060.3,NM_001284213.1;CAST,intron_variant,,ENST00000325674,;CAST,intron_variant,,ENST00000338252,NM_001190442.1;CAST,intron_variant,,ENST00000341926,;CAST,intron_variant,,ENST00000359176,NM_001284213.1;CAST,intron_variant,,ENST00000395812,NM_001042440.2,NM_001284213.1,NM_001284212.1;CAST,intron_variant,,ENST00000395813,NM_001284213.1;CAST,intron_variant,,ENST00000421689,;CAST,intron_variant,,ENST00000504465,;CAST,intron_variant,,ENST00000505143,;CAST,intron_variant,,ENST00000508197,;CAST,intron_variant,,ENST00000508608,;CAST,intron_variant,,ENST00000508830,;CAST,intron_variant,,ENST00000509903,;CAST,intron_variant,,ENST00000510156,;CAST,intron_variant,,ENST00000510756,;CAST,intron_variant,,ENST00000511049,;CAST,intron_variant,,ENST00000511097,;CAST,intron_variant,,ENST00000511782,;CAST,intron_variant,,ENST00000512620,;CAST,upstream_gene_variant,,ENST00000437034,;CAST,upstream_gene_variant,,ENST00000510500,;CTC-506B8.1,downstream_gene_variant,,ENST00000502568,;CAST,intron_variant,,ENST00000348386,;CAST,intron_variant,,ENST00000513666,;CAST,intron_variant,,ENST00000515063,;CAST,downstream_gene_variant,,ENST00000508117,;	-	ENSG00000153113	ENST00000395812	Transcript	intron_variant						rs34594086	1		1	CAST	HGNC	1515	protein_coding	YES	CCDS54882.1	ENSP00000379157	P20810	E7EQ12	UPI0000DA4C59	NM_001042440.2,NM_001284213.1,NM_001284212.1				8/29			0.0696	0.2248		0.0923	0.34	0.2004										MODIFIER	1	deletion													1	.	AAAAACA	.	.																					96072162
RP11-1152B5.1	0	.	GRCh37	5	101309976	101309980	+	5'Flank	DEL	TAACT	TAACT	-	rs141396863		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAACT	TAACT																			ENST00000515228		4	.	4	0	.	0	RP11-1152B5.1,upstream_gene_variant,,ENST00000515228,;	-	ENSG00000249495	ENST00000515228	Transcript	upstream_gene_variant						rs141396863	1	2020	1	RP11-1152B5.1	Clone_based_vega_gene		processed_pseudogene	YES													0.1694	0.0922			0.1233	0.0245										MODIFIER	1	deletion														.	GCTAACTT	.	.																					101309975
Unknown	0	.	GRCh37	5	101380173	101380174	+	IGR	INS	-	-	AAT	rs3040000		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AAT				intergenic_variant						rs3040000	1																				0.3593	0.2594		0.1141	0.2793	0.1769										MODIFIER	1	insertion														.	AAA	.	.																					101380173
CTC-254B4.1	102467213	.	GRCh37	5	106337780	106337781	+	Intron	INS	-	-	ATTA	rs10692244		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.75+8860_75+8861insTAAT			ENST00000513273		4	.	4	0	.	0	CTC-254B4.1,intron_variant,,ENST00000513273,;	ATTA	ENSG00000251027	ENST00000513273	Transcript	intron_variant,non_coding_transcript_variant						rs10692244	1		-1	CTC-254B4.1	Clone_based_vega_gene		lincRNA											1/3			0.6838	0.804		0.8829	0.7664	0.7975										MODIFIER	1	insertion														.	TCA	.	.																					106337780
NREP-AS1	100873948	.	GRCh37	5	111339982	111339982	+	Intron	DEL	C	C	-	rs34079753		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																n.444-12848del			ENST00000507222		4	.	4	0	.	0	NREP-AS1,intron_variant,,ENST00000503242,;NREP-AS1,intron_variant,,ENST00000507222,;	-	ENSG00000250095	ENST00000507222	Transcript	intron_variant,non_coding_transcript_variant						rs34079753	1		1	NREP-AS1	HGNC	40780	antisense	YES										3/3			0.1921	0.4957		0.5675	0.3738	0.589										MODIFIER	1	deletion														.	CACC	.	.																					111339981
APC	324	.	GRCh37	5	112166045	112166047	+	Intron	DEL	ACT	ACT	-	rs34481414		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACT	ACT																c.1743+1378_1743+1380del			ENST00000457016		3	.	3	0	.	0	APC,intron_variant,,ENST00000257430,NM_000038.5;APC,intron_variant,,ENST00000457016,;APC,intron_variant,,ENST00000504915,;APC,intron_variant,,ENST00000507379,NM_001127511.2;APC,intron_variant,,ENST00000508376,NM_001127510.2;APC,intron_variant,,ENST00000512211,;APC,intron_variant,,ENST00000502371,;APC,intron_variant,,ENST00000508624,;APC,intron_variant,,ENST00000514164,;CTC-554D6.1,intron_variant,,ENST00000520401,;APC,downstream_gene_variant,,ENST00000505084,;	-	ENSG00000134982	ENST00000457016	Transcript	intron_variant						rs34481414	1		1	APC	HGNC	583	protein_coding	YES	CCDS4107.1	ENSP00000413133	P25054	Q9UM98,Q9P119,Q9HAW6,Q4LE70,E9PFT7,D6RFL6,B2ZRE1,A5HB97,A5HB96,A5HB95,A5HB94,A1YIQ7	UPI000013CF60					14/15			0.4932	0.6671		0.8155	0.5249	0.6534										MODIFIER	1	deletion													1	.	AAACTA	.	.																					112166044
Unknown	0	.	GRCh37	5	113076658	113076659	+	IGR	INS	-	-	CT	rs10627250		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		CT				intergenic_variant						rs10627250	1																				0.9402	0.9712		1	0.9463	0.9673										MODIFIER	1	insertion														.	CAC	.	.																					113076658
ENSR00001697866	0	.	GRCh37	5	121600405	121600406	+	IGR	INS	-	-	TTTTCC	rs3031364		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001697866		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001697866,;	TTTTCC		ENSR00001697866	RegulatoryFeature	regulatory_region_variant						rs3031364	1																				0.0756	0.1916		0.0933	0.2296	0.3098										MODIFIER	1	insertion														.	GGT	.	.																					121600405
Unknown	0	.	GRCh37	5	121875453	121875454	+	IGR	INS	-	-	A	rs71623254		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		A				intergenic_variant						rs71623254	1																				0.6157	0.6023		0.8026	0.6074	0.6176										MODIFIER	1	insertion														.	GTA	.	.																					121875453
ZNF608	57507	.	GRCh37	5	124003152	124003153	+	Intron	INS	-	-	CACCGT	rs61246286		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1163-17768_1163-17763dup			ENST00000306315		3	.	3	0	.	0	ZNF608,intron_variant,,ENST00000306315,NM_020747.2;ZNF608,intron_variant,,ENST00000504926,;ZNF608,intron_variant,,ENST00000509799,;ZNF608,intron_variant,,ENST00000513986,;ZNF608,intron_variant,,ENST00000503896,;ZNF608,intron_variant,,ENST00000507508,;ZNF608,intron_variant,,ENST00000511308,;ZNF608,intron_variant,,ENST00000505686,;,regulatory_region_variant,,ENSR00001339186,;	CACCGT	ENSG00000168916	ENST00000306315	Transcript	intron_variant						rs61246286	1		-1	ZNF608	HGNC	29238	protein_coding	YES	CCDS34219.1	ENSP00000307746	Q9ULD9	Q9UFL4,B3KPE6	UPI000013EB23	NM_020747.2				2/8																		MODIFIER	1	insertion														.	CCC	.	.																					124003152
RP11-114J13.1	0	.	GRCh37	5	125512766	125512767	+	Intron	INS	-	-	C	rs138491381		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.72-78913dup			ENST00000450613		3	.	3	0	.	0	RP11-114J13.1,intron_variant,,ENST00000450613,;CTC-339D2.1,upstream_gene_variant,,ENST00000507428,;	C	ENSG00000248752	ENST00000450613	Transcript	intron_variant,non_coding_transcript_variant						rs138491381	1		-1	RP11-114J13.1	Clone_based_vega_gene		lincRNA	YES										1/2			0.9985	1		0.999	1	1										MODIFIER	1	insertion														.	TAC	.	.																					125512766
RP11-114H7.2	0	.	GRCh37	5	130331989	130331989	+	3'Flank	DEL	A	A	-	rs34671325		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000508316		3	.	3	0	.	0	RP11-114H7.2,downstream_gene_variant,,ENST00000508316,;	-	ENSG00000250405	ENST00000508316	Transcript	downstream_gene_variant						rs34671325	1	132	1	RP11-114H7.2	Clone_based_vega_gene		processed_pseudogene	YES													0.5295	0.6354		0.5873	0.6352	0.5716										MODIFIER	1	deletion														.	CCAA	.	.																					130331988
FSTL4	23105	.	GRCh37	5	132628247	132628248	+	Intron	INS	-	-	A	rs35459497		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.727+20098dup			ENST00000265342		3	.	3	0	.	0	FSTL4,intron_variant,,ENST00000265342,NM_015082.1;,regulatory_region_variant,,ENSR00001699006,;	A	ENSG00000053108	ENST00000265342	Transcript	intron_variant						rs35459497	1		-1	FSTL4	HGNC	21389	protein_coding	YES	CCDS34238.1	ENSP00000265342	Q6MZW2		UPI000003AFB0	NM_015082.1				6/15			0.4871	0.4409		0.3522	0.4761	0.3906										MODIFIER	1	insertion														.	TCA	.	.																					132628247
FAM13B	51306	.	GRCh37	5	137347734	137347736	+	Intron	DEL	ACA	ACA	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACA	ACA																c.371-102_371-100del			ENST00000033079		6	4	2	17	0	0	FAM13B,intron_variant,,ENST00000033079,NM_016603.2;FAM13B,intron_variant,,ENST00000420893,NM_001101800.1;FAM13B,intron_variant,,ENST00000425075,NM_001101801.1;FAM13B,intron_variant,,ENST00000514310,;,regulatory_region_variant,,ENSR00001699585,;	-	ENSG00000031003	ENST00000033079	Transcript	intron_variant							1		-1	FAM13B	HGNC	1335	protein_coding	YES	CCDS4195.1	ENSP00000033079	Q9NYF5	D6RE97,D6RDL7,D6RCA0,D6RBJ3,D6RAT6	UPI000004A03C	NM_016603.2				4/22																		MODIFIER	1	deletion														.	ATACAA	.	.																					137347733
UBE2D2	7322	.	GRCh37	5	138945963	138945976	+	Intron	DEL	GGTCATGCACAGTG	GGTCATGCACAGTG	-	rs59548103		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GGTCATGCACAGTG	GGTCATGCACAGTG																c.24+4582_24+4595del			ENST00000398733		4	.	4	0	.	0	UBE2D2,intron_variant,,ENST00000253815,NM_181838.1;UBE2D2,intron_variant,,ENST00000398733,NM_003339.2;UBE2D2,intron_variant,,ENST00000505007,;UBE2D2,intron_variant,,ENST00000505548,;UBE2D2,intron_variant,,ENST00000511725,;UBE2D2,intron_variant,,ENST00000398734,;UBE2D2,intron_variant,,ENST00000510470,;	-	ENSG00000131508	ENST00000398733	Transcript	intron_variant						rs59548103	1		1	UBE2D2	HGNC	12475	protein_coding	YES	CCDS43369.1	ENSP00000381717	P62837	D6RFM0,D6RAW0	UPI0000006BD0	NM_003339.2				1/6																		MODIFIER	1	deletion														.	CAGGTCATGCACAGTGG	.	.																					138945962
PCDHGA3	56112	.	GRCh37	5	140795208	140795209	+	Intron	INS	-	-	A	rs113784532		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2424+69195dup			ENST00000253812		50	.	5	40	.	0	PCDHGA3,intron_variant,,ENST00000253812,NM_018916.3,NM_032011.1;PCDHGA2,intron_variant,,ENST00000394576,NM_018915.2;PCDHGA8,intron_variant,,ENST00000398604,NM_032088.1;PCDHGA10,intron_variant,,ENST00000398610,NM_018913.2,NM_032090.1;PCDHGA1,intron_variant,,ENST00000517417,NM_018912.2;PCDHGA6,intron_variant,,ENST00000517434,NM_018919.2,NM_032086.1;PCDHGA5,intron_variant,,ENST00000518069,NM_018918.2,NM_032054.1;PCDHGA7,intron_variant,,ENST00000518325,NM_018920.2;PCDHGB4,intron_variant,,ENST00000519479,NM_003736.2,NM_018925.2,NM_032098.1;PCDHGB6,intron_variant,,ENST00000520790,NM_018926.2,NM_032100.1;PCDHGB2,intron_variant,,ENST00000522605,NM_018923.2,NM_032096.1;PCDHGB1,intron_variant,,ENST00000523390,NM_018922.2,NM_032095.1;PCDHGA4,intron_variant,,ENST00000571252,NM_018917.2;PCDHGA9,intron_variant,,ENST00000573521,NM_018921.2,NM_032089.1;PCDHGB3,intron_variant,,ENST00000576222,NM_018924.2,NM_032097.1;PCDHGB7,upstream_gene_variant,,ENST00000398594,NM_018927.3;	A	ENSG00000254245	ENST00000253812	Transcript	intron_variant						rs113784532	1		1	PCDHGA3	HGNC	8701	protein_coding	YES	CCDS47290.1	ENSP00000253812	Q9Y5H0	Q9UKW1,Q9BT64	UPI0000161C1A	NM_018916.3,NM_032011.1				1/3									0.08189	0.06387								MODIFIER		insertion														.	TTA	.	.												0.1101	0.1061	0.1036	0.1567	0.08737	0.07974	0.1056	0.1213	0.1635	140795208
ARHGAP26	23092	.	GRCh37	5	142543610	142543611	+	Intron	INS	-	-	T	rs543247118		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1988+16678dup			ENST00000274498		3	.	3	0	.	0	ARHGAP26,intron_variant,,ENST00000274498,NM_015071.4;ARHGAP26,intron_variant,,ENST00000378004,NM_001135608.1;ARHGAP26,intron_variant,,ENST00000418236,;ARHGAP26,intron_variant,,ENST00000443674,;ARHGAP26,upstream_gene_variant,,ENST00000486650,;ARHGAP26,intron_variant,,ENST00000419676,;ARHGAP26,intron_variant,,ENST00000424007,;	T	ENSG00000145819	ENST00000274498	Transcript	intron_variant						rs543247118	1		1	ARHGAP26	HGNC	17073	protein_coding	YES	CCDS4277.1	ENSP00000274498	Q9UNA1	Q9HBW4,Q8NFJ1,C9J6V4	UPI0000130D6B	NM_015071.4				20/22																		MODIFIER	1	insertion													1	.	TCT	.	.																					142543610
YIPF5	81555	.	GRCh37	5	143553465	143553466	+	5'Flank	DEL	TT	TT	-	rs58804094		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																			ENST00000274496		3	.	3	0	.	0	KCTD16,intron_variant,,ENST00000512467,;YIPF5,upstream_gene_variant,,ENST00000274496,NM_030799.8;YIPF5,upstream_gene_variant,,ENST00000448443,NM_001024947.3;YIPF5,upstream_gene_variant,,ENST00000513112,NM_001271732.1;YIPF5,upstream_gene_variant,,ENST00000519064,;YIPF5,upstream_gene_variant,,ENST00000522203,;YIPF5,upstream_gene_variant,,ENST00000508754,;	-	ENSG00000145817	ENST00000274496	Transcript	upstream_gene_variant						rs58804094	1	3242	-1	YIPF5	HGNC	24877	protein_coding	YES	CCDS4279.1	ENSP00000274496	Q969M3	E5RHH4,E5RGR9	UPI00000474FE	NM_030799.8																						MODIFIER	1	deletion														.	GATTT	.	.																					143553464
CTC-295J13.3	0	.	GRCh37	5	147626673	147626673	+	3'Flank	DEL	T	T	-	rs35867610		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000513133		3	.	3	0	.	0	CTC-295J13.3,downstream_gene_variant,,ENST00000513133,;	-	ENSG00000248109	ENST00000513133	Transcript	downstream_gene_variant						rs35867610	1	4516	1	CTC-295J13.3	Clone_based_vega_gene		lincRNA	YES													0.3669	0.8948		0.8343	0.9254	0.8579										MODIFIER	1	deletion														.	AGTT	.	.																					147626672
MIR145	406937	.	GRCh37	5	148816511	148816512	+	3'Flank	INS	-	-	A	rs35797277		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000602315		3	.	3	0	.	0	MIR145,downstream_gene_variant,,ENST00000602315,;	A	ENSG00000269936	ENST00000602315	Transcript	downstream_gene_variant						rs35797277	1	4114	1	MIR145	HGNC	31532	lincRNA	YES													0.1838	0.4885		0.4306	0.4672	0.3333										MODIFIER	1	insertion														.	TCA	.	.																					148816511
ENSR00001700999	0	.	GRCh37	5	149062283	149062290	+	IGR	DEL	GAAGGAAG	GAAGGAAG	-	rs144812362		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAAGGAAG	GAAGGAAG																			ENSR00001700999		6	.	6	0	.	0	,regulatory_region_variant,,ENSR00001700999,;	-		ENSR00001700999	RegulatoryFeature	regulatory_region_variant						rs144812362	1																				0.1142	0.1066		0.1101	0.1779	0.1186										MODIFIER	1	deletion														.	TTGAAGGAAGG	.	.																					149062282
PPARGC1B	133522	.	GRCh37	5	149157656	149157675	+	Intron	DEL	ACACACACACACACACACAG	ACACACACACACACACACAG	-	rs1183022472		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACACACACACACACACAG	ACACACACACACACACACAG																c.79-42339_79-42320del			ENST00000309241		3	.	3	0	.	0	PPARGC1B,intron_variant,,ENST00000309241,NM_133263.3;PPARGC1B,intron_variant,,ENST00000360453,NM_001172698.1;PPARGC1B,intron_variant,,ENST00000394320,;PPARGC1B,intron_variant,,ENST00000403750,NM_001172699.1;PPARGC1B,intron_variant,,ENST00000461780,;,regulatory_region_variant,,ENSR00001701013,;	-	ENSG00000155846	ENST00000309241	Transcript	intron_variant						rs1183022472	1		1	PPARGC1B	HGNC	30022	protein_coding	YES	CCDS4298.1	ENSP00000312649	Q86YN6		UPI000006F49D	NM_133263.3				1/11																		MODIFIER	1	deletion														.	ACACACACACACACACACACAGA	.	.																					149157655
Unknown	0	.	GRCh37	5	151756435	151756436	+	IGR	INS	-	-	T	rs11389017		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					10	.	10	0	.	0		T				intergenic_variant						rs11389017	1																				0.5242	0.4856		0.2569	0.4821	0.5286										MODIFIER	1	insertion														.	TAT	.	.																					151756435
Unknown	0	.	GRCh37	5	154024675	154024679	+	IGR	DEL	ACTCC	ACTCC	-	rs4031836		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACTCC	ACTCC																					3	.	3	0	.	0		-				intergenic_variant						rs4031836	1																				0.1097	0.1873		0.3671	0.1431	0.1738										MODIFIER	1	deletion														.	TGACTCCA	.	.																					154024674
Unknown	0	.	GRCh37	5	154690133	154690134	+	IGR	DEL	TC	TC	-	rs59615030		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TC	TC																					8	5	3	5	5	0		-				intergenic_variant						rs59615030	1																																			MODIFIER	1	deletion														.	TGTCT	.	.																					154690132
Unknown	0	.	GRCh37	5	158982037	158982038	+	IGR	INS	-	-	A	rs35538979		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	4	3	.	0		A				intergenic_variant						rs35538979	1																				0.056	0.072		0.0714	0.1302	0.0389										MODIFIER	1	insertion														.	TGA	.	.																					158982037
Unknown	0	.	GRCh37	5	161415692	161415692	+	IGR	DEL	A	A	-	rs568464685		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs568464685	1																																			MODIFIER	1	deletion														.	AGAA	.	.																					161415691
RP11-541P9.3	0	.	GRCh37	5	162698632	162698637	+	Intron	DEL	AAAAAA	AAAAAA	-	rs5872811		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAAAA	AAAAAA																n.322+154172_322+154177del			ENST00000458002		4	.	4	0	.	0	RP11-541P9.3,intron_variant,,ENST00000458002,;RP11-541P9.3,intron_variant,,ENST00000503504,;	-	ENSG00000250061	ENST00000458002	Transcript	intron_variant,non_coding_transcript_variant						rs5872811	1		-1	RP11-541P9.3	Clone_based_vega_gene		antisense											3/4																		MODIFIER		deletion														.	TCAAAAAAA	.	.																					162698631
CTC-340A15.2	102546299	.	GRCh37	5	164532254	164532255	+	Intron	INS	-	-	CAAT	rs10645008		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.118-24563_118-24562insTCAA			ENST00000519267		3	.	3	0	.	0	CTC-340A15.2,intron_variant,,ENST00000519267,;CTC-340A15.2,intron_variant,,ENST00000519570,;CTC-340A15.2,intron_variant,,ENST00000522303,;CTC-340A15.2,intron_variant,,ENST00000522646,;	CAAT	ENSG00000241956	ENST00000519267	Transcript	intron_variant,non_coding_transcript_variant						rs10645008	1		1	CTC-340A15.2	Clone_based_vega_gene		antisense											2/2			0.8359	0.647		0.6716	0.4911	0.5532										MODIFIER		insertion														.	ACC	.	.																					164532254
CTC-340A15.2	102546299	.	GRCh37	5	164535644	164535645	+	Intron	INS	-	-	TC	rs140017076		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.118-21162_118-21161dup			ENST00000519267		3	.	3	0	.	0	CTC-340A15.2,intron_variant,,ENST00000519267,;CTC-340A15.2,intron_variant,,ENST00000519570,;CTC-340A15.2,intron_variant,,ENST00000522303,;CTC-340A15.2,intron_variant,,ENST00000522646,;	TC	ENSG00000241956	ENST00000519267	Transcript	intron_variant,non_coding_transcript_variant						rs140017076	1		1	CTC-340A15.2	Clone_based_vega_gene		antisense											2/2																		MODIFIER		insertion														.	TTT	.	.																					164535644
CTB-7E3.1	102557615	.	GRCh37	5	166330820	166330821	+	3'Flank	INS	-	-	CAAA	rs10680665		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000523742		4	.	4	0	.	0	CTB-7E3.1,downstream_gene_variant,,ENST00000523742,;	CAAA	ENSG00000254130	ENST00000523742	Transcript	downstream_gene_variant						rs10680665	1	1406	-1	CTB-7E3.1	Clone_based_vega_gene		lincRNA	YES													0.8684	0.9366		0.9514	0.8976	0.8415										MODIFIER	1	insertion														.	TCC	.	.																					166330820
WWC1	23286	.	GRCh37	5	167889247	167889248	+	Intron	INS	-	-	AGC	rs60823427		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2916+1502_2916+1503insCAG			ENST00000521089		3	.	3	0	.	0	WWC1,intron_variant,,ENST00000265293,NM_001161662.1,NM_001161661.1,NM_015238.2;WWC1,intron_variant,,ENST00000393895,;WWC1,intron_variant,,ENST00000521089,;WWC1,intron_variant,,ENST00000524038,;WWC1,intron_variant,,ENST00000524228,;WWC1,intron_variant,,ENST00000522140,;WWC1,upstream_gene_variant,,ENST00000521391,;,regulatory_region_variant,,ENSR00001702567,;	AGC	ENSG00000113645	ENST00000521089	Transcript	intron_variant						rs60823427	1		1	WWC1	HGNC	29435	protein_coding	YES	CCDS54945.1	ENSP00000427772	Q8IX03		UPI00017A7149					20/22			0.9523	0.804		0.5407	0.8022	0.7219										MODIFIER	1	insertion														.	AGA	.	.																					167889247
Unknown	0	.	GRCh37	5	168966296	168966297	+	IGR	INS	-	-	AG	rs1160923		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AG				intergenic_variant						rs1160923	1																			0.5677	0.3548	0.5476		0.754	0.6322	0.6115										MODIFIER	1	insertion														.	AAG	.	.																					168966296
DOCK2	1794	.	GRCh37	5	169126093	169126094	+	Intron	INS	-	-	CAAGTCTTTACC	rs3841609		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1056-292_1056-291insAAGTCTTTACCC			ENST00000256935		6	.	3	6	.	0	DOCK2,intron_variant,,ENST00000256935,NM_004946.2;DOCK2,upstream_gene_variant,,ENST00000520908,;DOCK2,upstream_gene_variant,,ENST00000540750,;DOCK2,intron_variant,,ENST00000519734,;DOCK2,intron_variant,,ENST00000523684,;DOCK2,intron_variant,,ENST00000519223,;DOCK2,intron_variant,,ENST00000524185,;	CAAGTCTTTACC	ENSG00000134516	ENST00000256935	Transcript	intron_variant						rs3841609	1		1	DOCK2	HGNC	2988	protein_coding	YES	CCDS4371.1	ENSP00000256935	Q92608	Q5XG91,B3KXW9	UPI00001A38CC	NM_004946.2				11/51			0.9629	0.6513		0.3859	0.4712	0.6912										MODIFIER	1	insertion													1	.	CTC	.	.																					169126093
STC2	8614	.	GRCh37	5	172745270	172745271	+	Intron	DEL	AG	AG	-	rs4041247		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																c.507-19_507-18del			ENST00000265087		23	.	3	10	.	0	STC2,intron_variant,,ENST00000265087,NM_003714.2;STC2,downstream_gene_variant,,ENST00000520648,;STC2,intron_variant,,ENST00000520593,;	-	ENSG00000113739	ENST00000265087	Transcript	intron_variant						rs4041247	1		-1	STC2	HGNC	11374	protein_coding	YES	CCDS4388.1	ENSP00000265087	O76061	Q6FHC9,E5RG57,B3KNF2	UPI00001360B8	NM_003714.2				3/3																		MODIFIER	1	deletion														.	AAAGA	.	.												0.1509	0.1332	0.1785	0.1741	0.2773	0.1564	0.1333	0.1334	0.169	172745269
Unknown	0	.	GRCh37	5	174659247	174659248	+	IGR	INS	-	-	AGAAGG	rs72395999		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		AGAAGG				intergenic_variant						rs72395999	1																																			MODIFIER	1	insertion														.	GAA	.	.																					174659247
SIMC1	375484	.	GRCh37	5	175763071	175763072	+	Intron	INS	-	-	AGGG	rs55945576		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.870-649_870-646dup			ENST00000341199		3	.	3	0	.	0	SIMC1,intron_variant,,ENST00000332772,;SIMC1,intron_variant,,ENST00000341199,NM_198567.4;SIMC1,intron_variant,,ENST00000430704,;SIMC1,intron_variant,,ENST00000443967,;	AGGG	ENSG00000170085	ENST00000341199	Transcript	intron_variant						rs55945576	1		1	SIMC1	HGNC	24779	protein_coding	YES	CCDS4398.2	ENSP00000342075	Q8NDZ2		UPI00000742BB	NM_198567.4				6/8			0.6725	0.6354		0.6349	0.7147	0.592										MODIFIER	1	insertion														.	GAA	.	.																					175763071
RP11-375B1.1	0	.	GRCh37	5	176142859	176142860	+	Intron	DEL	CT	CT	-	rs35095448		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CT	CT																n.220-8145_220-8144del			ENST00000507236		3	.	3	0	.	0	RP11-375B1.1,intron_variant,,ENST00000507236,;	-	ENSG00000248484	ENST00000507236	Transcript	intron_variant,non_coding_transcript_variant						rs35095448	1		-1	RP11-375B1.1	Clone_based_vega_gene		lincRNA	YES										1/1			0.1551	0.2349		0.127	0.2485	0.2035										MODIFIER	1	deletion														.	AACTC	.	.																					176142858
Unknown	0	.	GRCh37	5	178252377	178252378	+	IGR	DEL	AT	AT	-	rs142573217		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																					3	.	3	0	.	0		-				intergenic_variant						rs142573217	1																			0.5132	0.4697	0.4308		0.5823	0.5567	0.5143										MODIFIER	1	deletion														.	AGATT	.	.																					178252376
CTC-241N9.1	0	.	GRCh37	5	179287622	179287623	+	Frame_Shift_Ins	INS	-	-	TA	rs1611076		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.314_315dup	p.Ala106Ter	p.A106*	ENST00000499601	2/2	3	.	3	0	.	0	CTC-241N9.1,frameshift_variant,p.Ala106Ter,ENST00000499601,;C5orf45,upstream_gene_variant,,ENST00000292586,NM_016175.3;TBC1D9B,downstream_gene_variant,,ENST00000355235,NM_015043.3;TBC1D9B,downstream_gene_variant,,ENST00000356834,NM_198868.2;C5orf45,upstream_gene_variant,,ENST00000376931,NM_001017987.2;C5orf45,upstream_gene_variant,,ENST00000403396,;TBC1D9B,downstream_gene_variant,,ENST00000444477,;C5orf45,upstream_gene_variant,,ENST00000518219,;C5orf45,upstream_gene_variant,,ENST00000518235,;TBC1D9B,downstream_gene_variant,,ENST00000519746,;C5orf45,upstream_gene_variant,,ENST00000520698,;C5orf45,upstream_gene_variant,,ENST00000521333,;TBC1D9B,downstream_gene_variant,,ENST00000522472,;C5orf45,upstream_gene_variant,,ENST00000523084,;TBC1D9B,downstream_gene_variant,,ENST00000524222,;C5orf45,upstream_gene_variant,,ENST00000517338,;TBC1D9B,downstream_gene_variant,,ENST00000518085,;C5orf45,non_coding_transcript_exon_variant,,ENST00000519398,;C5orf45,upstream_gene_variant,,ENST00000519208,;C5orf45,upstream_gene_variant,,ENST00000519213,;C5orf45,upstream_gene_variant,,ENST00000519318,;C5orf45,upstream_gene_variant,,ENST00000520150,;TBC1D9B,downstream_gene_variant,,ENST00000520794,;C5orf45,upstream_gene_variant,,ENST00000520995,;C5orf45,upstream_gene_variant,,ENST00000521299,;TBC1D9B,downstream_gene_variant,,ENST00000521469,;C5orf45,upstream_gene_variant,,ENST00000522157,;C5orf45,upstream_gene_variant,,ENST00000522663,;C5orf45,upstream_gene_variant,,ENST00000523737,;C5orf45,upstream_gene_variant,,ENST00000523835,;C5orf45,upstream_gene_variant,,ENST00000524068,;,regulatory_region_variant,,ENSR00001703964,;	TA	ENSG00000245317	ENST00000499601	Transcript	frameshift_variant	793-794/1454	313-314/471	105/156	V/VX	gta/gTAta	rs1611076	1		1	CTC-241N9.1	Clone_based_vega_gene		protein_coding	YES		ENSP00000426367		D6RGH1	UPI0000197922				2/2				0.2141	0.6196		0.746	0.3598	0.6033										HIGH	1	insertion		2												.	TGT	.	.												0.4982	0.2479	0.7103	0.4473	0.7396	0.4291	0.3667	0.4761	0.5749	179287622
RASGEF1C	255426	.	GRCh37	5	179612290	179612290	+	Intron	DEL	A	A	-	rs59604565		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.-7+23738del			ENST00000361132		6	.	6	0	.	0	RASGEF1C,intron_variant,,ENST00000361132,NM_175062.3;	-	ENSG00000146090	ENST00000361132	Transcript	intron_variant						rs59604565	1		-1	RASGEF1C	HGNC	27400	protein_coding		CCDS4452.1	ENSP00000354963	Q8N431		UPI0000037308	NM_175062.3				1/13			0.997	0.9986		0.999	0.997	0.999										MODIFIER	1	deletion														.	CTAA	.	.																					179612289
MAPK9	5601	.	GRCh37	5	179680897	179680898	+	Intron	DEL	AC	AC	-	rs34715282		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																c.451-4760_451-4759del			ENST00000452135		4	.	4	0	.	0	MAPK9,intron_variant,,ENST00000343111,;MAPK9,intron_variant,,ENST00000347470,;MAPK9,intron_variant,,ENST00000393360,NM_002752.4,NM_139068.2;MAPK9,intron_variant,,ENST00000397072,;MAPK9,intron_variant,,ENST00000425491,NM_001135044.1;MAPK9,intron_variant,,ENST00000452135,;MAPK9,intron_variant,,ENST00000455781,NM_139070.2,NM_139069.2;MAPK9,intron_variant,,ENST00000539014,;MAPK9,intron_variant,,ENST00000523135,;MAPK9,intron_variant,,ENST00000524170,;MAPK9,intron_variant,,ENST00000393362,;RP11-252I14.2,upstream_gene_variant,,ENST00000523026,;	-	ENSG00000050748	ENST00000452135	Transcript	intron_variant						rs34715282	1		-1	MAPK9	HGNC	6886	protein_coding	YES	CCDS4453.1	ENSP00000394560	P45984	E5RJ57	UPI000006E3AD					5/11			0.2995	0.4841		0.7421	0.4364	0.3466										MODIFIER	1	deletion														.	AGACA	.	.																					179680896
FARS2	10667	.	GRCh37	6	5423325	5423325	+	Intron	DEL	C	C	-	rs34499406		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.773-7949del			ENST00000324331		7	.	4	2	.	0	FARS2,intron_variant,,ENST00000274680,NM_006567.3;FARS2,intron_variant,,ENST00000324331,;FARS2,intron_variant,,ENST00000445533,;	-	ENSG00000145982	ENST00000324331	Transcript	intron_variant						rs34499406	1		1	FARS2	HGNC	21062	protein_coding	YES	CCDS4494.1	ENSP00000316335	O95363	R4GMX6	UPI000006CF04					3/6		0.2232	0.0106	0.2334		0.4792	0.161	0.3037										MODIFIER	1	deletion													1	.	AGCT	.	.																					5423324
Unknown	0	.	GRCh37	6	6806698	6806698	+	IGR	DEL	A	A	-	rs11301583		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs11301583	1																				0.4054	0.4467		0.6677	0.4523	0.4816										MODIFIER	1	deletion														.	CGAA	.	.																					6806697
ENSR00001705192	0	.	GRCh37	6	7032591	7032591	+	IGR	DEL	A	A	-	rs35944141		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENSR00001705192		8	.	4	3	.	0	,regulatory_region_variant,,ENSR00001705192,;	-		ENSR00001705192	RegulatoryFeature	regulatory_region_variant						rs35944141	1																			0.2492	0.1619	0.451		0.004	0.5278	0.1902										MODIFIER	1	deletion														.	ACAG	.	.																					7032590
RREB1	6239	.	GRCh37	6	7157867	7157868	+	Intron	INS	-	-	G	rs946342394		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-284-19019dup			ENST00000379938		3	.	3	0	.	0	RREB1,intron_variant,,ENST00000334984,;RREB1,intron_variant,,ENST00000349384,NM_001003698.3;RREB1,intron_variant,,ENST00000379933,NM_001168344.1;RREB1,intron_variant,,ENST00000379938,NM_001003700.1,NM_001003699.3;RREB1,intron_variant,,ENST00000467782,;RREB1,intron_variant,,ENST00000471433,;RREB1,intron_variant,,ENST00000483150,;RREB1,intron_variant,,ENST00000491191,;RREB1,intron_variant,,ENST00000475946,;,regulatory_region_variant,,ENSR00001353550,;	G	ENSG00000124782	ENST00000379938	Transcript	intron_variant						rs946342394	1		1	RREB1	HGNC	10449	protein_coding	YES	CCDS34335.1	ENSP00000369270	Q92766	C9JU34,C9JPJ6,C9JE09	UPI000020E496	NM_001003700.1,NM_001003699.3				1/12																		MODIFIER	1	insertion													1	.	GTG	.	.																					7157867
BLOC1S5-TXNDC5	0	.	GRCh37	6	8002684	8002685	+	Intron	INS	-	-	TAAC	rs148932440		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.372+23915_372+23916insGTTA			ENST00000439343		4	.	4	0	.	0	TXNDC5,intron_variant,,ENST00000539054,;BLOC1S5-TXNDC5,intron_variant,,ENST00000439343,;	TAAC	ENSG00000259040	ENST00000439343	Transcript	intron_variant,NMD_transcript_variant						rs148932440	1		-1	BLOC1S5-TXNDC5	HGNC	42001	nonsense_mediated_decay	YES		ENSP00000454697		H3BN57	UPI0001B793F7					4/12			0.289	0.183		0.1419	0.161	0.0695										MODIFIER	1	insertion														.	TAT	.	.																					8002684
Unknown	0	.	GRCh37	6	8675612	8675615	+	IGR	DEL	TAAT	TAAT	-	rs144185570		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAAT	TAAT																					7	.	7	0	.	0		-				intergenic_variant						rs144185570	1																				0.0144	0.2536		0.2599	0.2197	0.1738										MODIFIER	1	deletion														.	ACTAATT	.	.																					8675611
Unknown	0	.	GRCh37	6	9069227	9069240	+	IGR	DEL	GTGTGTGTGTGTGT	GTGTGTGTGTGTGT	-	rs35271148		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GTGTGTGTGTGTGT	GTGTGTGTGTGTGT																					3	.	3	0	.	0		-				intergenic_variant						rs35271148	1																																			MODIFIER	1	deletion														.	GAGTGTGTGTGTGTGTG	.	.																					9069226
OFCC1	266553	.	GRCh37	6	9661051	9661052	+	Intron	DEL	AA	AA	-	rs200722880		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																c.*1555+12216_*1555+12217del			ENST00000492094		3	.	3	0	.	0	OFCC1,intron_variant,,ENST00000492094,;	-	ENSG00000181355	ENST00000492094	Transcript	intron_variant,NMD_transcript_variant						rs200722880	1		-1	OFCC1	HGNC	21017	nonsense_mediated_decay			ENSP00000473634			UPI0002B832A9					16/18																		MODIFIER	1	deletion														.	GCAAA	.	.																					9661050
RP11-716O23.1	0	.	GRCh37	6	11427631	11427631	+	Intron	DEL	G	G	-	rs59060518		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																n.230+9819del			ENST00000419796		5	.	5	0	.	0	RP11-716O23.1,intron_variant,,ENST00000419796,;,regulatory_region_variant,,ENSR00000406403,;	-	ENSG00000233656	ENST00000419796	Transcript	intron_variant,non_coding_transcript_variant						rs59060518	1		1	RP11-716O23.1	Clone_based_vega_gene		lincRNA	YES										1/2		1	1	1		1	1	1										MODIFIER	1	deletion														.	TCGA	.	.																					11427630
Unknown	0	.	GRCh37	6	16088559	16088559	+	IGR	DEL	A	A	-	rs11338836		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					5	.	5	0	.	0		-				intergenic_variant						rs11338836	1																				0.8669	0.8386		0.875	0.8211	0.8793										MODIFIER	1	deletion														.	AGAA	.	.																					16088558
Unknown	0	.	GRCh37	6	18028222	18028222	+	IGR	DEL	T	T	-	rs530142272		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs530142272	1																																			MODIFIER	1	deletion														.	CCTT	.	.																					18028221
RNF144B	255488	.	GRCh37	6	18445315	18445316	+	Intron	INS	-	-	T	rs34323770		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.331+5347dup			ENST00000259939		4	.	4	3	.	0	RNF144B,intron_variant,,ENST00000259939,NM_182757.3;RNF144B,intron_variant,,ENST00000429054,;,regulatory_region_variant,,ENSR00001706677,;	T	ENSG00000137393	ENST00000259939	Transcript	intron_variant						rs34323770	1		1	RNF144B	HGNC	21578	protein_coding	YES	CCDS34345.1	ENSP00000259939	Q7Z419		UPI00001B2DA3	NM_182757.3				4/7			0.0575	0.2205		0.0119	0.1431	0.0706										MODIFIER	1	insertion														.	GAT	.	.																					18445315
CASC15	401237	.	GRCh37	6	22108290	22108295	+	Intron	DEL	ACACAC	ACACAC	-	rs61414874		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACAC	ACACAC																n.888-2650_888-2645del			ENST00000444265		3	.	3	0	.	0	CASC15,intron_variant,,ENST00000444265,;CASC15,intron_variant,,ENST00000606851,;CASC15,intron_variant,,ENST00000607048,;	-	ENSG00000272168	ENST00000444265	Transcript	intron_variant,non_coding_transcript_variant						rs61414874	1		1	CASC15	HGNC	28245	lincRNA											6/10																		MODIFIER		deletion														.	ATACACACA	.	.																					22108289
GPLD1	2822	.	GRCh37	6	24480026	24480027	+	Intron	DEL	AT	AT	-	rs3032260		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																c.232+82_232+83del			ENST00000230036		13	.	4	11	.	0	GPLD1,intron_variant,,ENST00000230036,NM_001503.3;GPLD1,intron_variant,,ENST00000474784,;GPLD1,intron_variant,,ENST00000475417,;GPLD1,intron_variant,,ENST00000378243,;GPLD1,intron_variant,,ENST00000486892,;	-	ENSG00000112293	ENST00000230036	Transcript	intron_variant						rs3032260	1		-1	GPLD1	HGNC	4459	protein_coding	YES	CCDS4553.1	ENSP00000230036	P80108		UPI000013C91C	NM_001503.3				3/24			0.6263	0.3501		0.2649	0.508	0.4622										MODIFIER	1	deletion														.	ACATA	.	.																					24480025
GUSBP2	387036	.	GRCh37	6	26910763	26910773	+	Intron	DEL	AAGGAAAGCAG	AAGGAAAGCAG	-	rs77454751		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAGGAAAGCAG	AAGGAAAGCAG																n.240+8092_240+8102del			ENST00000479900		4	.	4	0	.	0	GUSBP2,intron_variant,,ENST00000479900,;GUSBP2,intron_variant,,ENST00000383335,;	-	ENSG00000241549	ENST00000479900	Transcript	intron_variant,non_coding_transcript_variant						rs77454751	1		-1	GUSBP2	HGNC	18792	processed_transcript											2/8																		MODIFIER	1	deletion														.	AAAAGGAAAGCAGA	.	.																					26910762
HLA-H	0	.	GRCh37	6	29860378	29860380	+	3'Flank	DEL	ATC	ATC	-	rs72217183		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATC	ATC																			ENST00000383326		3	.	3	0	.	0	HLA-H,downstream_gene_variant,,ENST00000383326,;HLA-H,downstream_gene_variant,,ENST00000383620,;HCG4P7,upstream_gene_variant,,ENST00000420084,;HLA-T,upstream_gene_variant,,ENST00000429813,;	-	ENSG00000206341	ENST00000383326	Transcript	downstream_gene_variant						rs72217183	1	3297	1	HLA-H	HGNC	4965	unprocessed_pseudogene	YES													0.7292	0.7666		0.5903	0.7336	0.6738										MODIFIER		deletion														.	GAATCA	.	.																					29860377
HLA-A	3105	.	GRCh37	6	29916036	29916036	+	3'Flank	DEL	C	C	-	rs67873629		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENST00000396634		5	.	1	6	.	6	HLA-A,downstream_gene_variant,,ENST00000376802,;HLA-A,downstream_gene_variant,,ENST00000376806,;HLA-A,downstream_gene_variant,,ENST00000376809,NM_002116.7,NM_001242758.1;HLA-A,downstream_gene_variant,,ENST00000396634,;HLA-A,downstream_gene_variant,,ENST00000461903,;HLA-A,downstream_gene_variant,,ENST00000479320,;HLA-A,downstream_gene_variant,,ENST00000495183,;HLA-A,downstream_gene_variant,,ENST00000496081,;	-	ENSG00000206503	ENST00000396634	Transcript	downstream_gene_variant						rs67873629	1	2375	1	HLA-A	HGNC	4931	protein_coding	YES	CCDS34373.1	ENSP00000379873	P04439,P16188,P13746	S5CRT1,S4TZI2,S4TZE1,R9WYX8,R4I501,R4I3H2,M9PNR0,M9PAA7,M9PAA4,M9P8Z4,M4N6L9,M1SQT4,M1KE04,M1FYE6,M1FYE3,M1FWW6,M1F5P2,Q9UEX6,Q9TQ84,Q9MYA8,Q8HWS5,Q861Q7,Q5XLD1,Q2L4E7,Q29840,Q1M2R8,Q0MSI1,O78086,O78085,O78081,O19689,L7PHV2,L7PHU7,L7PH13,L0BVP5,K9LDJ0,K9LCM8,K9L7Y8,K7WPD7,K7P600,K7P5W6,K7P5U2,K7P5E0,K7P5B6,K7P562,K7P558,J9UP83,J9TNR8,J9PWV5,J9PWL3,J7GM07,J7FNZ2,J7F8L2,I6SJ64,I6QU16,I6NS25,I6NS19,I3UI58,I3UI47,I3QHQ4,I2B2Z9,I1W1L8,H9BQ78,H6UV72,H6UV69,H6UV68,H2BE80,H2BDP5,G9I2J6,G9HW24,G3DR81,G1EPB1,G1EP98,G1EP96,G1EP95,G1EP88,G1EP78,G1EP71,G1EP55,G1EP50,G1EP19,G1EP18,G1EP05,G1ENY5,G1DUW4,G0ZMG9,G0ZMG4,G0ZMG3,G0ZMF4,G0ZDS9,G0WVA6,G0WVA0,F8RHD1,F8RHC2,F8RHB9,F8R8I1,F8R119,F8R110,F6KRP1,F6KRM4,F6IQV7,F4YU26,F4YU20,F2X604,F2X5Y0,F2X5X9,F2VNH3,F2VNH0,F2VNG0,F2VNF7,F2VNF2,F2VNE0,F2VND0,F2VNC4,E9LY14,E9LY02,E9LY00,E8ZF52,E7BY93,E7BY85,E7BBA1,E5DCM4,E5DCM2,E5DCM0,E3SG86,E2DH82,E2D5M3,E2D5L9,E2D5K9,E0YTI8,E0YTI1,E0X9K2,E0WBX4,E0WBX1,D7NSP0,D7NPA3,D7NP98,D7NP92,D7NNU1,D7NNT9,D7NNT6,D7NNT3,D7NNS2,D7NNR5,D7NNM6,D6MLN9,D6MLN3,D6MLM4,D6MLL1,D6MLK2,D6MLJ4,D6MLJ1,D6ML56,D6ML55,D6ML54,D6ML44,D6ML42,D6ML40,D6ML35,D6ML33,D6ML18,D6ML16,D6ML10,D6ML09,D6ML06,D6ML01,D6MKY9,D6MJF7,D5M8G4,D5M8G1,D5M8E4,D5G2J2,D5FIG9,D5FHQ9,D5FHN7,D5FHM5,D5FHM3,D5FHM1,D5FHK5,D5FHG0,D3U484,D3U454,D3U442,D1MYY8,D0RAY3,D0EZK0,D0EZJ9,D0AB29,C9WEL3,C9WEL2,C9WEL1,C9E1E8,C9E1E7,C8XTP8,C8XTP7,C8XTN9,C8XTN7,C8CH66,C6K4J6,C6K4I6,C6K4I1,C6K4H8,C6K4H3,C6K4H0,C6K4G0,C6K4E3,C5J029,C5J027,C5IZR4,C5IZQ3,C4PFZ1,B8YCR7,B8XRE8,B6VA02,B6ECH2,B4DVC4,B1PKY1,A7MAP4,A5PHP7,A0ZXY8	UPI000008AB1D								0.2973	0.366		0.4484	0.4225	0.364										MODIFIER	1	deletion													1	.	TACC	.	.																					29916035
HLA-A	3105	.	GRCh37	6	29916040	29916041	+	3'Flank	INS	-	-	A	rs66531952		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000396634		5	.	1	6	.	6	HLA-A,downstream_gene_variant,,ENST00000376802,;HLA-A,downstream_gene_variant,,ENST00000376806,;HLA-A,downstream_gene_variant,,ENST00000376809,NM_002116.7,NM_001242758.1;HLA-A,downstream_gene_variant,,ENST00000396634,;HLA-A,downstream_gene_variant,,ENST00000461903,;HLA-A,downstream_gene_variant,,ENST00000479320,;HLA-A,downstream_gene_variant,,ENST00000495183,;HLA-A,downstream_gene_variant,,ENST00000496081,;	A	ENSG00000206503	ENST00000396634	Transcript	downstream_gene_variant						rs66531952	1	2379	1	HLA-A	HGNC	4931	protein_coding	YES	CCDS34373.1	ENSP00000379873	P04439,P16188,P13746	S5CRT1,S4TZI2,S4TZE1,R9WYX8,R4I501,R4I3H2,M9PNR0,M9PAA7,M9PAA4,M9P8Z4,M4N6L9,M1SQT4,M1KE04,M1FYE6,M1FYE3,M1FWW6,M1F5P2,Q9UEX6,Q9TQ84,Q9MYA8,Q8HWS5,Q861Q7,Q5XLD1,Q2L4E7,Q29840,Q1M2R8,Q0MSI1,O78086,O78085,O78081,O19689,L7PHV2,L7PHU7,L7PH13,L0BVP5,K9LDJ0,K9LCM8,K9L7Y8,K7WPD7,K7P600,K7P5W6,K7P5U2,K7P5E0,K7P5B6,K7P562,K7P558,J9UP83,J9TNR8,J9PWV5,J9PWL3,J7GM07,J7FNZ2,J7F8L2,I6SJ64,I6QU16,I6NS25,I6NS19,I3UI58,I3UI47,I3QHQ4,I2B2Z9,I1W1L8,H9BQ78,H6UV72,H6UV69,H6UV68,H2BE80,H2BDP5,G9I2J6,G9HW24,G3DR81,G1EPB1,G1EP98,G1EP96,G1EP95,G1EP88,G1EP78,G1EP71,G1EP55,G1EP50,G1EP19,G1EP18,G1EP05,G1ENY5,G1DUW4,G0ZMG9,G0ZMG4,G0ZMG3,G0ZMF4,G0ZDS9,G0WVA6,G0WVA0,F8RHD1,F8RHC2,F8RHB9,F8R8I1,F8R119,F8R110,F6KRP1,F6KRM4,F6IQV7,F4YU26,F4YU20,F2X604,F2X5Y0,F2X5X9,F2VNH3,F2VNH0,F2VNG0,F2VNF7,F2VNF2,F2VNE0,F2VND0,F2VNC4,E9LY14,E9LY02,E9LY00,E8ZF52,E7BY93,E7BY85,E7BBA1,E5DCM4,E5DCM2,E5DCM0,E3SG86,E2DH82,E2D5M3,E2D5L9,E2D5K9,E0YTI8,E0YTI1,E0X9K2,E0WBX4,E0WBX1,D7NSP0,D7NPA3,D7NP98,D7NP92,D7NNU1,D7NNT9,D7NNT6,D7NNT3,D7NNS2,D7NNR5,D7NNM6,D6MLN9,D6MLN3,D6MLM4,D6MLL1,D6MLK2,D6MLJ4,D6MLJ1,D6ML56,D6ML55,D6ML54,D6ML44,D6ML42,D6ML40,D6ML35,D6ML33,D6ML18,D6ML16,D6ML10,D6ML09,D6ML06,D6ML01,D6MKY9,D6MJF7,D5M8G4,D5M8G1,D5M8E4,D5G2J2,D5FIG9,D5FHQ9,D5FHN7,D5FHM5,D5FHM3,D5FHM1,D5FHK5,D5FHG0,D3U484,D3U454,D3U442,D1MYY8,D0RAY3,D0EZK0,D0EZJ9,D0AB29,C9WEL3,C9WEL2,C9WEL1,C9E1E8,C9E1E7,C8XTP8,C8XTP7,C8XTN9,C8XTN7,C8CH66,C6K4J6,C6K4I6,C6K4I1,C6K4H8,C6K4H3,C6K4H0,C6K4G0,C6K4E3,C5J029,C5J027,C5IZR4,C5IZQ3,C4PFZ1,B8YCR7,B8XRE8,B6VA02,B6ECH2,B4DVC4,B1PKY1,A7MAP4,A5PHP7,A0ZXY8	UPI000008AB1D								0.4123	0.5101		0.5823	0.5636	0.5532										MODIFIER	1	insertion													1	.	TGT	.	.																					29916040
HCG9	10255	.	GRCh37	6	29944101	29944102	+	Intron	INS	-	-	TAA	rs3842131		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.406+816_406+818dup			ENST00000376800		4	.	4	0	.	0	HCG9,intron_variant,,ENST00000376800,;HCG9,upstream_gene_variant,,ENST00000463275,;MICD,upstream_gene_variant,,ENST00000413248,;,regulatory_region_variant,,ENSR00000195350,;,regulatory_region_variant,,ENSR00001358316,;	TAA	ENSG00000204625	ENST00000376800	Transcript	intron_variant,non_coding_transcript_variant						rs3842131	1		1	HCG9	HGNC	21243	lincRNA	YES										1/2																		MODIFIER	1	insertion														.	ACT	.	.																					29944101
TRIM39	56658	.	GRCh37	6	30302084	30302085	+	Intron	INS	-	-	TTCT	rs35724275		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.550-1435_550-1432dup			ENST00000376656		6	.	6	0	.	0	TRIM39,intron_variant,,ENST00000376656,NM_021253.3;TRIM39,intron_variant,,ENST00000376659,NM_172016.2;TRIM39,intron_variant,,ENST00000396547,;TRIM39,intron_variant,,ENST00000396548,;TRIM39,intron_variant,,ENST00000396551,;TRIM39,intron_variant,,ENST00000420746,;TRIM39,intron_variant,,ENST00000428728,;TRIM39-RPP21,intron_variant,,ENST00000513556,NM_001199119.1;TRIM39,intron_variant,,ENST00000540416,;TRIM39,downstream_gene_variant,,ENST00000428404,;TRIM39,downstream_gene_variant,,ENST00000428555,;TRIM39,downstream_gene_variant,,ENST00000440271,;TRIM39,downstream_gene_variant,,ENST00000458516,;,regulatory_region_variant,,ENSR00001707840,;	TTCT	ENSG00000204599	ENST00000376656	Transcript	intron_variant						rs35724275	1		1	TRIM39	HGNC	10065	protein_coding	YES	CCDS34377.1	ENSP00000365844	Q9HCM9	A2AAZ5,A2AAZ4,A2AAZ3,A2AAZ2	UPI000013D097	NM_021253.3				4/8			0.857	0.7104		0.7212	0.6302	0.8497										MODIFIER	1	insertion														.	AAT	.	.																					30302084
CDSN	1041	.	GRCh37	6	31083798	31083800	+	3'UTR	DEL	CTT	-	-	rs56899166		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTT	CTT																c.*2_*4del			ENST00000376288	2/2	5	.	0	4	.	3	CDSN,3_prime_UTR_variant,,ENST00000376288,NM_001264.4;PSORS1C1,intron_variant,,ENST00000259881,NM_014068.2;C6orf15,upstream_gene_variant,,ENST00000259870,NM_014070.2;PSORS1C1,non_coding_transcript_exon_variant,,ENST00000467107,;PSORS1C1,intron_variant,,ENST00000479581,;PSORS1C1,intron_variant,,ENST00000493289,;PSORS1C1,intron_variant,,ENST00000548049,;PSORS1C1,intron_variant,,ENST00000550838,;PSORS1C1,intron_variant,,ENST00000552747,;,regulatory_region_variant,,ENSR00001707952,;	-	ENSG00000204539	ENST00000376288	Transcript	3_prime_UTR_variant	1619-1621/2552					rs56899166	1		-1	CDSN	HGNC	1802	protein_coding	YES	CCDS34389.1	ENSP00000365465		Q7Z560,G8JLG2	UPI00001AFE92	NM_001264.4			2/2				0.7065	0.6138		0.7113	0.5487	0.6247	0.6565	0.4893			24200957					MODIFIER	1	deletion													1	.	GACTTC	.	.												0.5736	0.6798	0.5877	0.6637	0.7233	0.5098	0.5144	0.5888	0.6427	31083797
RNU6-283P	0	.	GRCh37	6	31336926	31336927	+	5'Flank	INS	-	-	TT	rs9281394		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000364788		4	.	4	0	.	0	RNU6-283P,upstream_gene_variant,,ENST00000364788,;DHFRP2,upstream_gene_variant,,ENST00000414224,;	TT	ENSG00000201658	ENST00000364788	Transcript	upstream_gene_variant						rs9281394	1	984	1	RNU6-283P	HGNC	47246	snRNA	YES													0.854	0.9193		0.9306	0.839	0.9294										MODIFIER		insertion														.	ACG	.	.																					31336926
C6orf10	10665	.	GRCh37	6	32335558	32335559	+	Intron	INS	-	-	AGAG	rs3038543		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.166+140_166+143dup			ENST00000447241		3	.	3	0	.	0	C6orf10,intron_variant,,ENST00000375007,;C6orf10,intron_variant,,ENST00000375015,;C6orf10,intron_variant,,ENST00000442822,;C6orf10,intron_variant,,ENST00000447241,NM_006781.3;C6orf10,intron_variant,,ENST00000527965,;C6orf10,intron_variant,,ENST00000532023,;C6orf10,intron_variant,,ENST00000533191,NM_001286475.1,NM_001286474.1;C6orf10,intron_variant,,ENST00000534588,;	AGAG	ENSG00000204296	ENST00000447241	Transcript	intron_variant						rs3038543	1		-1	C6orf10	HGNC	13922	protein_coding	YES	CCDS34422.1	ENSP00000415517	Q5SRN2		UPI0000470279	NM_006781.3				4/22			0.6974	0.7983		0.871	0.7823	0.8998										MODIFIER	1	insertion														.	AAA	.	.																					32335558
HLA-DQB2	3120	.	GRCh37	6	32721410	32721411	+	3'Flank	DEL	TG	TG	-	rs9280175		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																			ENST00000411527		4	.	4	0	.	0	HLA-DQB2,downstream_gene_variant,,ENST00000411527,NM_001198858.1;HLA-DQB2,downstream_gene_variant,,ENST00000427449,;HLA-DQB2,downstream_gene_variant,,ENST00000435145,;HLA-DQB2,downstream_gene_variant,,ENST00000437316,;MIR3135B,upstream_gene_variant,,ENST00000581098,;	-	ENSG00000232629	ENST00000411527	Transcript	downstream_gene_variant						rs9280175	1	2464	-1	HLA-DQB2	HGNC	4945	protein_coding	YES	CCDS56419.1	ENSP00000390431	P05538		UPI0000457414	NM_001198858.1							0.6369	0.7147		0.8075	0.6133	0.6718										MODIFIER	1	deletion														.	ATTGT	.	.																					32721409
GRM4	2914	.	GRCh37	6	34108114	34108115	+	Intron	INS	-	-	G	rs5875496		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-364+5662dup			ENST00000538487		5	.	5	0	.	0	GRM4,intron_variant,,ENST00000374177,NM_001256809.1;GRM4,intron_variant,,ENST00000538487,NM_000841.2,NM_001256811.1;GRM4,intron_variant,,ENST00000609278,NM_001282847.1;	G	ENSG00000124493	ENST00000538487	Transcript	intron_variant						rs5875496	1		-1	GRM4	HGNC	4596	protein_coding	YES	CCDS4787.1	ENSP00000440556	Q14833	A8K0J8,A1L4F9	UPI000004A7DE	NM_000841.2,NM_001256811.1				1/10			0.5817	0.8026		0.5248	0.6342	0.5297										MODIFIER	1	insertion														.	ATG	.	.																					34108114
C6orf1	221491	.	GRCh37	6	34221259	34221273	+	5'Flank	DEL	AAAAAAAAAAAAAAG	AAAAAAAAAAAAAAG	-	rs150005915		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAAAAAAAAAAAAG	AAAAAAAAAAAAAAG																			ENST00000476320		3	.	3	0	.	0	C6orf1,upstream_gene_variant,,ENST00000335352,NM_001287397.1;C6orf1,upstream_gene_variant,,ENST00000394990,NM_001008704.1;C6orf1,upstream_gene_variant,,ENST00000413013,NM_001287398.1;C6orf1,upstream_gene_variant,,ENST00000468145,NM_001287396.1;C6orf1,upstream_gene_variant,,ENST00000476320,NM_001008703.1;C6orf1,upstream_gene_variant,,ENST00000481533,NM_178508.3;C6orf1,upstream_gene_variant,,ENST00000463083,;C6orf1,upstream_gene_variant,,ENST00000495581,;	-	ENSG00000186577	ENST00000476320	Transcript	upstream_gene_variant						rs150005915	1	4012	-1	C6orf1	HGNC	1340	protein_coding	YES	CCDS4790.1	ENSP00000417604	Q86T20	G8JLJ3	UPI00001618A4	NM_001008703.1							0.9365	0.9712		0.999	0.998	1										MODIFIER	1	deletion														.	AAAAAAAAAAAAAAAAGA	.	.																					34221258
Unknown	0	.	GRCh37	6	38635140	38635141	+	IGR	INS	-	-	C	rs113577879		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		C				intergenic_variant						rs113577879	1																				0.4183	0.3746		0.2431	0.3976	0.3067										MODIFIER	1	insertion														.	GGC	.	.																					38635140
DNAH8	1769	.	GRCh37	6	38804223	38804223	+	Intron	DEL	A	A	-	rs71543945		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.3715-1485del			ENST00000359357		3	.	3	0	.	0	DNAH8,intron_variant,,ENST00000327475,NM_001206927.1;DNAH8,intron_variant,,ENST00000359357,;DNAH8,intron_variant,,ENST00000441566,;DNAH8,intron_variant,,ENST00000449981,;	-	ENSG00000124721	ENST00000359357	Transcript	intron_variant						rs71543945	1		1	DNAH8	HGNC	2952	protein_coding	YES		ENSP00000352312	Q96JB1		UPI00003677EB					30/90																		MODIFIER	1	deletion														.	TCAA	.	.																					38804222
Unknown	0	.	GRCh37	6	39204832	39204855	+	IGR	DEL	ATATATGAGGTCACCACTCCCCTC	ATATATGAGGTCACCACTCCCCTC	-	rs59614432		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATATATGAGGTCACCACTCCCCTC	ATATATGAGGTCACCACTCCCCTC																					3	.	3	0	.	0		-				intergenic_variant						rs59614432	1																				0.0333	0.4294		0.2212	0.5427	0.5583										MODIFIER	1	deletion														.	ATATATATGAGGTCACCACTCCCCTCA	.	.																					39204831
Unknown	0	.	GRCh37	6	40644957	40644958	+	IGR	INS	-	-	T	rs113587752		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					7	.	4	3	.	0		T				intergenic_variant						rs113587752	1																				0.0885	0.1873		0.1905	0.2594	0.2025										MODIFIER	1	insertion														.	CCT	.	.																					40644957
CCND3	896	.	GRCh37	6	41969852	41969853	+	Intron	INS	-	-	A	rs55946125		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-46+46386dup			ENST00000372988		3	.	3	0	.	0	CCND3,intron_variant,,ENST00000372988,NM_001136017.2;CCND3,intron_variant,,ENST00000415497,NM_001136126.1;CCND3,intron_variant,,ENST00000502771,;CCND3,intron_variant,,ENST00000508143,;CCND3,intron_variant,,ENST00000510503,;CCND3,intron_variant,,ENST00000511642,;CCND3,intron_variant,,ENST00000514588,;CCND3,intron_variant,,ENST00000511686,;CCND3,intron_variant,,ENST00000513956,;CCND3,intron_variant,,ENST00000514382,;CCND3,intron_variant,,ENST00000505672,;CCND3,intron_variant,,ENST00000505884,;CCND3,intron_variant,,ENST00000511161,;	A	ENSG00000112576	ENST00000372988	Transcript	intron_variant						rs55946125	1		-1	CCND3	HGNC	1585	protein_coding		CCDS47426.1	ENSP00000362079	P30281	D6RIX2,D6RDL3	UPI000178DF96	NM_001136017.2				1/4			0.7148	0.8429		0.8621	0.8728	0.8497										MODIFIER	1	insertion													1	.	TTA	.	.																					41969852
RUNX2	860	.	GRCh37	6	45521848	45521851	+	3'Flank	DEL	TGTG	TGTG	-	rs70996341		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGTG	TGTG																			ENST00000371438		3	.	3	3	.	0	RUNX2,intron_variant,,ENST00000576263,;RUNX2,downstream_gene_variant,,ENST00000359524,;RUNX2,downstream_gene_variant,,ENST00000371432,NM_001278478.1;RUNX2,downstream_gene_variant,,ENST00000371438,NM_001024630.3;RUNX2,intron_variant,,ENST00000478660,;,regulatory_region_variant,,ENSR00001362539,;	-	ENSG00000124813	ENST00000371438	Transcript	downstream_gene_variant						rs70996341	1	3032	1	RUNX2	HGNC	10472	protein_coding	YES	CCDS43467.2	ENSP00000360493	Q13950	U3RG86	UPI000013532F	NM_001024630.3							0.112	0.304		0.0456	0.34	0.2178										MODIFIER	1	deletion													1	.	TATGTGT	.	.																					45521847
GPR115	221393	.	GRCh37	6	47665768	47665768	+	5'Flank	DEL	G	G	-	rs3215998		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																			ENST00000283303		8	.	8	3	.	0	GPR115,intron_variant,,ENST00000371220,;GPR115,upstream_gene_variant,,ENST00000283303,NM_153838.3;GPR115,upstream_gene_variant,,ENST00000327753,;GPR111,downstream_gene_variant,,ENST00000398742,;GPR111,downstream_gene_variant,,ENST00000467205,NM_153839.6;,regulatory_region_variant,,ENSR00001710382,;	-	ENSG00000153294	ENST00000283303	Transcript	upstream_gene_variant						rs3215998	1	521	1	GPR115	HGNC	19011	protein_coding	YES	CCDS4922.2	ENSP00000283303	Q8IZF3		UPI000046FF2B	NM_153838.3						0.3758	0.1573	0.5216		0.6915	0.3678	0.2505										MODIFIER	1	deletion														.	TAGA	.	.																					47665767
Unknown	0	.	GRCh37	6	48341273	48341274	+	IGR	INS	-	-	A	rs369904395		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		A				intergenic_variant						rs369904395	1																				0.3283	0.1671		0.1171	0.0905	0.1575										MODIFIER	1	insertion														.	TTA	.	.																					48341273
CENPQ	55166	.	GRCh37	6	49450369	49450375	+	Intron	DEL	TCGGCGA	TCGGCGA	-	rs58765118		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCGGCGA	TCGGCGA																c.477+1577_477+1583del			ENST00000335783		6	.	3	5	.	0	CENPQ,intron_variant,,ENST00000335783,NM_018132.3;	-	ENSG00000031691	ENST00000335783	Transcript	intron_variant						rs58765118	1		1	CENPQ	HGNC	21347	protein_coding	YES	CCDS4925.1	ENSP00000337289	Q7L2Z9		UPI000020DE7B	NM_018132.3				6/8			0.4251	0.6066		0.5208	0.4135	0.3221										MODIFIER	1	deletion														.	GCTCGGCGAT	.	.																					49450368
TFAP2D	83741	.	GRCh37	6	50680321	50680322	+	5'Flank	INS	-	-	A	rs398084929		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000008391		3	.	3	0	.	0	TFAP2D,upstream_gene_variant,,ENST00000008391,NM_172238.3;	A	ENSG00000008197	ENST00000008391	Transcript	upstream_gene_variant						rs398084929	1	1219	1	TFAP2D	HGNC	15581	protein_coding	YES	CCDS4933.1	ENSP00000008391	Q7Z6R9		UPI00001A3A89	NM_172238.3							0.0915	0.2089		0.4345	0.3131	0.2301										MODIFIER	1	insertion														.	CTA	.	.																					50680321
GCM1	8521	.	GRCh37	6	52998130	52998131	+	Intron	DEL	TG	TG	-	rs5876306		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																c.328+739_328+740del			ENST00000259803		4	.	4	0	.	0	GCM1,intron_variant,,ENST00000259803,NM_003643.3;	-	ENSG00000137270	ENST00000259803	Transcript	intron_variant						rs5876306	1		-1	GCM1	HGNC	4197	protein_coding	YES	CCDS4950.1	ENSP00000259803	Q9NP62		UPI0000073F99	NM_003643.3				3/5																		MODIFIER	1	deletion														.	AATGT	.	.																					52998129
DST	667	.	GRCh37	6	56473006	56473007	+	Intron	INS	-	-	T	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.3672+2218dup			ENST00000244364		57	.	32	61	.	59	DST,frameshift_variant,p.Asn2107LysfsTer6,ENST00000370754,;DST,frameshift_variant,p.Asn1929LysfsTer6,ENST00000370769,;DST,frameshift_variant,p.Asn1929LysfsTer6,ENST00000312431,;DST,frameshift_variant,p.Asn1603LysfsTer6,ENST00000446842,;DST,frameshift_variant,p.Asn1929LysfsTer6,ENST00000361203,;DST,frameshift_variant,p.Asn1603LysfsTer6,ENST00000439203,;DST,intron_variant,,ENST00000244364,NM_015548.4;DST,intron_variant,,ENST00000370788,NM_001144769.2,NM_183380.3,NM_001144770.1;DST,intron_variant,,ENST00000421834,;	T	ENSG00000151914	ENST00000244364	Transcript	intron_variant							1		-1	DST	HGNC	1090	protein_coding	YES	CCDS47443.1	ENSP00000244364	Q03001	Q86T18	UPI00001C1577	NM_015548.4				25/83																		MODIFIER	1	insertion													1	.	TAT	.	.																					56473006
PRIM2	5558	.	GRCh37	6	57262323	57262324	+	Intron	INS	-	-	G	rs142886884		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.693+15357_693+15358insG			ENST00000607273		6	.	3	3	.	0	PRIM2,intron_variant,,ENST00000607273,NM_000947.3;PRIM2,intron_variant,,ENST00000389488,;PRIM2,intron_variant,,ENST00000490313,;	G	ENSG00000146143	ENST00000607273	Transcript	intron_variant						rs142886884	1		1	PRIM2	HGNC	9370	protein_coding	YES		ENSP00000475738		U3KQB9,I0CMK6,I0CMJ8,H9XFA6	UPI00004588DE	NM_000947.3				7/13																		MODIFIER	1	insertion														.	TTT	.	.																					57262323
PRIM2	5558	.	GRCh37	6	57314153	57314154	+	Intron	INS	-	-	TTG	rs74362561		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.694-58132_694-58130dup			ENST00000607273		3	.	3	0	.	0	PRIM2,intron_variant,,ENST00000607273,NM_000947.3;PRIM2,intron_variant,,ENST00000389488,;	TTG	ENSG00000146143	ENST00000607273	Transcript	intron_variant						rs74362561	1		1	PRIM2	HGNC	9370	protein_coding	YES		ENSP00000475738		U3KQB9,I0CMK6,I0CMJ8,H9XFA6	UPI00004588DE	NM_000947.3				7/13																		MODIFIER	1	insertion														.	TAT	.	.																					57314153
PRIM2	5558	.	GRCh37	6	57388106	57388106	+	Intron	DEL	A	A	-	rs55988029		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.762-5006del			ENST00000607273		4	.	4	0	.	0	PRIM2,intron_variant,,ENST00000607273,NM_000947.3;PRIM2,intron_variant,,ENST00000389488,;PRIM2,intron_variant,,ENST00000470638,;PRIM2,upstream_gene_variant,,ENST00000550475,;,regulatory_region_variant,,ENSR00001364914,;	-	ENSG00000146143	ENST00000607273	Transcript	intron_variant						rs55988029	1		1	PRIM2	HGNC	9370	protein_coding	YES		ENSP00000475738		U3KQB9,I0CMK6,I0CMJ8,H9XFA6	UPI00004588DE	NM_000947.3				8/13																		MODIFIER	1	deletion														.	CTAC	.	.																					57388105
PRIM2	5558	.	GRCh37	6	57406654	57406655	+	Intron	INS	-	-	T	rs66899453		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1020+8338dup			ENST00000607273		6	.	6	0	.	0	PRIM2,intron_variant,,ENST00000607273,NM_000947.3;PRIM2,intron_variant,,ENST00000389488,;PRIM2,intron_variant,,ENST00000550475,;	T	ENSG00000146143	ENST00000607273	Transcript	intron_variant						rs66899453	1		1	PRIM2	HGNC	9370	protein_coding	YES		ENSP00000475738		U3KQB9,I0CMK6,I0CMJ8,H9XFA6	UPI00004588DE	NM_000947.3				10/13																		MODIFIER	1	insertion														.	AGT	.	.																					57406654
PRIM2	5558	.	GRCh37	6	57488800	57488800	+	Intron	DEL	G	G	-	rs111409818		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.*190-10167del			ENST00000607273		9	.	3	6	.	0	PRIM2,intron_variant,,ENST00000607273,NM_000947.3;PRIM2,intron_variant,,ENST00000389488,;	-	ENSG00000146143	ENST00000607273	Transcript	intron_variant						rs111409818	1		1	PRIM2	HGNC	9370	protein_coding	YES		ENSP00000475738		U3KQB9,I0CMK6,I0CMJ8,H9XFA6	UPI00004588DE	NM_000947.3				12/13																		MODIFIER	1	deletion														.	CAGT	.	.																					57488799
PRIM2	5558	.	GRCh37	6	57503445	57503445	+	Intron	DEL	C	C	-	rs11343070		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																c.*258+4410del			ENST00000607273		6	.	4	3	.	0	PRIM2,intron_variant,,ENST00000607273,NM_000947.3;PRIM2,intron_variant,,ENST00000389488,;	-	ENSG00000146143	ENST00000607273	Transcript	intron_variant						rs11343070	1		1	PRIM2	HGNC	9370	protein_coding	YES		ENSP00000475738		U3KQB9,I0CMK6,I0CMJ8,H9XFA6	UPI00004588DE	NM_000947.3				13/13																		MODIFIER	1	deletion														.	CACA	.	.																					57503444
Unknown	0	.	GRCh37	6	57539905	57539906	+	IGR	INS	-	-	TTTCCATA	rs371730861		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TTTCCATA				intergenic_variant						rs371730861	1																																			MODIFIER	1	insertion														.	TTT	.	.																					57539905
Unknown	0	.	GRCh37	6	63670853	63670854	+	IGR	INS	-	-	C	rs35604933		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		C				intergenic_variant						rs35604933	1																				0.5287	0.7262		0.751	0.5885	0.7086										MODIFIER	1	insertion														.	TAT	.	.																					63670853
LGSN	51557	.	GRCh37	6	63986922	63986923	+	3'Flank	INS	-	-	A	rs5876850		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000370657		3	.	3	0	.	0	LGSN,3_prime_UTR_variant,,ENST00000370658,NM_016571.2,NM_001143940.1;LGSN,downstream_gene_variant,,ENST00000370657,;LGSN,downstream_gene_variant,,ENST00000485906,;	A	ENSG00000146166	ENST00000370657	Transcript	downstream_gene_variant						rs5876850	1	2618	-1	LGSN	HGNC	21016	protein_coding	YES	CCDS4964.1	ENSP00000359691	Q5TDP6		UPI000013DA35								0.3601	0.3862		0.4484	0.492	0.3814										MODIFIER	1	insertion														.	ACA	.	.																					63986922
Unknown	0	.	GRCh37	6	67263544	67263544	+	IGR	DEL	T	T	-	rs34677477		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs34677477	1																				0.4039	0.1902		0.0952	0.2992	0.2802										MODIFIER	1	deletion														.	TGTT	.	.																					67263543
Unknown	0	.	GRCh37	6	67846718	67846719	+	IGR	DEL	AT	AT	-	rs139946808		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																					6	.	3	4	.	0		-				intergenic_variant						rs139946808	1																			0.5184	0.3366	0.5245		0.5933	0.5467	0.6534										MODIFIER	1	deletion														.	ACATG	.	.																					67846717
COL19A1	1310	.	GRCh37	6	70688016	70688020	+	Intron	DEL	GAGAA	GAGAA	-	rs70987492		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAGAA	GAGAA																c.1026+15257_1026+15261del			ENST00000322773		3	.	3	0	.	0	COL19A1,intron_variant,,ENST00000322773,NM_001858.4;COL19A1,downstream_gene_variant,,ENST00000483745,;	-	ENSG00000082293	ENST00000322773	Transcript	intron_variant						rs70987492	1		1	COL19A1	HGNC	2196	protein_coding	YES	CCDS4970.1	ENSP00000316030	Q14993		UPI000004F1E3	NM_001858.4				11/50			0.0121	0.2176		0.2748	0.325	0.271										MODIFIER	1	deletion														.	CTGAGAAG	.	.																					70688015
OGFRL1	79627	.	GRCh37	6	72022860	72022861	+	3'Flank	DEL	AA	AA	-	rs35372424		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																			ENST00000370435		6	.	6	0	.	0	OGFRL1,downstream_gene_variant,,ENST00000370435,NM_024576.3;RP3-331H24.5,intron_variant,,ENST00000602823,;RP11-154D6.1,intron_variant,,ENST00000434683,;RP11-154D6.1,intron_variant,,ENST00000450998,;RP11-154D6.1,intron_variant,,ENST00000585882,;RP11-154D6.1,intron_variant,,ENST00000585945,;RP11-154D6.1,intron_variant,,ENST00000586030,;RP11-154D6.1,intron_variant,,ENST00000586232,;RP11-154D6.1,intron_variant,,ENST00000587015,;RP11-154D6.1,intron_variant,,ENST00000587036,;RP11-154D6.1,intron_variant,,ENST00000587253,;RP11-154D6.1,intron_variant,,ENST00000587397,;RP11-154D6.1,intron_variant,,ENST00000588612,;RP11-154D6.1,intron_variant,,ENST00000589255,;RP11-154D6.1,intron_variant,,ENST00000590213,;RP11-154D6.1,intron_variant,,ENST00000590780,;RP11-154D6.1,intron_variant,,ENST00000591156,;RP11-154D6.1,upstream_gene_variant,,ENST00000412751,;RP11-154D6.1,upstream_gene_variant,,ENST00000423255,;RP11-154D6.1,upstream_gene_variant,,ENST00000432050,;RP11-154D6.1,upstream_gene_variant,,ENST00000586974,;,regulatory_region_variant,,ENSR00001711683,;	-	ENSG00000119900	ENST00000370435	Transcript	downstream_gene_variant						rs35372424	1	4207	1	OGFRL1	HGNC	21378	protein_coding	YES	CCDS34482.1	ENSP00000359464	Q5TC84		UPI000021D446	NM_024576.3							0.2141	0.402		0.3433	0.2207	0.1677										MODIFIER	1	deletion														.	ATAAA	.	.																					72022859
Unknown	0	.	GRCh37	6	79138140	79138140	+	IGR	DEL	T	T	-	rs60375620		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					5	.	5	4	.	0		-				intergenic_variant						rs60375620	1																				0.4705	0.3689		0.252	0.3807	0.2689										MODIFIER	1	deletion														.	GATT	.	.																					79138139
UBE3D	90025	.	GRCh37	6	83703070	83703071	+	Intron	INS	-	-	AT	rs10680743		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1010+25621_1010+25622insAT			ENST00000369747		3	.	3	0	.	0	UBE3D,intron_variant,,ENST00000369747,NM_198920.1;UBE3D,intron_variant,,ENST00000237186,;UBE3D,intron_variant,,ENST00000430071,;UBE3D,intron_variant,,ENST00000509102,;	AT	ENSG00000118420	ENST00000369747	Transcript	intron_variant						rs10680743	1		-1	UBE3D	HGNC	21381	protein_coding	YES	CCDS34491.1	ENSP00000358762	Q7Z6J8	D6RHY9	UPI0000160DBE	NM_198920.1				8/9			0.8563	0.8876		0.9454	0.8738	0.9182										MODIFIER	1	insertion														.	ACA	.	.																					83703070
Unknown	0	.	GRCh37	6	85316464	85316464	+	IGR	DEL	T	T	-	rs60178649		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs60178649	1																				0.8064	0.7349		0.7808	0.9026	0.9243										MODIFIER	1	deletion														.	TATT	.	.																					85316463
RPL7P27	0	.	GRCh37	6	86801532	86801533	+	5'Flank	INS	-	-	CTGAGGCATTGCCTCA	rs71006499		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000403775		3	.	3	0	.	0	RPL7P27,upstream_gene_variant,,ENST00000403775,;	CTGAGGCATTGCCTCA	ENSG00000220069	ENST00000403775	Transcript	upstream_gene_variant						rs71006499	1	4680	-1	RPL7P27	HGNC	36649	processed_pseudogene	YES													0.9917	0.9611		0.997	0.9374	0.9847										MODIFIER	1	insertion														.	CCC	.	.																					86801532
RNGTT	8732	.	GRCh37	6	89454400	89454404	+	Intron	DEL	TATGA	TATGA	-	rs66750671		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TATGA	TATGA																c.1439+25089_1439+25093del			ENST00000369485		3	.	3	0	.	0	RNGTT,intron_variant,,ENST00000265607,NM_001286428.1,NM_001286426.1;RNGTT,intron_variant,,ENST00000369475,;RNGTT,intron_variant,,ENST00000369485,NM_003800.3;RNGTT,intron_variant,,ENST00000538899,;	-	ENSG00000111880	ENST00000369485	Transcript	intron_variant						rs66750671	1		-1	RNGTT	HGNC	10073	protein_coding	YES	CCDS5017.1	ENSP00000358497	O60942	Q7Z3R6,B4DIQ0	UPI000012ED6E	NM_003800.3				13/15																		MODIFIER	1	deletion														.	GCTATGAT	.	.																					89454399
ENSR00001369164	0	.	GRCh37	6	89742782	89742783	+	IGR	INS	-	-	ATTTTTTTTTC	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001369164		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001369164,;	ATTTTTTTTTC		ENSR00001369164	RegulatoryFeature	regulatory_region_variant							1																																			MODIFIER	1	insertion														.	TAA	.	.																					89742782
MDN1	23195	.	GRCh37	6	90474976	90474977	+	Intron	DEL	AC	AC	-	rs5878110		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																c.2145-2728_2145-2727del			ENST00000369393		3	.	3	0	.	0	MDN1,intron_variant,,ENST00000369393,;MDN1,intron_variant,,ENST00000428876,NM_014611.1;MDN1,intron_variant,,ENST00000439638,;	-	ENSG00000112159	ENST00000369393	Transcript	intron_variant						rs5878110	1		-1	MDN1	HGNC	18302	protein_coding	YES	CCDS5024.1	ENSP00000358400	Q9NU22	M0QXR3	UPI000013C4B8					15/101			0.9092	0.8646		0.9177	0.7992	0.681										MODIFIER	1	deletion														.	ATACA	.	.																					90474975
BACH2	60468	.	GRCh37	6	90806991	90806991	+	Intron	DEL	T	T	-	rs5878115		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.-161-8163del			ENST00000257749		3	.	3	0	.	0	BACH2,intron_variant,,ENST00000257749,NM_021813.2;BACH2,intron_variant,,ENST00000343122,;BACH2,intron_variant,,ENST00000406998,;BACH2,intron_variant,,ENST00000453877,;BACH2,intron_variant,,ENST00000537989,NM_001170794.1;BACH2,intron_variant,,ENST00000470301,;BACH2,intron_variant,,ENST00000472023,;BACH2,intron_variant,,ENST00000493201,;,regulatory_region_variant,,ENSR00001712963,;	-	ENSG00000112182	ENST00000257749	Transcript	intron_variant						rs5878115	1		-1	BACH2	HGNC	14078	protein_coding	YES	CCDS5026.1	ENSP00000257749	Q9BYV9	S0BE05,S0BDZ6,S0BDY5,Q7Z6Q0	UPI000004F8AD	NM_021813.2				4/8			0.9569	0.7997		0.9782	0.7087	0.8599										MODIFIER	1	deletion														.	GATT	.	.																					90806990
Unknown	0	.	GRCh37	6	93552771	93552772	+	IGR	DEL	TC	TC	-	rs5878271		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TC	TC																					3	.	3	0	.	0		-				intergenic_variant						rs5878271	1																																			MODIFIER	1	deletion														.	TGTCT	.	.																					93552770
Unknown	0	.	GRCh37	6	94210956	94210957	+	IGR	INS	-	-	TGTT	rs61542359		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		TGTT				intergenic_variant						rs61542359	1																				0.5915	0.1916		0.1161	0.1193	0.0971										MODIFIER	1	insertion														.	TCT	.	.																					94210956
RP11-524K14.1	0	.	GRCh37	6	94601224	94601225	+	3'Flank	INS	-	-	TAAAC	rs111676124		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000424678		3	.	3	0	.	0	RP11-524K14.1,downstream_gene_variant,,ENST00000424678,;	TAAAC	ENSG00000229600	ENST00000424678	Transcript	downstream_gene_variant						rs111676124	1	2096	1	RP11-524K14.1	Clone_based_vega_gene		lincRNA	YES													0.6505	0.6124		0.9663	0.5964	0.7669										MODIFIER	1	insertion														.	ATT	.	.																					94601224
Unknown	0	.	GRCh37	6	97128301	97128302	+	IGR	INS	-	-	T	rs11429781		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs11429781	1																				0.8548	0.9914		1	0.999	1										MODIFIER	1	insertion														.	ACT	.	.																					97128301
RP1-199J3.5	0	.	GRCh37	6	100022909	100022913	+	5'Flank	DEL	ACTAT	ACTAT	-	rs79115935		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACTAT	ACTAT																			ENST00000407121		6	.	4	3	.	0	RP1-199J3.5,upstream_gene_variant,,ENST00000407121,;	-	ENSG00000219755	ENST00000407121	Transcript	upstream_gene_variant						rs79115935	1	675	1	RP1-199J3.5	Clone_based_vega_gene		processed_pseudogene	YES													0.053	0.1859		0.0893	0.1938	0.136										MODIFIER	1	deletion														.	GGACTATA	.	.																					100022908
HACE1	57531	.	GRCh37	6	105232461	105232461	+	Intron	DEL	A	A	-	rs71763197		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1410-101del			ENST00000262903		11	.	4	6	.	0	HACE1,intron_variant,,ENST00000262903,NM_020771.3;HACE1,intron_variant,,ENST00000369125,;HACE1,upstream_gene_variant,,ENST00000518503,;HACE1,upstream_gene_variant,,ENST00000517995,;HACE1,intron_variant,,ENST00000369127,;HACE1,intron_variant,,ENST00000416605,;HACE1,intron_variant,,ENST00000517424,;,regulatory_region_variant,,ENSR00001713671,;	-	ENSG00000085382	ENST00000262903	Transcript	intron_variant						rs71763197	2		-1	HACE1	HGNC	21033	protein_coding	YES	CCDS5050.1	ENSP00000262903	Q8IYU2	E5RFX0,E3W983	UPI00001602DC	NM_020771.3				12/23																		MODIFIER	1	sequence_alteration													1	.	CCAA	.	.																					105232460
LIN28B	389421	.	GRCh37	6	105420986	105420986	+	Intron	DEL	A	A	-	rs574004784		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.198+14839del			ENST00000345080		3	.	3	0	.	0	LIN28B,intron_variant,,ENST00000345080,NM_001004317.3;,regulatory_region_variant,,ENSR00001713685,;	-	ENSG00000187772	ENST00000345080	Transcript	intron_variant						rs574004784	1		1	LIN28B	HGNC	32207	protein_coding	YES	CCDS34504.1	ENSP00000344401	Q6ZN17	A7E2T3	UPI000035E7BD	NM_001004317.3				2/3																		MODIFIER	1	deletion													1	.	TCAA	.	.																					105420985
POPDC3	64208	.	GRCh37	6	105608326	105608327	+	Intron	INS	-	-	GACC	rs34700827		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.486-636_486-633dup			ENST00000254765		4	.	4	0	.	0	POPDC3,intron_variant,,ENST00000254765,NM_022361.4;POPDC3,upstream_gene_variant,,ENST00000429112,;BVES-AS1,intron_variant,,ENST00000369122,;BVES-AS1,intron_variant,,ENST00000580511,;BVES-AS1,intron_variant,,ENST00000580854,;BVES-AS1,downstream_gene_variant,,ENST00000369120,;POPDC3,intron_variant,,ENST00000474760,;POPDC3,intron_variant,,ENST00000489134,;	GACC	ENSG00000132429	ENST00000254765	Transcript	intron_variant						rs34700827	1		-1	POPDC3	HGNC	17649	protein_coding	YES	CCDS5052.1	ENSP00000254765	Q9HBV1		UPI000006FA58	NM_022361.4				2/3			0.5439	0.9467		0.9177	0.9573	0.8988										MODIFIER	1	insertion														.	GTG	.	.																					105608326
Unknown	0	.	GRCh37	6	105711566	105711566	+	IGR	DEL	C	C	-	rs200648935		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					3	.	3	0	.	0		-				intergenic_variant						rs200648935	1																			0.1082	0.2179	0.049		0.0565	0.0586	0.1063										MODIFIER	1	deletion														.	AACA	.	.																					105711565
ARMC2	84071	.	GRCh37	6	109285993	109285993	+	Intron	DEL	A	A	-	rs879292492		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.2286-180del			ENST00000392644		7	.	3	10	.	0	ARMC2,intron_variant,,ENST00000368972,NM_001286609.1;ARMC2,intron_variant,,ENST00000392644,NM_032131.4;ARMC2,intron_variant,,ENST00000481850,;	-	ENSG00000118690	ENST00000392644	Transcript	intron_variant						rs879292492	1		1	ARMC2	HGNC	23045	protein_coding	YES	CCDS5069.2	ENSP00000376417	Q8NEN0	G5E993,B0QZC1	UPI000022CC80	NM_032131.4				16/17																		MODIFIER	1	deletion													1	.	TCAA	.	.																					109285992
SLC22A16	85413	.	GRCh37	6	110759758	110759764	+	Intron	DEL	ATATAAC	ATATAAC	-	rs10603592		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATATAAC	ATATAAC																c.1311+159_1311+165del			ENST00000368919		5	.	3	3	.	0	SLC22A16,intron_variant,,ENST00000330550,;SLC22A16,intron_variant,,ENST00000368919,NM_033125.3;SLC22A16,intron_variant,,ENST00000439654,;SLC22A16,intron_variant,,ENST00000451557,;SLC22A16,downstream_gene_variant,,ENST00000434949,;SLC22A16,downstream_gene_variant,,ENST00000437378,;SLC22A16,downstream_gene_variant,,ENST00000456137,;RN7SL617P,downstream_gene_variant,,ENST00000485298,;	-	ENSG00000004809	ENST00000368919	Transcript	intron_variant						rs10603592	1		-1	SLC22A16	HGNC	20302	protein_coding	YES	CCDS5084.1	ENSP00000357915	Q86VW1	Q96ER0,C9JU94,C9JGT0	UPI000000DC13	NM_033125.3				5/7			0.0038	0.049		0.0536	0.0775	0.0982										MODIFIER	1	deletion														.	TTATATAACA	.	.																					110759757
RNU6-1115P	0	.	GRCh37	6	111179399	111179400	+	3'Flank	INS	-	-	T	rs74640188		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000362490		5	.	5	0	.	0	RNU6-1115P,downstream_gene_variant,,ENST00000362490,;CNN2P9,upstream_gene_variant,,ENST00000417134,;	T	ENSG00000199360	ENST00000362490	Transcript	downstream_gene_variant						rs74640188	1	1674	1	RNU6-1115P	HGNC	48078	snRNA	YES													0.4289	0.1859		0.6528	0.2654	0.4939										MODIFIER		insertion														.	CGT	.	.																					111179399
RP11-397G5.2	0	.	GRCh37	6	111243272	111243284	+	5'Flank	DEL	TCAGCTGGTGTGA	TCAGCTGGTGTGA	-	rs56802906		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCAGCTGGTGTGA	TCAGCTGGTGTGA																			ENST00000402967		3	.	3	0	.	0	RP11-397G5.2,upstream_gene_variant,,ENST00000402967,;	-	ENSG00000219329	ENST00000402967	Transcript	upstream_gene_variant						rs56802906	1	1485	1	RP11-397G5.2	Clone_based_vega_gene		processed_pseudogene	YES													1	1		1	1	1										MODIFIER	1	deletion														.	GTTCAGCTGGTGTGAT	.	.																					111243271
RP11-505K1.1	0	.	GRCh37	6	113142780	113142782	+	5'Flank	DEL	TCT	TCT	-	rs10586135		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCT	TCT																			ENST00000604713		6	.	4	6	.	0	RP11-505K1.1,upstream_gene_variant,,ENST00000604713,;	-	ENSG00000271498	ENST00000604713	Transcript	upstream_gene_variant						rs10586135	1	4359	1	RP11-505K1.1	Clone_based_vega_gene		processed_pseudogene	YES													0.1188	0.1729		0.0486	0.2147	0.2495										MODIFIER	1	deletion														.	AATCTT	.	.																					113142779
SOCS5P5	0	.	GRCh37	6	113541009	113541010	+	5'Flank	INS	-	-	TCCAGGAG	rs2307877		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000402732		4	.	4	0	.	0	SOCS5P5,upstream_gene_variant,,ENST00000402732,;	TCCAGGAG	ENSG00000216904	ENST00000402732	Transcript	upstream_gene_variant						rs2307877	1	2358	1	SOCS5P5	HGNC	44601	processed_pseudogene	YES													0.8835	0.9597		0.8968	0.9573	0.8773										MODIFIER	1	insertion														.	ATT	.	.																					113541009
Unknown	0	.	GRCh37	6	115938601	115938602	+	IGR	INS	-	-	T	rs35134705		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs35134705	1																				0.0877	0.3473		0.4008	0.3469	0.273										MODIFIER	1	insertion														.	TCT	.	.																					115938601
HSF2	3298	.	GRCh37	6	122727921	122727921	+	Intron	DEL	G	G	-	rs34444982		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.94-5597del			ENST00000368455		3	.	3	0	.	0	HSF2,intron_variant,,ENST00000368455,NM_004506.3;HSF2,intron_variant,,ENST00000452194,NM_001135564.1;,regulatory_region_variant,,ENSR00001715407,;	-	ENSG00000025156	ENST00000368455	Transcript	intron_variant						rs34444982	1		1	HSF2	HGNC	5225	protein_coding	YES	CCDS5124.1	ENSP00000357440	Q03933		UPI000012CCE8	NM_004506.3				1/12		0.1410	0.1029	0.1239		0.252	0.1511	0.0798										MODIFIER	1	deletion														.	TAGT	.	.																					122727920
NKAIN2	154215	.	GRCh37	6	124167989	124167990	+	Intron	INS	-	-	CA	rs34106417		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.54+42607_54+42608dup			ENST00000368417		6	2	3	4	4	0	NKAIN2,intron_variant,,ENST00000368416,;NKAIN2,intron_variant,,ENST00000368417,NM_001040214.1;NKAIN2,intron_variant,,ENST00000546092,;NKAIN2,intron_variant,,ENST00000476571,;	CA	ENSG00000188580	ENST00000368417	Transcript	intron_variant						rs34106417	1		1	NKAIN2	HGNC	16443	protein_coding	YES	CCDS34526.1	ENSP00000357402	Q5VXU1	B3KNZ0,B0AZU5	UPI0000458919	NM_001040214.1				1/6			0.1271	0.3588		0.4812	0.3996	0.41										MODIFIER	1	insertion														.	CGC	.	.																					124167989
RNF217	154214	.	GRCh37	6	125313324	125313324	+	Intron	DEL	T	T	-	rs35561609		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.-184-4397del			ENST00000359704		5	.	5	2	.	0	RNF217,intron_variant,,ENST00000359704,NM_152553.2;RNF217,intron_variant,,ENST00000368414,;RNF217,intron_variant,,ENST00000519799,;RNF217,intron_variant,,ENST00000521654,NM_001286398.1;RNF217,intron_variant,,ENST00000560949,;RNF217,intron_variant,,ENST00000454842,;RNF217,intron_variant,,ENST00000519565,;	-	ENSG00000146373	ENST00000359704	Transcript	intron_variant						rs35561609	1		1	RNF217	HGNC	21487	protein_coding	YES	CCDS5129.1	ENSP00000352734	Q8TC41		UPI000007307D	NM_152553.2				1/8		0.2516	0.0961	0.2795		0.4117	0.2734	0.2546										MODIFIER	1	deletion														.	GCTG	.	.																					125313323
RP1-293L8.2	643623	.	GRCh37	6	125990837	125990837	+	5'Flank	DEL	T	T	-	rs200661396		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000423208		3	.	3	0	.	0	RP1-293L8.2,upstream_gene_variant,,ENST00000423208,;RP11-624M8.1,intron_variant,,ENST00000427852,;RP11-624M8.1,intron_variant,,ENST00000451660,;RP11-624M8.1,intron_variant,,ENST00000606334,;	-	ENSG00000224506	ENST00000423208	Transcript	upstream_gene_variant						rs200661396	1	4662	1	RP1-293L8.2	Clone_based_vega_gene		lincRNA	YES													0.1006	0.0086			0.001											MODIFIER	1	deletion														.	GGTT	.	.																					125990836
Unknown	0	.	GRCh37	6	126898932	126898933	+	IGR	INS	-	-	TTG	rs3030277		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	.	6	0	.	0		TTG				intergenic_variant						rs3030277	1																				0.5461	0.8516		0.998	0.7247	0.9622										MODIFIER	1	insertion														.	AAT	.	.																					126898932
Unknown	0	.	GRCh37	6	127372170	127372171	+	IGR	DEL	AC	AC	-	rs35631508		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																					3	.	3	0	.	0		-				intergenic_variant						rs35631508	1																																			MODIFIER	1	deletion														.	AAACA	.	.																					127372169
RPS12	6206	.	GRCh37	6	133139121	133139123	+	3'Flank	DEL	CTT	CTT	-	rs67074708		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTT	CTT																			ENST00000230050		5	.	5	3	.	0	RPS12,downstream_gene_variant,,ENST00000230050,NM_001016.3;SNORA33,downstream_gene_variant,,ENST00000363664,NR_002436.1;SNORD101,downstream_gene_variant,,ENST00000384027,NR_002434.1;SNORD100,downstream_gene_variant,,ENST00000408573,NR_002435.1;RPS12,downstream_gene_variant,,ENST00000484616,;	-	ENSG00000112306	ENST00000230050	Transcript	downstream_gene_variant						rs67074708	1	418	1	RPS12	HGNC	10385	protein_coding	YES	CCDS5164.1	ENSP00000230050	P25398		UPI000000096F	NM_001016.3							0.4402	0.536		0.2282	0.3012	0.3507										MODIFIER	1	deletion														.	GACTTC	.	.																					133139120
RP3-323P13.2	100507308	.	GRCh37	6	133899669	133899669	+	Intron	DEL	T	T	-	rs60316888		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																n.624-10283del			ENST00000607033		6	.	3	4	.	0	RP3-323P13.2,intron_variant,,ENST00000606292,;RP3-323P13.2,intron_variant,,ENST00000606544,;RP3-323P13.2,intron_variant,,ENST00000607033,;RP3-323P13.2,intron_variant,,ENST00000607573,;	-	ENSG00000227954	ENST00000607033	Transcript	intron_variant,non_coding_transcript_variant						rs60316888	1		-1	RP3-323P13.2	Clone_based_vega_gene		antisense	YES										4/8																		MODIFIER	1	deletion														.	AGTT	.	.																					133899668
RP11-557H15.3	0	.	GRCh37	6	134825720	134825720	+	Intron	DEL	A	A	-	rs11343908		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																n.77+15927del			ENST00000417483		3	.	3	0	.	0	RP11-557H15.3,intron_variant,,ENST00000417483,;LINC01010,downstream_gene_variant,,ENST00000431422,;LINC01010,downstream_gene_variant,,ENST00000440090,;LINC01010,downstream_gene_variant,,ENST00000456749,;	-	ENSG00000231971	ENST00000417483	Transcript	intron_variant,non_coding_transcript_variant						rs11343908	1		-1	RP11-557H15.3	Clone_based_vega_gene		lincRNA	YES										1/4			0.5159	0.2536		0.1865	0.3072	0.363										MODIFIER	1	deletion														.	ACAA	.	.																					134825719
Unknown	0	.	GRCh37	6	135019582	135019584	+	IGR	DEL	GAG	GAG	-	rs78479050		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAG	GAG																					4	.	4	0	.	0		-				intergenic_variant						rs78479050	1																				0.2489	0.2363		0.2867	0.2087	0.2096										MODIFIER	1	deletion														.	CTGAGG	.	.																					135019581
Unknown	0	.	GRCh37	6	139320512	139320513	+	IGR	INS	-	-	CCTGGAAAG	rs57363069		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		CCTGGAAAG				intergenic_variant						rs57363069	1																				0.146	0.1441		0.3442	0.2366	0.2526										MODIFIER	1	insertion														.	AAC	.	.																					139320512
TIAM2	26230	.	GRCh37	6	155523170	155523170	+	Intron	DEL	A	A	-	rs5881125		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.3065-9160del			ENST00000461783		3	.	3	0	.	0	TIAM2,intron_variant,,ENST00000318981,NM_012454.3;TIAM2,intron_variant,,ENST00000360366,;TIAM2,intron_variant,,ENST00000367174,;TIAM2,intron_variant,,ENST00000456144,;TIAM2,intron_variant,,ENST00000456877,;TIAM2,intron_variant,,ENST00000461783,;TIAM2,intron_variant,,ENST00000528391,;TIAM2,intron_variant,,ENST00000528535,;TIAM2,intron_variant,,ENST00000529824,;TIAM2,intron_variant,,ENST00000543712,;,regulatory_region_variant,,ENSR00001719049,;,TF_binding_site_variant,,ENSM00533419933,;,TF_binding_site_variant,,ENSM00533127090,;	-	ENSG00000146426	ENST00000461783	Transcript	intron_variant						rs5881125	1		1	TIAM2	HGNC	11806	protein_coding	YES	CCDS34558.1	ENSP00000437188	Q8IVF5	F5H8H5,F5H6W6,F5H6R0,F5H1M3,E9PMZ8	UPI00004DF8BE					16/28			0.8351	0.8026		0.494	0.7286	0.683										MODIFIER	1	deletion														.	ATAA	.	.																					155523169
Unknown	0	.	GRCh37	6	156130859	156130859	+	IGR	DEL	T	T	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					6	4	2	4	4	0		-				intergenic_variant							1																																			MODIFIER	1	deletion														.	TATT	.	.																					156130858
ENSR00001381812	0	.	GRCh37	6	156208599	156208600	+	IGR	INS	-	-	CTAA	rs10670368		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001381812		5	.	5	0	.	0	,regulatory_region_variant,,ENSR00001381812,;	CTAA		ENSR00001381812	RegulatoryFeature	regulatory_region_variant						rs10670368	1																				0.7829	0.7968		0.8681	0.6829	0.8415										MODIFIER	1	insertion														.	ATC	.	.																					156208599
Unknown	0	.	GRCh37	6	156312125	156312126	+	IGR	INS	-	-	CGTTC	rs139649478		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		CGTTC				intergenic_variant						rs139649478	1																				0.5946	0.4251		0.3889	0.4672	0.3701										MODIFIER	1	insertion														.	TTC	.	.																					156312125
TULP4	56995	.	GRCh37	6	158750859	158750860	+	Intron	INS	-	-	CTAT	rs10640677		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.252+15560_252+15563dup			ENST00000367097		3	.	3	0	.	0	TULP4,intron_variant,,ENST00000367094,NM_001007466.2;TULP4,intron_variant,,ENST00000367097,NM_020245.4;	CTAT	ENSG00000130338	ENST00000367097	Transcript	intron_variant						rs10640677	1		1	TULP4	HGNC	15530	protein_coding	YES	CCDS34561.1	ENSP00000356064	Q9NRJ4		UPI000013CD76	NM_020245.4				1/13																		MODIFIER	1	insertion														.	AAC	.	.																					158750859
IGF2R	3482	.	GRCh37	6	160463028	160463029	+	Intron	INS	-	-	T	rs3839347		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1481-1140dup			ENST00000356956		3	.	3	0	.	0	IGF2R,intron_variant,,ENST00000356956,NM_000876.2;,regulatory_region_variant,,ENSR00000206327,;	T	ENSG00000197081	ENST00000356956	Transcript	intron_variant						rs3839347	1		1	IGF2R	HGNC	5467	protein_coding	YES	CCDS5273.1	ENSP00000349437	P11717	A0N9R7,A0N9R6	UPI0000072478	NM_000876.2				11/47			0.2564	0.3516		0.7242	0.3459	0.4622										MODIFIER	1	insertion														.	ACT	.	.																					160463028
SLC22A2	6582	.	GRCh37	6	160636860	160636861	+	3'Flank	INS	-	-	GGTAGAGCC	rs11280578		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000366953		4	.	4	0	.	0	SLC22A2,downstream_gene_variant,,ENST00000366953,NM_003058.3;SLC22A2,intron_variant,,ENST00000486916,;SLC22A2,downstream_gene_variant,,ENST00000491092,;SLC22A2,downstream_gene_variant,,ENST00000498556,;	GGTAGAGCC	ENSG00000112499	ENST00000366953	Transcript	downstream_gene_variant						rs11280578	1	933	-1	SLC22A2	HGNC	10966	protein_coding	YES	CCDS5276.1	ENSP00000355920	O15244	Q5T7Q5	UPI000013D5BB	NM_003058.3							0.6732	0.9121		0.869	0.8907	0.8548										MODIFIER	1	insertion														.	CTG	.	.																					160636860
PARK2	5071	.	GRCh37	6	162575557	162575557	+	Intron	DEL	A	A	-	rs5881452		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.534+46606del			ENST00000366898		3	.	3	0	.	0	PARK2,intron_variant,,ENST00000338468,;PARK2,intron_variant,,ENST00000366892,;PARK2,intron_variant,,ENST00000366894,;PARK2,intron_variant,,ENST00000366896,NM_013988.2;PARK2,intron_variant,,ENST00000366897,NM_013987.2;PARK2,intron_variant,,ENST00000366898,NM_004562.2;PARK2,intron_variant,,ENST00000479615,;,regulatory_region_variant,,ENSR00001719860,;	-	ENSG00000185345	ENST00000366898	Transcript	intron_variant						rs5881452	1		-1	PARK2	HGNC	8607	protein_coding	YES	CCDS5281.1	ENSP00000355865	O60260	M4T2U2,Q6S8G7,Q6Q2I8,Q5XNR7	UPI00003673FE	NM_004562.2				4/11																		MODIFIER	1	deletion													1	.	AGAA	.	.																					162575556
Unknown	0	.	GRCh37	6	165346570	165346570	+	IGR	DEL	T	T	-	rs140498464		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs140498464	1																			0.2644	0.2821	0.3343		0.3591	0.1044	0.2577										MODIFIER	1	deletion														.	AATA	.	.																					165346569
RPS6KA2	6196	.	GRCh37	6	167156685	167156686	+	Intron	INS	-	-	C	rs5881715		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.123+115002dup			ENST00000503859		9	.	4	3	.	0	RPS6KA2,intron_variant,,ENST00000503859,NM_001006932.1;RPS6KA2,intron_variant,,ENST00000506565,;RPS6KA2,intron_variant,,ENST00000507371,;RPS6KA2,intron_variant,,ENST00000510118,;RPS6KA2,intron_variant,,ENST00000512860,;	C	ENSG00000071242	ENST00000503859	Transcript	intron_variant						rs5881715	1		-1	RPS6KA2	HGNC	10431	protein_coding	YES	CCDS34570.1	ENSP00000427015	Q15349	D6RHW7,D6RD75,D6R910,B7Z3B5	UPI000020D48C	NM_001006932.1				2/21			0.8971	0.3602		0.5407	0.2942	0.3272										MODIFIER	1	insertion														.	CAC	.	.																					167156685
SMOC2	64094	.	GRCh37	6	168909736	168909736	+	Intron	DEL	T	T	-	rs145987209		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.85-858del			ENST00000354536		4	.	4	0	.	0	SMOC2,intron_variant,,ENST00000354536,NM_022138.2;SMOC2,intron_variant,,ENST00000356284,NM_001166412.1;	-	ENSG00000112562	ENST00000354536	Transcript	intron_variant						rs145987209	1		1	SMOC2	HGNC	20323	protein_coding	YES	CCDS5307.1	ENSP00000346537	Q9H3U7	B4DNB1	UPI0000072A56	NM_022138.2				1/12			0.2519	0.0461		0.0069	0.0487	0.2198										MODIFIER	1	deletion													1	.	AGTT	.	.																					168909735
Unknown	0	.	GRCh37	6	169208187	169208187	+	IGR	DEL	A	A	-	rs34616891		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	4	0	.	0		-				intergenic_variant						rs34616891	1																				0.0613	0.0965		0.1429	0.0905	0.09										MODIFIER	1	deletion														.	TTAA	.	.																					169208186
Unknown	0	.	GRCh37	6	169322891	169322899	+	IGR	DEL	CCATAGGCC	CCATAGGCC	-	rs57291478		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCATAGGCC	CCATAGGCC																					4	.	4	0	.	0		-				intergenic_variant						rs57291478	1																				0.5628	0.8444		0.6875	0.8807	0.7536										MODIFIER	1	deletion														.	CTCCATAGGCCC	.	.																					169322890
Unknown	0	.	GRCh37	7	572026	572027	+	IGR	DEL	AG	AG	-	rs35459772		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																					3	.	3	0	.	0		-				intergenic_variant						rs35459772	1																				0.0635	0.1916		0.2044	0.3499	0.2474										MODIFIER	1	deletion														.	GAAGA	.	.																					572025
HEATR2	54919	.	GRCh37	7	765699	765715	+	5'Flank	DEL	AGCCAGTTTCTGCATGC	AGCCAGTTTCTGCATGC	-	rs66479052		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGCCAGTTTCTGCATGC	AGCCAGTTTCTGCATGC																			ENST00000297440		3	.	3	0	.	0	PRKAR1B,intron_variant,,ENST00000403562,NM_001164758.1;PRKAR1B,intron_variant,,ENST00000417852,;PRKAR1B,intron_variant,,ENST00000537384,NM_001164760.1;HEATR2,upstream_gene_variant,,ENST00000297440,NM_017802.3;HEATR2,upstream_gene_variant,,ENST00000313147,;HEATR2,upstream_gene_variant,,ENST00000437419,;HEATR2,upstream_gene_variant,,ENST00000440747,;PRKAR1B,intron_variant,,ENST00000478198,;PRKAR1B,intron_variant,,ENST00000488474,;HEATR2,upstream_gene_variant,,ENST00000438961,;,regulatory_region_variant,,ENSR00000207477,;	-	ENSG00000164818	ENST00000297440	Transcript	upstream_gene_variant						rs66479052	1	623	1	HEATR2	HGNC	26013	protein_coding	YES	CCDS34580.1	ENSP00000297440	Q86Y56		UPI0000D61BE2	NM_017802.3																						MODIFIER	1	deletion													1	.	TTAGCCAGTTTCTGCATGCA	.	.																					765698
ADAP1	11033	.	GRCh37	7	945071	945071	+	Intron	DEL	A	A	-	rs1379936267		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.389-262del			ENST00000265846		11	.	6	6	.	3	ADAP1,intron_variant,,ENST00000265846,NM_006869.2,NM_001284311.1;ADAP1,intron_variant,,ENST00000435943,;ADAP1,intron_variant,,ENST00000437486,;ADAP1,intron_variant,,ENST00000446141,;ADAP1,intron_variant,,ENST00000449296,NM_001284309.1,NM_001284310.1;ADAP1,intron_variant,,ENST00000453823,;ADAP1,intron_variant,,ENST00000454383,;ADAP1,intron_variant,,ENST00000539900,NM_001284308.1;ADAP1,upstream_gene_variant,,ENST00000453175,;ADAP1,intron_variant,,ENST00000463358,;ADAP1,intron_variant,,ENST00000477906,;ADAP1,intron_variant,,ENST00000488527,;ADAP1,non_coding_transcript_exon_variant,,ENST00000478000,;COX19,intron_variant,,ENST00000457254,;ADAP1,upstream_gene_variant,,ENST00000481406,;ADAP1,upstream_gene_variant,,ENST00000495809,;,regulatory_region_variant,,ENSR00001385349,;,regulatory_region_variant,,ENSR00001720874,;	-	ENSG00000105963	ENST00000265846	Transcript	intron_variant						rs1379936267	1		-1	ADAP1	HGNC	16486	protein_coding	YES	CCDS5318.1	ENSP00000265846	O75689	H7C2Q4	UPI000013D694	NM_006869.2,NM_001284311.1				4/10																		MODIFIER	1	deletion														.	GGAG	.	.																					945070
MAFK	7975	.	GRCh37	7	1579166	1579174	+	Intron	DEL	CAGCGTGGC	CAGCGTGGC	-	rs3217410		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAGCGTGGC	CAGCGTGGC																c.36+312_36+320del			ENST00000343242		3	.	3	0	.	0	MAFK,intron_variant,,ENST00000343242,NM_002360.3;MAFK,intron_variant,,ENST00000406174,;TMEM184A,downstream_gene_variant,,ENST00000297477,NM_001097620.1;TMEM184A,downstream_gene_variant,,ENST00000421996,;TMEM184A,downstream_gene_variant,,ENST00000449955,;MAFK,intron_variant,,ENST00000403150,;TMEM184A,downstream_gene_variant,,ENST00000319018,;AC093734.1,upstream_gene_variant,,ENST00000540816,;	-	ENSG00000198517	ENST00000343242	Transcript	intron_variant						rs3217410	1		1	MAFK	HGNC	6782	protein_coding	YES	CCDS5325.1	ENSP00000344903	O60675	A8WFP5,A4D214	UPI000012EB23	NM_002360.3				2/2			0.9607	0.7795		0.6865	0.7018	0.6268										MODIFIER	1	deletion														.	GGCAGCGTGGCC	.	.																					1579165
LFNG	3955	.	GRCh37	7	2570869	2570870	+	3'Flank	INS	-	-	CTTCTGAGCCCAGCCCCAC	rs6149960		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000222725		4	.	4	0	.	0	LFNG,downstream_gene_variant,,ENST00000222725,NM_001040167.1;LFNG,downstream_gene_variant,,ENST00000338732,;LFNG,downstream_gene_variant,,ENST00000359574,NM_001040168.1;LFNG,downstream_gene_variant,,ENST00000402045,NM_002304.2;LFNG,downstream_gene_variant,,ENST00000402506,NM_001166355.1;MIR4648,downstream_gene_variant,,ENST00000580107,;LFNG,downstream_gene_variant,,ENST00000493850,;	CTTCTGAGCCCAGCCCCAC	ENSG00000106003	ENST00000222725	Transcript	downstream_gene_variant						rs6149960	1	2806	1	LFNG	HGNC	6560	protein_coding	YES	CCDS34587.1	ENSP00000222725	Q8NES3		UPI000012E5D5	NM_001040167.1							0.9077	0.7392		0.748	0.7286	0.7239										MODIFIER	1	insertion													1	.	TGC	.	.																					2570869
Unknown	0	.	GRCh37	7	4520435	4520435	+	IGR	DEL	T	T	-	rs59719510		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					6	.	6	0	.	0		-				intergenic_variant						rs59719510	1																																			MODIFIER	1	deletion														.	TCTT	.	.																					4520434
FBXL18	80028	.	GRCh37	7	5498329	5498330	+	Intron	INS	-	-	A	rs879787732		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2001-10856dup			ENST00000415009		3	.	3	0	.	0	FBXL18,intron_variant,,ENST00000415009,;,regulatory_region_variant,,ENSR00001721502,;	A	ENSG00000155034	ENST00000415009	Transcript	intron_variant,NMD_transcript_variant						rs879787732	1		-1	FBXL18	HGNC	21874	nonsense_mediated_decay			ENSP00000415064	Q96ME1		UPI000006D25C					4/6																		MODIFIER	1	insertion														.	CCA	.	.																					5498329
RAC1	5879	.	GRCh37	7	6411993	6411993	+	5'Flank	DEL	A	A	-	rs34272534		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000356142		3	.	3	0	.	0	RAC1,upstream_gene_variant,,ENST00000348035,NM_006908.4;RAC1,upstream_gene_variant,,ENST00000356142,NM_018890.3;RAC1,upstream_gene_variant,,ENST00000488373,;	-	ENSG00000136238	ENST00000356142	Transcript	upstream_gene_variant						rs34272534	1	2177	1	RAC1	HGNC	9801	protein_coding	YES	CCDS5349.1	ENSP00000348461	P63000	A4D2P0	UPI000002B20E	NM_018890.3							0.3949	0.5303		0.7649	0.4533	0.4796										MODIFIER	1	deletion													1	.	ACAA	.	.																					6411992
DAGLB	221955	.	GRCh37	7	6485944	6485946	+	Intron	DEL	AAA	AAA	-	rs11315985		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAA	AAA																c.96-211_96-209del			ENST00000297056		3	.	3	0	.	0	DAGLB,intron_variant,,ENST00000297056,NM_139179.3;DAGLB,intron_variant,,ENST00000421761,;DAGLB,intron_variant,,ENST00000425398,NM_001142936.1;DAGLB,intron_variant,,ENST00000428902,;DAGLB,intron_variant,,ENST00000432248,;DAGLB,intron_variant,,ENST00000436575,;KDELR2,intron_variant,,ENST00000463747,;DAGLB,intron_variant,,ENST00000479922,;DAGLB,intron_variant,,ENST00000483716,;DAGLB,intron_variant,,ENST00000454738,;,regulatory_region_variant,,ENSR00000208227,;	-	ENSG00000164535	ENST00000297056	Transcript	intron_variant						rs11315985	1		-1	DAGLB	HGNC	28923	protein_coding	YES	CCDS5350.1	ENSP00000297056	Q8NCG7	E7ET49,B3KR38	UPI000006E01F	NM_139179.3				1/14																		MODIFIER	1	deletion														.	ACAAAA	.	.																					6485943
RSPH10B2	728194	.	GRCh37	7	6798598	6798599	+	Intron	INS	-	-	T	rs1305154747		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.255-116dup			ENST00000403107		14	.	12	27	.	27	RSPH10B2,intron_variant,,ENST00000297186,;RSPH10B2,intron_variant,,ENST00000359718,;RSPH10B2,intron_variant,,ENST00000403107,;RSPH10B2,intron_variant,,ENST00000404077,NM_001099697.1;RSPH10B2,intron_variant,,ENST00000433859,;RSPH10B2,downstream_gene_variant,,ENST00000418406,;RSPH10B2,downstream_gene_variant,,ENST00000435395,;RSPH10B2,intron_variant,,ENST00000485129,;RSPH10B2,upstream_gene_variant,,ENST00000463354,;RSPH10B2,upstream_gene_variant,,ENST00000489190,;RSPH10B2,upstream_gene_variant,,ENST00000497737,;	T	ENSG00000169402	ENST00000403107	Transcript	intron_variant						rs1305154747	1		1	RSPH10B2	HGNC	34385	protein_coding	YES	CCDS43552.1	ENSP00000384766	B2RC85	C9JJN2	UPI000020EAF6					2/19																		MODIFIER	1	insertion														.	TAT	.	.																					6798598
RP11-740N7.4	0	.	GRCh37	7	6958896	6958896	+	3'Flank	DEL	A	A	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000461922		6	4	2	6	6	0	RP11-740N7.4,downstream_gene_variant,,ENST00000461922,;ALG1L5P,upstream_gene_variant,,ENST00000482043,;	-	ENSG00000241539	ENST00000461922	Transcript	downstream_gene_variant							1	4813	-1	RP11-740N7.4	Clone_based_vega_gene		processed_pseudogene	YES																												MODIFIER		deletion														.	GTAA	.	.																					6958895
ICA1	3382	.	GRCh37	7	8192427	8192429	+	Intron	DEL	CCA	CCA	-	rs79753788		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCA	CCA																c.804+4317_804+4319del			ENST00000402384		7	3	4	8	8	0	ICA1,intron_variant,,ENST00000265577,;ICA1,intron_variant,,ENST00000396675,NM_022307.2;ICA1,intron_variant,,ENST00000401396,;ICA1,intron_variant,,ENST00000402384,NM_001136020.2;ICA1,intron_variant,,ENST00000406470,NM_001276478.1,NM_004968.3;ICA1,intron_variant,,ENST00000422063,;ICA1,downstream_gene_variant,,ENST00000317367,;ICA1,downstream_gene_variant,,ENST00000407906,;AC007009.2,downstream_gene_variant,,ENST00000577980,;ICA1,intron_variant,,ENST00000486677,;ICA1,intron_variant,,ENST00000339809,;ICA1,intron_variant,,ENST00000455539,;ICA1,intron_variant,,ENST00000470696,;,regulatory_region_variant,,ENSR00001721821,;	-	ENSG00000003147	ENST00000402384	Transcript	intron_variant						rs79753788	1		-1	ICA1	HGNC	5343	protein_coding	YES	CCDS34602.1	ENSP00000385570	Q05084	Q9UDQ6,F8WET5,C9J3Y4	UPI000012D139	NM_001136020.2				8/13																		MODIFIER	1	deletion														.	CTCCAC	.	.																					8192426
Unknown	0	.	GRCh37	7	10641093	10641097	+	IGR	DEL	ATAAT	ATAAT	-	rs71023862		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATAAT	ATAAT																					4	.	4	0	.	0		-				intergenic_variant						rs71023862	1																				0.0439	0.2464		0.0397	0.2972	0.182										MODIFIER	1	deletion														.	CAATAATA	.	.																					10641092
PHF14	9678	.	GRCh37	7	11166403	11166403	+	Intron	DEL	A	A	-	rs748777005		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1917+15322del			ENST00000445996		3	.	3	0	.	0	PHF14,intron_variant,,ENST00000445996,;PHF14,intron_variant,,ENST00000469407,;PHF14,intron_variant,,ENST00000493922,;PHF14,intron_variant,,ENST00000423760,;PHF14,intron_variant,,ENST00000470665,;PHF14,intron_variant,,ENST00000473050,;	-	ENSG00000106443	ENST00000445996	Transcript	intron_variant						rs748777005	1		1	PHF14	HGNC	22203	protein_coding			ENSP00000403907	O94880		UPI0000EE431B					16/16																		MODIFIER	1	deletion														.	TGAA	.	.																					11166402
AGMO	392636	.	GRCh37	7	15470018	15470019	+	Intron	INS	-	-	A	rs201115742		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.513+611dup			ENST00000342526		3	.	3	0	.	0	AGMO,intron_variant,,ENST00000342526,NM_001004320.1;	A	ENSG00000187546	ENST00000342526	Transcript	intron_variant						rs201115742	1		-1	AGMO	HGNC	33784	protein_coding	YES	CCDS34604.1	ENSP00000341662	Q6ZNB7		UPI0000050343	NM_001004320.1				4/12			0.0257	0.0591		0.0704	0.1093	0.1524										MODIFIER	1	insertion														.	ACA	.	.																					15470018
AGMO	392636	.	GRCh37	7	15528542	15528543	+	Intron	DEL	TG	TG	-	rs34792607		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																c.409+55854_409+55855del			ENST00000342526		3	.	3	0	.	0	AGMO,intron_variant,,ENST00000342526,NM_001004320.1;	-	ENSG00000187546	ENST00000342526	Transcript	intron_variant						rs34792607	1		-1	AGMO	HGNC	33784	protein_coding	YES	CCDS34604.1	ENSP00000341662	Q6ZNB7		UPI0000050343	NM_001004320.1				3/12																		MODIFIER	1	deletion														.	ACTGT	.	.																					15528541
Unknown	0	.	GRCh37	7	16112092	16112093	+	IGR	INS	-	-	AGT	rs4001550		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AGT				intergenic_variant						rs4001550	1																			0.8311	0.7126	0.8977		0.8492	0.8787	0.8763										MODIFIER	1	insertion														.	TCG	.	.																					16112092
AC005682.5	101927841	.	GRCh37	7	22902331	22902332	+	3'Flank	DEL	TT	TT	-	rs10542417		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																			ENST00000415611		3	.	3	0	.	0	AC005682.5,downstream_gene_variant,,ENST00000415611,;AC005682.5,downstream_gene_variant,,ENST00000422542,;AC005682.6,downstream_gene_variant,,ENST00000452069,;	-	ENSG00000228649	ENST00000415611	Transcript	downstream_gene_variant						rs10542417	1	3225	1	AC005682.5	Clone_based_vega_gene		lincRNA	YES													0.4576	0.5303		0.5	0.3708	0.4806										MODIFIER		deletion														.	GATTT	.	.																					22902330
AC009508.1	0	.	GRCh37	7	23932780	23932781	+	Intron	INS	-	-	AC	rs34245074		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.76-1036_76-1035dup			ENST00000412828		4	.	4	2	.	0	AC009508.1,intron_variant,,ENST00000412828,;snoU13,downstream_gene_variant,,ENST00000459324,;	AC	ENSG00000227930	ENST00000412828	Transcript	intron_variant,non_coding_transcript_variant						rs34245074	1		-1	AC009508.1	Clone_based_vega_gene		lincRNA	YES										1/1																		MODIFIER	1	insertion														.	AGA	.	.																					23932780
DFNA5	1687	.	GRCh37	7	24778273	24778273	+	Intron	DEL	A	A	-	rs143422463		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.404+5908del			ENST00000342947		5	.	5	0	.	0	DFNA5,intron_variant,,ENST00000342947,NM_004403.2;DFNA5,intron_variant,,ENST00000409775,;DFNA5,intron_variant,,ENST00000409970,NM_001127453.1;DFNA5,intron_variant,,ENST00000414428,;DFNA5,intron_variant,,ENST00000419307,NM_001127454.1;DFNA5,intron_variant,,ENST00000545231,;DFNA5,intron_variant,,ENST00000411476,;DFNA5,intron_variant,,ENST00000493723,;DFNA5,downstream_gene_variant,,ENST00000473990,;	-	ENSG00000105928	ENST00000342947	Transcript	intron_variant						rs143422463	1		-1	DFNA5	HGNC	2810	protein_coding	YES	CCDS5389.1	ENSP00000339587	O60443		UPI00001291FC	NM_004403.2				3/9			0.059	0.219		0.1736	0.1233	0.1728										MODIFIER	1	deletion													1	.	ACAA	.	.																					24778272
AC091705.1	0	.	GRCh37	7	25590589	25590590	+	RNA	INS	-	-	T	rs35228764		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.93dup			ENST00000412197	1/2	4	.	4	0	.	0	AC091705.1,non_coding_transcript_exon_variant,,ENST00000412197,;	T	ENSG00000227386	ENST00000412197	Transcript	non_coding_transcript_exon_variant	93-94/209					rs35228764	1		-1	AC091705.1	Clone_based_vega_gene		lincRNA	YES									1/2																			MODIFIER	1	insertion														.	GAT	.	.																					25590589
AC004947.2	100506289	.	GRCh37	7	26592328	26592329	+	Intron	INS	-	-	GTGCACACACACGCCC	rs141907807		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.389+501_389+516dup			ENST00000420912		3	.	3	0	.	0	AC004947.2,intron_variant,,ENST00000420912,;AC004947.2,intron_variant,,ENST00000430426,;AC004947.2,intron_variant,,ENST00000457000,;,regulatory_region_variant,,ENSR00001390818,;	GTGCACACACACGCCC	ENSG00000233760	ENST00000420912	Transcript	intron_variant,non_coding_transcript_variant						rs141907807	1		1	AC004947.2	Clone_based_vega_gene		lincRNA	YES										1/1																		MODIFIER	1	insertion														.	CTG	.	.																					26592328
INMT	11185	.	GRCh37	7	30794253	30794256	+	Intron	DEL	ATCC	ATCC	-	rs58315408		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATCC	ATCC																c.362+737_362+740del			ENST00000013222		9	5	4	6	0	0	INMT,intron_variant,,ENST00000013222,NM_006774.4,NM_001199219.1;INMT,intron_variant,,ENST00000409539,;INMT,intron_variant,,ENST00000484180,;INMT-FAM188B,intron_variant,,ENST00000451002,;INMT-FAM188B,intron_variant,,ENST00000458257,;,regulatory_region_variant,,ENSR00001724115,;	-	ENSG00000241644	ENST00000013222	Transcript	intron_variant						rs58315408	1		1	INMT	HGNC	6069	protein_coding	YES	CCDS5430.1	ENSP00000013222	O95050	Q3MIB5	UPI000013C526	NM_006774.4,NM_001199219.1				2/2																		MODIFIER	1	deletion														.	CTATCCA	.	.																					30794252
DPY19L1	23333	.	GRCh37	7	35002707	35002708	+	Intron	INS	-	-	A	rs202056559		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.873+3798_873+3799insT			ENST00000310974		4	.	4	0	.	0	DPY19L1,intron_variant,,ENST00000310974,NM_015283.1;DPY19L1,intron_variant,,ENST00000446375,;DPY19L1,intron_variant,,ENST00000462134,;	A	ENSG00000173852	ENST00000310974	Transcript	intron_variant						rs202056559	1		-1	DPY19L1	HGNC	22205	protein_coding	YES	CCDS43567.1	ENSP00000308695	Q2PZI1		UPI000067CB92	NM_015283.1				10/21		0.0100	0.003	0.0072			0.0348	0.0061										MODIFIER	1	insertion														.	CTG	.	.																					35002707
EEPD1	80820	.	GRCh37	7	36232908	36232908	+	Intron	DEL	T	T	-	rs70977115		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.878+38098del			ENST00000242108		3	.	3	0	.	0	EEPD1,intron_variant,,ENST00000242108,NM_030636.2;EEPD1,intron_variant,,ENST00000534978,;,regulatory_region_variant,,ENSR00001724706,;	-	ENSG00000122547	ENST00000242108	Transcript	intron_variant						rs70977115	1		1	EEPD1	HGNC	22223	protein_coding	YES	CCDS34619.1	ENSP00000242108	Q7L9B9		UPI000020ED9D	NM_030636.2				2/7			0.1346	0.1297		0.005	0.1471	0.0583										MODIFIER	1	deletion														.	AGTT	.	.																					36232907
AMPH	273	.	GRCh37	7	38605909	38605909	+	Intron	DEL	T	T	-	rs11305133		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.70-31298del			ENST00000356264		4	.	4	0	.	0	AMPH,intron_variant,,ENST00000325590,NM_139316.2;AMPH,intron_variant,,ENST00000356264,NM_001635.3;AMPH,intron_variant,,ENST00000428293,;	-	ENSG00000078053	ENST00000356264	Transcript	intron_variant						rs11305133	1		-1	AMPH	HGNC	471	protein_coding	YES	CCDS5456.1	ENSP00000348602	P49418	Q9UQI5,Q9UQI4,Q9UQI3,Q9UQI2	UPI00001259EA	NM_001635.3				1/20			0.5582	0.6614		0.2966	0.7316	0.5419										MODIFIER	1	deletion														.	TGTT	.	.																					38605908
HECW1	23072	.	GRCh37	7	43324597	43324598	+	Intron	INS	-	-	T	rs55642652		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.28-26752dup			ENST00000395891		4	.	4	0	.	0	HECW1,intron_variant,,ENST00000395891,NM_015052.3;HECW1,intron_variant,,ENST00000453890,NM_001287059.1;HECW1,intron_variant,,ENST00000464944,;HECW1,intron_variant,,ENST00000490954,;HECW1,intron_variant,,ENST00000492310,;	T	ENSG00000002746	ENST00000395891	Transcript	intron_variant						rs55642652	1		1	HECW1	HGNC	22195	protein_coding	YES	CCDS5469.2	ENSP00000379228	Q76N89	A4D1V5	UPI0000D74C41	NM_015052.3				3/29			0.3608	0.2666		0.0675	0.3469	0.1963										MODIFIER	1	insertion														.	GAT	.	.																					43324597
Unknown	0	.	GRCh37	7	44383401	44383401	+	IGR	DEL	G	G	-	rs372434146		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					3	.	3	0	.	0		-				intergenic_variant						rs372434146	1																																			MODIFIER	1	deletion														.	AAGA	.	.																					44383400
Unknown	0	.	GRCh37	7	50891444	50891444	+	IGR	DEL	T	T	-	rs35570351		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					5	.	5	0	.	0		-				intergenic_variant						rs35570351	1																				0.1596	0.7594		0.7877	0.838	0.7935										MODIFIER	1	deletion														.	TATT	.	.																					50891443
Unknown	0	.	GRCh37	7	51802799	51802800	+	IGR	INS	-	-	C	rs71024620		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		C				intergenic_variant						rs71024620	1																				0.8381	0.7867		0.7361	0.8419	0.7812										MODIFIER	1	insertion														.	CAC	.	.																					51802799
POM121L12	285877	.	GRCh37	7	53107473	53107475	+	3'Flank	DEL	ATA	ATA	-	rs57273324		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATA	ATA																			ENST00000408890		3	.	3	0	.	0	POM121L12,downstream_gene_variant,,ENST00000408890,NM_182595.3;	-	ENSG00000221900	ENST00000408890	Transcript	downstream_gene_variant						rs57273324	1	2856	1	POM121L12	HGNC	25369	protein_coding	YES	CCDS43584.1	ENSP00000386133	Q8N7R1		UPI00001B6540	NM_182595.3							0.1581	0.2421		0.4315	0.2982	0.4714										MODIFIER	1	deletion														.	AGATAA	.	.																					53107472
GS1-179L18.1	401337	.	GRCh37	7	53875114	53875115	+	Intron	INS	-	-	A	rs58792281		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.424+4086dup			ENST00000380970		3	.	3	0	.	0	GS1-179L18.1,intron_variant,,ENST00000380970,;	A	ENSG00000205628	ENST00000380970	Transcript	intron_variant,non_coding_transcript_variant						rs58792281	1		-1	GS1-179L18.1	Clone_based_vega_gene		lincRNA	YES										1/5																		MODIFIER	1	insertion														.	TCA	.	.																					53875114
Unknown	0	.	GRCh37	7	57413384	57413384	+	IGR	DEL	T	T	-	rs34046586		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs34046586	1																				0.3926	0.5043		0.5546	0.3618	0.5777										MODIFIER	1	deletion														.	GATT	.	.																					57413383
Unknown	0	.	GRCh37	7	61755271	61755272	+	IGR	INS	-	-	G	rs143086106		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					9	6	3	8	0	0		G				intergenic_variant						rs143086106	1																																			MODIFIER	1	insertion														.	ATG	.	.																					61755271
RP5-905H7.3	0	.	GRCh37	7	62705305	62705305	+	5'Flank	DEL	T	T	-	rs57242985		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000451381		3	.	3	0	.	0	RP5-905H7.3,upstream_gene_variant,,ENST00000451381,;SEPT7P4,intron_variant,,ENST00000437076,;	-	ENSG00000244550	ENST00000451381	Transcript	upstream_gene_variant						rs57242985	1	3282	-1	RP5-905H7.3	Clone_based_vega_gene		processed_transcript	YES																												MODIFIER		deletion														.	TATT	.	.																					62705304
RP11-561N12.2	0	.	GRCh37	7	63465800	63465804	+	5'Flank	DEL	TCTTT	TCTTT	-	rs56208372		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCTTT	TCTTT																			ENST00000330020		6	4	2	13	0	0	RP11-561N12.2,upstream_gene_variant,,ENST00000330020,;	-	ENSG00000241149	ENST00000330020	Transcript	upstream_gene_variant						rs56208372	1	150	1	RP11-561N12.2	Clone_based_vega_gene		unprocessed_pseudogene	YES													0.6331	0.6916		0.4583	0.7614	0.6053										MODIFIER	1	deletion														.	TCTCTTTT	.	.																					63465799
RP11-321E8.4	0	.	GRCh37	7	63601118	63601119	+	Intron	INS	-	-	AG	rs34563201		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.29+218_29+219insGA			ENST00000442436		3	.	3	0	.	0	RP11-321E8.4,intron_variant,,ENST00000442436,;GUSBP6,intron_variant,,ENST00000434932,;RP11-165H4.2,downstream_gene_variant,,ENST00000454924,;	AG	ENSG00000229881	ENST00000442436	Transcript	intron_variant,non_coding_transcript_variant						rs34563201	1		1	RP11-321E8.4	Clone_based_vega_gene		lincRNA	YES										1/2			0.5068	0.4856		0.6498	0.3499	0.3978										MODIFIER	1	insertion														.	ACA	.	.																					63601118
RP11-561N12.1	0	.	GRCh37	7	64043695	64043696	+	3'Flank	INS	-	-	GGC	rs57077555		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000414815		12	.	7	9	.	3	RP11-561N12.1,downstream_gene_variant,,ENST00000414815,;	GGC	ENSG00000224669	ENST00000414815	Transcript	downstream_gene_variant						rs57077555	1	110	1	RP11-561N12.1	Clone_based_vega_gene		processed_pseudogene	YES													0.0809	0.1196			0.0875	0.0501										MODIFIER	1	insertion														.	GGG	.	.																					64043695
TPST1	8460	.	GRCh37	7	65831235	65831236	+	Intron	INS	-	-	T	rs988822741		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.99+9390dup			ENST00000490159		3	.	3	0	.	0	TPST1,intron_variant,,ENST00000490159,;	T	ENSG00000169902	ENST00000490159	Transcript	intron_variant,non_coding_transcript_variant						rs988822741	1		1	TPST1	HGNC	12020	processed_transcript											2/2																		MODIFIER	1	insertion														.	AAT	.	.																					65831235
SBDS	51119	.	GRCh37	7	66455007	66455008	+	Intron	INS	-	-	T	rs71293171		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.624+1116dup			ENST00000246868		3	.	3	0	.	0	SBDS,intron_variant,,ENST00000246868,NM_016038.2;SBDS,intron_variant,,ENST00000414306,;SBDS,downstream_gene_variant,,ENST00000463579,;SBDS,downstream_gene_variant,,ENST00000490953,;	T	ENSG00000126524	ENST00000246868	Transcript	intron_variant						rs71293171	1		-1	SBDS	HGNC	19440	protein_coding	YES	CCDS5537.1	ENSP00000246868	Q9Y3A5		UPI000013559C	NM_016038.2				4/4																		MODIFIER	1	insertion													1	.	TCT	.	.																					66455007
Unknown	0	.	GRCh37	7	67882889	67882890	+	IGR	INS	-	-	CTCTCTTAAGCCCCTCCT	rs55752035		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		CTCTCTTAAGCCCCTCCT				intergenic_variant						rs55752035	1																				0.7292	0.9568		0.9385	0.9592	0.9703										MODIFIER	1	insertion														.	CCC	.	.																					67882889
AUTS2	26053	.	GRCh37	7	69174038	69174038	+	Intron	DEL	T	T	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.309+109091del			ENST00000342771		6	4	2	4	4	0	AUTS2,intron_variant,,ENST00000342771,NM_015570.2;AUTS2,intron_variant,,ENST00000403018,NM_001127232.1;AUTS2,intron_variant,,ENST00000406775,NM_001127231.1;,regulatory_region_variant,,ENSR00001398436,;,regulatory_region_variant,,ENSR00001398437,;	-	ENSG00000158321	ENST00000342771	Transcript	intron_variant							1		1	AUTS2	HGNC	14262	protein_coding	YES	CCDS5539.1	ENSP00000344087	Q8WXX7	Q75MQ7,Q75MQ4,Q75MQ3,Q75MD7	UPI0000126665	NM_015570.2				1/18																		MODIFIER	1	deletion													1	.	TGTT	.	.																					69174037
WBSCR17	64409	.	GRCh37	7	70713965	70713965	+	Intron	DEL	T	T	-	rs5884828		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.239-86570del			ENST00000333538		4	.	4	0	.	0	WBSCR17,intron_variant,,ENST00000333538,NM_022479.2;,regulatory_region_variant,,ENSR00001398813,;	-	ENSG00000185274	ENST00000333538	Transcript	intron_variant						rs5884828	1		1	WBSCR17	HGNC	16347	protein_coding	YES	CCDS5540.1	ENSP00000329654	Q6IS24	Q68CW8,Q2L4S5,B3KRD2	UPI00000502D5	NM_022479.2				1/10																		MODIFIER	1	deletion														.	TGTT	.	.																					70713964
CACNA2D1	781	.	GRCh37	7	81805252	81805252	+	Intron	DEL	A	A	-	rs10709904		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.295-5327del			ENST00000356860		3	.	3	0	.	0	CACNA2D1,intron_variant,,ENST00000356253,;CACNA2D1,intron_variant,,ENST00000356860,NM_000722.2;CACNA2D1,intron_variant,,ENST00000423588,;CACNA2D1,intron_variant,,ENST00000484706,;,regulatory_region_variant,,ENSR00001728529,;	-	ENSG00000153956	ENST00000356860	Transcript	intron_variant						rs10709904	1		-1	CACNA2D1	HGNC	1399	protein_coding	YES	CCDS5598.1	ENSP00000349320	P54289	Q9UDU5,Q9UDQ3,Q9UDL7,O95026	UPI00003674CD	NM_000722.2				3/38			0.5098	0.1628		0.1944	0.0586	0.1401										MODIFIER	1	deletion													1	.	TGAA	.	.																					81805251
PCLO	27445	.	GRCh37	7	82789870	82789870	+	Intron	DEL	A	A	-	rs11309799		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.248+1791del			ENST00000333891		3	.	3	0	.	0	PCLO,intron_variant,,ENST00000333891,NM_033026.5;PCLO,intron_variant,,ENST00000423517,NM_014510.2;	-	ENSG00000186472	ENST00000333891	Transcript	intron_variant						rs11309799	1		-1	PCLO	HGNC	13406	protein_coding	YES	CCDS47630.1	ENSP00000334319	Q9Y6V0		UPI0001573469	NM_033026.5				1/24		0.1390	0.1067	0.1744		0.0685	0.2793	0.0859										MODIFIER	1	deletion													1	.	TTAT	.	.																					82789869
Unknown	0	.	GRCh37	7	85482012	85482012	+	IGR	DEL	A	A	-	rs35386370		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					5	.	5	0	.	0		-				intergenic_variant						rs35386370	1																				0.3374	0.4986		0.879	0.4046	0.7004										MODIFIER	1	deletion														.	TTAA	.	.																					85482011
ENSR00000214831	0	.	GRCh37	7	87945280	87945281	+	IGR	INS	-	ACTC	ACTC	rs57080345		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00000214831		6	.	0	3	.	2	,regulatory_region_variant,,ENSR00000214831,;	ACTC		ENSR00000214831	RegulatoryFeature	regulatory_region_variant						rs57080345	1																																			MODIFIER	1	insertion														.	TTA	.	.																					87945280
CDK14	5218	.	GRCh37	7	90304714	90304715	+	Intron	INS	-	-	T	rs11397070		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.124-51158dup			ENST00000380050		3	.	3	0	.	0	CDK14,intron_variant,,ENST00000380050,NM_001287137.1,NM_001287135.1;CDK14,intron_variant,,ENST00000430760,;CDK14,intron_variant,,ENST00000446224,;CDK14,intron_variant,,ENST00000449528,;CDK14,intron_variant,,ENST00000456689,;CDK14,intron_variant,,ENST00000484035,;	T	ENSG00000058091	ENST00000380050	Transcript	intron_variant						rs11397070	1		1	CDK14	HGNC	8883	protein_coding			ENSP00000369390	O94921	C9JWL6,C9IYJ9	UPI000013EAF4	NM_001287137.1,NM_001287135.1				2/14			0.8359	0.879		0.9058	0.8231	0.8211										MODIFIER	1	insertion														.	GAT	.	.																					90304714
RN7SKP129	0	.	GRCh37	7	94433957	94433957	+	3'Flank	DEL	A	A	-	rs569590281		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000410288		3	.	3	0	.	0	RN7SKP129,downstream_gene_variant,,ENST00000410288,;	-	ENSG00000222220	ENST00000410288	Transcript	downstream_gene_variant						rs569590281	1	2833	1	RN7SKP129	HGNC	45853	misc_RNA	YES																												MODIFIER	1	deletion														.	TGAA	.	.																					94433956
Unknown	0	.	GRCh37	7	97720995	97720995	+	IGR	DEL	T	T	-	rs55808403		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	4	0	.	0		-				intergenic_variant						rs55808403	1																				0.7572	0.9553		0.9663	0.9791	0.956										MODIFIER	1	deletion														.	CCTT	.	.																					97720994
ZAN	7455	.	GRCh37	7	100327197	100327197	+	5'Flank	DEL	A	A	-	rs199783394		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000546292		4	.	4	0	.	0	ZAN,upstream_gene_variant,,ENST00000538115,;ZAN,upstream_gene_variant,,ENST00000542585,NM_003386.1;ZAN,upstream_gene_variant,,ENST00000546213,;ZAN,upstream_gene_variant,,ENST00000546292,NM_173059.1;ZAN,upstream_gene_variant,,ENST00000348028,;ZAN,upstream_gene_variant,,ENST00000349350,;ZAN,upstream_gene_variant,,ENST00000421100,;ZAN,upstream_gene_variant,,ENST00000427578,;ZAN,upstream_gene_variant,,ENST00000443370,;ZAN,upstream_gene_variant,,ENST00000449052,;	-	ENSG00000146839	ENST00000546292	Transcript	upstream_gene_variant						rs199783394	1	4447	1	ZAN	HGNC	12857	protein_coding	YES		ENSP00000445943		F5H0T8	UPI00004575C6	NM_173059.1																						MODIFIER	1	deletion														.	ATAA	.	.																					100327196
CUX1	1523	.	GRCh37	7	101900586	101900587	+	3'UTR	INS	-	-	T	rs35391223		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.*8275dup			ENST00000360264	24/24	3	.	3	0	.	0	CUX1,3_prime_UTR_variant,,ENST00000360264,NM_001202543.1;CUX1,3_prime_UTR_variant,,ENST00000292535,NM_181552.3;CUX1,intron_variant,,ENST00000292538,NM_001913.3;CUX1,intron_variant,,ENST00000393824,NM_001202546.1;CUX1,intron_variant,,ENST00000425244,NM_001202545.1;CUX1,intron_variant,,ENST00000437600,NM_181500.2;CUX1,intron_variant,,ENST00000547394,NM_001202544.1;CUX1,intron_variant,,ENST00000558836,;CUX1,intron_variant,,ENST00000560541,;	T	ENSG00000257923	ENST00000360264	Transcript	3_prime_UTR_variant	12835-12836/13762					rs35391223	1		1	CUX1	HGNC	2557	protein_coding	YES	CCDS56498.1	ENSP00000353401	P39880		UPI00001AEB98	NM_001202543.1			24/24				0.1331	0.2233		0.0437	0.174	0.092										MODIFIER	1	insertion													1	.	CCT	.	.																					101900586
LHFPL3	375612	.	GRCh37	7	104304763	104304764	+	Intron	INS	-	-	A	rs11434136		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.481+41300dup			ENST00000535008		3	.	3	0	.	0	LHFPL3,intron_variant,,ENST00000401970,;LHFPL3,intron_variant,,ENST00000424859,NM_199000.2;LHFPL3,intron_variant,,ENST00000535008,;LHFPL3,intron_variant,,ENST00000543266,;EIF4BP6,upstream_gene_variant,,ENST00000431936,;	A	ENSG00000187416	ENST00000535008	Transcript	intron_variant						rs11434136	1		1	LHFPL3	HGNC	6589	protein_coding	YES		ENSP00000444350		F5GZM2	UPI0002065540					3/4			0.7632	0.9813		0.9881	0.9891	0.9888										MODIFIER	1	insertion														.	ATA	.	.																					104304763
Unknown	0	.	GRCh37	7	105812232	105812233	+	IGR	INS	-	-	T	rs5886383		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs5886383	1																				0.615	0.2594		0.0546	0.33	0.1636										MODIFIER	1	insertion														.	CCT	.	.																					105812232
Unknown	0	.	GRCh37	7	109766459	109766462	+	IGR	DEL	AGAC	AGAC	-	rs149002978		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGAC	AGAC																					5	.	3	3	.	0		-				intergenic_variant						rs149002978	1																					0.0014			0.008											MODIFIER	1	deletion														.	TTAGACA	.	.																					109766458
TMEM168	64418	.	GRCh37	7	112434170	112434171	+	5'Flank	DEL	GT	GT	-	rs3082862		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																			ENST00000312814		3	.	3	0	.	0	TMEM168,upstream_gene_variant,,ENST00000312814,NM_001287497.1,NM_022484.5;TMEM168,upstream_gene_variant,,ENST00000441474,;TMEM168,upstream_gene_variant,,ENST00000447395,;TMEM168,upstream_gene_variant,,ENST00000449743,;TMEM168,upstream_gene_variant,,ENST00000454074,;	-	ENSG00000146802	ENST00000312814	Transcript	upstream_gene_variant						rs3082862	1	3523	-1	TMEM168	HGNC	25826	protein_coding	YES	CCDS5757.1	ENSP00000323068	Q9H0V1	C9JVE9,C9IZT1,B4DDS0	UPI000004DACB	NM_001287497.1,NM_022484.5							0.1732	0.5159		0.7232	0.5994	0.4243										MODIFIER	1	deletion														.	GGGTG	.	.																					112434169
POT1	25913	.	GRCh37	7	124464910	124464913	+	Intron	DEL	TAGT	TAGT	-	rs79646733		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAGT	TAGT																c.1792+393_1792+396del			ENST00000357628		3	.	3	0	.	0	POT1,intron_variant,,ENST00000357628,NM_015450.2;POT1,intron_variant,,ENST00000393329,NM_001042594.1;POT1,intron_variant,,ENST00000436534,;POT1,intron_variant,,ENST00000430927,;POT1,intron_variant,,ENST00000607932,;POT1,intron_variant,,ENST00000608057,;POT1,intron_variant,,ENST00000609106,;	-	ENSG00000128513	ENST00000357628	Transcript	intron_variant						rs79646733	1		-1	POT1	HGNC	17284	protein_coding	YES	CCDS5793.1	ENSP00000350249	Q9NUX5	C9JPG9,A8MTK3	UPI0000073E3F	NM_015450.2				18/18			0.2557	0.4294		0.4891	0.4414	0.3824										MODIFIER	1	deletion													1	.	ACTAGTT	.	.																					124464909
POT1-AS1	0	.	GRCh37	7	124774878	124774878	+	Intron	DEL	A	A	-	rs79909947		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																n.1314-3748del			ENST00000453342		3	.	3	0	.	0	POT1-AS1,intron_variant,,ENST00000435452,;POT1-AS1,intron_variant,,ENST00000449642,;POT1-AS1,intron_variant,,ENST00000453342,;	-	ENSG00000224897	ENST00000453342	Transcript	intron_variant,non_coding_transcript_variant						rs79909947	1		1	POT1-AS1	HGNC	49459	antisense	YES										9/10			0.289	0.219		0.3532	0.3221	0.1902										MODIFIER	1	deletion														.	CCAA	.	.																					124774877
Unknown	0	.	GRCh37	7	125249167	125249170	+	IGR	DEL	AATC	AATC	-	rs151280400		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AATC	AATC																					3	.	3	0	.	0		-				intergenic_variant						rs151280400	1																				0.0711	0.464		0.6131	0.3648	0.6022										MODIFIER	1	deletion														.	TTAATCA	.	.																					125249166
Unknown	0	.	GRCh37	7	127774680	127774680	+	IGR	DEL	A	A	-	rs56242362		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					6	.	6	0	.	0		-				intergenic_variant						rs56242362	1																																			MODIFIER	1	deletion														.	TCAA	.	.																					127774679
NRF1	4899	.	GRCh37	7	129397839	129397842	+	3'Flank	DEL	TGCT	TGCT	-	rs35246716		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGCT	TGCT																			ENST00000393232		4	.	4	0	.	0	NRF1,downstream_gene_variant,,ENST00000223190,;NRF1,downstream_gene_variant,,ENST00000311967,;NRF1,downstream_gene_variant,,ENST00000353868,;NRF1,downstream_gene_variant,,ENST00000393230,NM_001040110.1;NRF1,downstream_gene_variant,,ENST00000393231,;NRF1,downstream_gene_variant,,ENST00000393232,NM_005011.3;NRF1,downstream_gene_variant,,ENST00000539636,;RNA5SP244,downstream_gene_variant,,ENST00000390936,;	-	ENSG00000106459	ENST00000393232	Transcript	downstream_gene_variant						rs35246716	1	919	1	NRF1	HGNC	7996	protein_coding	YES	CCDS5813.2	ENSP00000376924	Q16656	C9JP85,B4DDV6	UPI000003BB3B	NM_005011.3							0.4017	0.6844		0.7946	0.6978	0.6043										MODIFIER	1	deletion														.	AATGCTT	.	.																					129397838
COPG2	26958	.	GRCh37	7	130292119	130292120	+	3'Flank	INS	-	-	ATAAATAA	rs5887469		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000445977		10	.	6	4	.	0	COPG2,downstream_gene_variant,,ENST00000330992,;COPG2,downstream_gene_variant,,ENST00000445977,;RNA5SP246,upstream_gene_variant,,ENST00000458909,;	ATAAATAA	ENSG00000158623	ENST00000445977	Transcript	downstream_gene_variant						rs5887469	1	3700	-1	COPG2	HGNC	2237	protein_coding	YES		ENSP00000393912		F6X838	UPI0000457604								0.6551	0.8271		0.8085	0.7266	0.6718										MODIFIER	1	insertion														.	TCA	.	.																					130292119
Unknown	0	.	GRCh37	7	132805576	132805577	+	IGR	INS	-	-	A	rs5887612		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		A				intergenic_variant						rs5887612	1																				0.3192	0.4424		0.3423	0.4165	0.3303										MODIFIER	1	insertion														.	TCA	.	.																					132805576
TBXAS1	6916	.	GRCh37	7	139501269	139501270	+	Intron	INS	-	-	T	rs56097281		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-77+14053dup			ENST00000263552		4	.	3	4	.	0	TBXAS1,intron_variant,,ENST00000263552,NM_001130966.2;TBXAS1,intron_variant,,ENST00000336425,;TBXAS1,intron_variant,,ENST00000425687,NM_001166254.1;TBXAS1,intron_variant,,ENST00000438104,;TBXAS1,downstream_gene_variant,,ENST00000462053,;TBXAS1,downstream_gene_variant,,ENST00000474763,;TBXAS1,downstream_gene_variant,,ENST00000481440,;	T	ENSG00000059377	ENST00000263552	Transcript	intron_variant						rs56097281	1		1	TBXAS1	HGNC	11609	protein_coding		CCDS5855.1	ENSP00000263552	P24557	Q9UDV3,Q86UL7,F8WD37,C9JS68	UPI000013D421	NM_001130966.2				4/16			0.5772	0.7118		0.9325	0.5427	0.7771										MODIFIER	1	insertion													1	.	CCT	.	.																					139501269
DENND2A	27147	.	GRCh37	7	140231622	140231623	+	Intron	INS	-	-	AAC	rs60323045		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2328-4330_2328-4328dup			ENST00000275884		4	.	4	0	.	0	DENND2A,intron_variant,,ENST00000275884,;DENND2A,intron_variant,,ENST00000469373,;DENND2A,intron_variant,,ENST00000496613,;DENND2A,intron_variant,,ENST00000537639,NM_015689.3;DENND2A,intron_variant,,ENST00000461883,;	AAC	ENSG00000146966	ENST00000275884	Transcript	intron_variant						rs60323045	1		-1	DENND2A	HGNC	22212	protein_coding	YES	CCDS43659.1	ENSP00000275884	Q9ULE3	C9JD15,C9JAA0,C9IYZ8,C9IY76	UPI00001C1E63					13/18			0.7012	0.964		0.9881	0.9811	0.9785										MODIFIER	1	insertion														.	AAA	.	.																					140231622
EPHA1	2041	.	GRCh37	7	143094328	143094329	+	Intron	DEL	AC	AC	-	rs146724598		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AC	AC																c.1771+68_1771+69del			ENST00000275815		6	4	2	4	4	0	EPHA1,intron_variant,,ENST00000275815,NM_005232.4;EPHA1,intron_variant,,ENST00000488068,;EPHA1,upstream_gene_variant,,ENST00000465208,;EPHA1,downstream_gene_variant,,ENST00000479459,;EPHA1,upstream_gene_variant,,ENST00000494989,;EPHA1,downstream_gene_variant,,ENST00000497891,;	-	ENSG00000146904	ENST00000275815	Transcript	intron_variant						rs146724598	1		-1	EPHA1	HGNC	3385	protein_coding	YES	CCDS5884.1	ENSP00000275815	P21709		UPI000013DA82	NM_005232.4				10/17																		MODIFIER	1	deletion														.	CAACA	.	.																					143094327
CNTNAP2	26047	.	GRCh37	7	146402711	146402712	+	Intron	INS	-	-	C	rs11427461		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.98-68650dup			ENST00000361727		5	.	5	0	.	0	CNTNAP2,intron_variant,,ENST00000361727,NM_014141.5;	C	ENSG00000174469	ENST00000361727	Transcript	intron_variant						rs11427461	1		1	CNTNAP2	HGNC	13830	protein_coding	YES	CCDS5889.1	ENSP00000354778	Q9UHC6	Q9UDV4,Q96T77,Q86UL9,Q86UL6,Q86UL4,Q86UJ1,Q86UI8,Q75MQ9,Q75MF8,Q75MF6,Q75MD4,Q75MA1,Q75M92,Q75LG9,O75852,B7Z1Y6	UPI00001285FA	NM_014141.5				1/23																		MODIFIER	1	insertion													1	.	GTC	.	.																					146402711
CNTNAP2	26047	.	GRCh37	7	147403273	147403274	+	Intron	INS	-	-	T	rs767715009		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2098+66891dup			ENST00000361727		3	.	3	0	.	0	CNTNAP2,intron_variant,,ENST00000361727,NM_014141.5;CNTNAP2,intron_variant,,ENST00000455301,;RP4-777G9.1,upstream_gene_variant,,ENST00000603254,;	T	ENSG00000174469	ENST00000361727	Transcript	intron_variant						rs767715009	1		1	CNTNAP2	HGNC	13830	protein_coding	YES	CCDS5889.1	ENSP00000354778	Q9UHC6	Q9UDV4,Q96T77,Q86UL9,Q86UL6,Q86UL4,Q86UJ1,Q86UI8,Q75MQ9,Q75MF8,Q75MF6,Q75MD4,Q75MA1,Q75M92,Q75LG9,O75852,B7Z1Y6	UPI00001285FA	NM_014141.5				13/23																		MODIFIER	1	insertion													1	.	GGT	.	.																					147403273
CNTNAP2	26047	.	GRCh37	7	147960235	147960236	+	Intron	INS	-	-	ATTA	rs3057300		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.3382-3890_3382-3889insATTA			ENST00000361727		3	.	3	0	.	0	CNTNAP2,intron_variant,,ENST00000361727,NM_014141.5;CNTNAP2,intron_variant,,ENST00000538075,;,regulatory_region_variant,,ENSR00001734558,;,regulatory_region_variant,,ENSR00001734559,;	ATTA	ENSG00000174469	ENST00000361727	Transcript	intron_variant						rs3057300	1		1	CNTNAP2	HGNC	13830	protein_coding	YES	CCDS5889.1	ENSP00000354778	Q9UHC6	Q9UDV4,Q96T77,Q86UL9,Q86UL6,Q86UL4,Q86UJ1,Q86UI8,Q75MQ9,Q75MF8,Q75MF6,Q75MD4,Q75MA1,Q75M92,Q75LG9,O75852,B7Z1Y6	UPI00001285FA	NM_014141.5				20/23		0.1044	0.2632	0.0663		0.0218	0.0646	0.0429										MODIFIER	1	insertion													1	.	TTG	.	.																					147960235
ABCF2	10061	.	GRCh37	7	150918587	150918587	+	Intron	DEL	T	T	-	rs376711339		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.921+77del			ENST00000222388		27	.	3	24	.	0	ABCF2,intron_variant,,ENST00000222388,NM_005692.4;ABCF2,intron_variant,,ENST00000287844,NM_007189.2;ABCF2,downstream_gene_variant,,ENST00000441774,;ABCF2,downstream_gene_variant,,ENST00000468073,;ABCF2,intron_variant,,ENST00000473874,;ABCF2,downstream_gene_variant,,ENST00000477252,;	-	ENSG00000033050	ENST00000222388	Transcript	intron_variant						rs376711339	1		-1	ABCF2	HGNC	71	protein_coding	YES	CCDS5922.1	ENSP00000222388		Q75MJ1,C9JZV3,C9JHK9	UPI000004C4C9	NM_005692.4				7/15																		MODIFIER	1	deletion														.	CCTT	.	.																					150918586
PRKAG2	51422	.	GRCh37	7	151498507	151498508	+	Intron	INS	-	-	T	rs5888452		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.115-14881_115-14880insA			ENST00000287878		5	.	5	0	.	0	PRKAG2,intron_variant,,ENST00000287878,NM_016203.3;PRKAG2,intron_variant,,ENST00000392801,NM_001040633.1;PRKAG2,intron_variant,,ENST00000481434,;PRKAG2,intron_variant,,ENST00000488258,;	T	ENSG00000106617	ENST00000287878	Transcript	intron_variant						rs5888452	1		-1	PRKAG2	HGNC	9386	protein_coding	YES	CCDS5928.1	ENSP00000287878	Q9UGJ0	C9JUG1	UPI00001250B5	NM_016203.3				1/15		0.6881	0.8442	0.5879		0.6687	0.6938	0.5624										MODIFIER	1	insertion													1	.	CCA	.	.																					151498507
PRKAG2	51422	.	GRCh37	7	151552201	151552205	+	Intron	DEL	ACACA	ACACA	CACA	rs1554618727		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACA	ACACA																c.114+21391del			ENST00000287878		105	92	13	42	0	0	PRKAG2,intron_variant,,ENST00000287878,NM_016203.3;PRKAG2,intron_variant,,ENST00000474383,;PRKAG2,intron_variant,,ENST00000481434,;PRKAG2,intron_variant,,ENST00000488258,;,regulatory_region_variant,,ENSR00001735016,;	ACCACA	ENSG00000106617	ENST00000287878	Transcript	intron_variant						rs1554618727	2		-1	PRKAG2	HGNC	9386	protein_coding	YES	CCDS5928.1	ENSP00000287878	Q9UGJ0	C9JUG1	UPI00001250B5	NM_016203.3				1/15									0.06166	0.04696								MODIFIER	1	sequence_alteration													1	.	CTACACACAC	.	.																					151552198
KMT2C	58508	.	GRCh37	7	152068471	152068472	+	Intron	INS	-	-	A	rs143452702		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.162-12712dup			ENST00000262189		3	.	3	0	.	0	KMT2C,intron_variant,,ENST00000262189,NM_170606.2;KMT2C,intron_variant,,ENST00000355193,;KMT2C,intron_variant,,ENST00000452749,;KMT2C,intron_variant,,ENST00000558084,;SEPT7P6,downstream_gene_variant,,ENST00000469999,;RP11-208G20.2,downstream_gene_variant,,ENST00000472406,;RP11-208G20.3,downstream_gene_variant,,ENST00000603054,;,regulatory_region_variant,,ENSR00001735078,;	A	ENSG00000055609	ENST00000262189	Transcript	intron_variant						rs143452702	1		-1	KMT2C	HGNC	13726	protein_coding	YES	CCDS5931.1	ENSP00000262189	Q8NEZ4	Q6N019,Q75MN6,H0YMU7	UPI0000141B9F	NM_170606.2				1/58			0.0068	0.0504			0.0984	0.0215										MODIFIER	1	insertion													1	.	ATA	.	.																					152068471
KMT2C	58508	.	GRCh37	7	152115947	152115947	+	Intron	DEL	A	A	-	rs113222244		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.161+16764del			ENST00000262189		4	.	4	0	.	0	KMT2C,intron_variant,,ENST00000262189,NM_170606.2;KMT2C,intron_variant,,ENST00000355193,;KMT2C,intron_variant,,ENST00000452749,;KMT2C,intron_variant,,ENST00000558084,;,regulatory_region_variant,,ENSR00001735095,;	-	ENSG00000055609	ENST00000262189	Transcript	intron_variant						rs113222244	1		-1	KMT2C	HGNC	13726	protein_coding	YES	CCDS5931.1	ENSP00000262189	Q8NEZ4	Q6N019,Q75MN6,H0YMU7	UPI0000141B9F	NM_170606.2				1/58			0.3064	0.1484		0.1161	0.0596	0.1431										MODIFIER	1	deletion													1	.	ACAA	.	.																					152115946
ACTR3B	57180	.	GRCh37	7	152498092	152498092	+	Intron	DEL	T	T	-	rs368430946		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.225+362del			ENST00000256001		9	.	5	5	.	0	ACTR3B,intron_variant,,ENST00000256001,NM_020445.5;ACTR3B,intron_variant,,ENST00000377776,NM_001040135.2;ACTR3B,intron_variant,,ENST00000397282,;ACTR3B,intron_variant,,ENST00000537264,;ACTR3B,intron_variant,,ENST00000488782,;	-	ENSG00000133627	ENST00000256001	Transcript	intron_variant						rs368430946	1		1	ACTR3B	HGNC	17256	protein_coding	YES	CCDS5934.1	ENSP00000256001	Q9P1U1	C9J580,B3KM55	UPI0000073AC7	NM_020445.5				3/11			0.2761	0.438		0.4623	0.4394	0.4642										MODIFIER	1	deletion														.	ACTT	.	.																					152498091
DPP6	1804	.	GRCh37	7	154103515	154103516	+	Intron	DEL	CA	CA	-	rs10610650		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CA	CA																c.244-39767_244-39766del			ENST00000377770		3	.	3	0	.	0	DPP6,intron_variant,,ENST00000332007,;DPP6,intron_variant,,ENST00000377770,;DPP6,intron_variant,,ENST00000404039,NM_130797.2,NM_001936.3,NM_001039350.1;DPP6,intron_variant,,ENST00000406326,;DPP6,intron_variant,,ENST00000427557,;DPP6,intron_variant,,ENST00000496611,;DPP6,intron_variant,,ENST00000462622,;	-	ENSG00000130226	ENST00000377770	Transcript	intron_variant						rs10610650	1		1	DPP6	HGNC	3010	protein_coding	YES		ENSP00000367001	P42658	Q75MI8,Q75MI7,Q75MF0	UPI00001AE746					1/25			0.7791	0.9467		0.9881	0.9453	0.9908										MODIFIER	1	deletion													1	.	TGCAC	.	.																					154103514
UBE3C	9690	.	GRCh37	7	157047091	157047092	+	Intron	INS	-	-	ATTA	rs138121126		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2950+90_2950+91insAATT			ENST00000348165		5	.	5	0	.	0	UBE3C,intron_variant,,ENST00000348165,NM_014671.2;UBE3C,intron_variant,,ENST00000470408,;UBE3C,upstream_gene_variant,,ENST00000474153,;	ATTA	ENSG00000009335	ENST00000348165	Transcript	intron_variant						rs138121126	1		1	UBE3C	HGNC	16803	protein_coding	YES	CCDS34789.1	ENSP00000309198	Q15386		UPI000020E72A	NM_014671.2				21/22			0.8094	0.9294		0.9881	0.9364	0.9744										MODIFIER	1	insertion														.	TTA	.	.																					157047091
Unknown	0	.	GRCh37	8	5347901	5347902	+	IGR	INS	-	-	AA	rs112498755		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AA				intergenic_variant						rs112498755	1																				0.5923	0.4107		0.4494	0.4155	0.4969										MODIFIER	1	insertion														.	TGA	.	.																					5347901
MCPH1	79648	.	GRCh37	8	6310917	6310918	+	Intron	INS	-	-	T	rs11459930		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1826-1735dup			ENST00000344683		5	.	5	0	.	0	MCPH1,intron_variant,,ENST00000344683,NM_024596.3;MCPH1,upstream_gene_variant,,ENST00000522020,;	T	ENSG00000147316	ENST00000344683	Transcript	intron_variant						rs11459930	1		1	MCPH1	HGNC	6954	protein_coding	YES	CCDS43689.1	ENSP00000342924		Q6W7E5,Q6RBX4,Q6RBQ8,Q6RBJ2,Q6RBC6,Q6RB60,Q6RAZ4,Q6RAP8,Q6RAB6,Q6RA50	UPI000020FF7E	NM_024596.3				8/13			0.2405	0.6009		0.5585	0.5616	0.5501										MODIFIER	1	insertion													1	.	TCT	.	.																					6310917
ANGPT2	285	.	GRCh37	8	6408750	6408751	+	Intron	INS	-	-	T	rs10708602		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.288+11417dup			ENST00000325203		3	.	3	0	.	0	ANGPT2,intron_variant,,ENST00000325203,;ANGPT2,intron_variant,,ENST00000338312,;MCPH1,intron_variant,,ENST00000344683,NM_024596.3;ANGPT2,intron_variant,,ENST00000415216,NM_001147.2,NM_001118888.1,NM_001118887.1;ANGPT2,intron_variant,,ENST00000523120,;MCPH1,intron_variant,,ENST00000519221,;MCPH1,intron_variant,,ENST00000521129,;,regulatory_region_variant,,ENSR00001736187,;	T	ENSG00000091879	ENST00000325203	Transcript	intron_variant						rs10708602	1		-1	ANGPT2	HGNC	485	protein_coding	YES	CCDS5958.1	ENSP00000314897	O15123	Q9H4C0	UPI0000034767					1/8																		MODIFIER		insertion														.	GAT	.	.																					6408750
Unknown	0	.	GRCh37	8	13888829	13888920	+	IGR	DEL	AAAAAAATTAAGGATAAGTGCCGGGATTGCGCCACTGCACTCCAGCCTGGGCGACAGCGAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAAA	AAAAAAATTAAGGATAAGTGCCGGGATTGCGCCACTGCACTCCAGCCTGGGCGACAGCGAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAAA	-	rs71209003		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAAAAATTAAGGATAAGTGCCGGGATTGCGCCACTGCACTCCAGCCTGGGCGACAGCGAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAAA	AAAAAAATTAAGGATAAGTGCCGGGATTGCGCCACTGCACTCCAGCCTGGGCGACAGCGAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAAA																					5	.	5	0	.	0		-				intergenic_variant						rs71209003	1																																			MODIFIER	1	deletion														.	TCAAAAAAATTAAGGATAAGTGCCGGGATTGCGCCACTGCACTCCAGCCTGGGCGACAGCGAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAAAA	.	.																					13888828
GFRA2	2675	.	GRCh37	8	21595567	21595567	+	Intron	DEL	A	A	-	rs142006405		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.794+12533del			ENST00000524240		4	.	4	2	.	0	GFRA2,intron_variant,,ENST00000400782,NM_001165039.1,NM_001165038.1;GFRA2,intron_variant,,ENST00000517328,;GFRA2,intron_variant,,ENST00000517892,;GFRA2,intron_variant,,ENST00000518077,;GFRA2,intron_variant,,ENST00000522071,;GFRA2,intron_variant,,ENST00000524240,NM_001495.4;GFRA2,intron_variant,,ENST00000306793,;	-	ENSG00000168546	ENST00000524240	Transcript	intron_variant						rs142006405	1		-1	GFRA2	HGNC	4244	protein_coding	YES	CCDS47816.1	ENSP00000428518	O00451	E5RJ44,E5RGR6	UPI000000D9B1	NM_001495.4				4/8		0.0771	0.1089	0.062		0.0466	0.0845	0.0685										MODIFIER	1	deletion														.	ACAT	.	.																					21595566
ENTPD4	9583	.	GRCh37	8	23300194	23300195	+	Intron	INS	-	-	AA	rs5890111		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.668-617_668-616dup			ENST00000358689		3	.	3	0	.	0	ENTPD4,intron_variant,,ENST00000356206,;ENTPD4,intron_variant,,ENST00000358689,NM_001128930.2,NM_004901.4;ENTPD4,intron_variant,,ENST00000417069,;ENTPD4,intron_variant,,ENST00000519839,;ENTPD4,downstream_gene_variant,,ENST00000518718,;ENTPD4,intron_variant,,ENST00000523958,;ENTPD4,upstream_gene_variant,,ENST00000520936,;	AA	ENSG00000197217	ENST00000358689	Transcript	intron_variant						rs5890111	1		-1	ENTPD4	HGNC	14573	protein_coding	YES	CCDS6041.1	ENSP00000351520	Q9Y227	E5RIB2	UPI0000129FB4	NM_001128930.2,NM_004901.4				6/12																		MODIFIER	1	insertion														.	TCA	.	.																					23300194
RBPMS	11030	.	GRCh37	8	30298311	30298311	+	Intron	DEL	T	T	-	rs34107190		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.67-33970del			ENST00000339877		3	.	3	0	.	0	RBPMS,intron_variant,,ENST00000287771,NM_001008711.2;RBPMS,intron_variant,,ENST00000320203,NM_006867.3;RBPMS,intron_variant,,ENST00000339877,NM_001008712.2;RBPMS,intron_variant,,ENST00000397323,NM_001008710.2;RBPMS,intron_variant,,ENST00000517860,;RBPMS,intron_variant,,ENST00000519647,;RBPMS,intron_variant,,ENST00000520161,;RBPMS,intron_variant,,ENST00000523115,;RBPMS,intron_variant,,ENST00000538486,;RBPMS,upstream_gene_variant,,ENST00000520191,;RBPMS,intron_variant,,ENST00000521816,;RBPMS,upstream_gene_variant,,ENST00000523717,;,regulatory_region_variant,,ENSR00001422833,;	-	ENSG00000157110	ENST00000339877	Transcript	intron_variant						rs34107190	1		1	RBPMS	HGNC	19097	protein_coding	YES	CCDS34876.1	ENSP00000340176	Q93062	E5RJD7,E5RFP4	UPI000002B229	NM_001008712.2				1/6			0.1354	0.3876		0.4246	0.2704	0.2474										MODIFIER	1	deletion														.	ACTT	.	.																					30298310
Unknown	0	.	GRCh37	8	30802830	30802831	+	IGR	INS	-	-	GTGT	rs72113332		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		GTGT				intergenic_variant						rs72113332	1																																			MODIFIER	1	insertion														.	TCG	.	.																					30802830
RP11-317N12.1	0	.	GRCh37	8	33653618	33653618	+	Intron	DEL	A	A	-	rs201521625		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																n.130-193del			ENST00000517292		3	.	3	0	.	0	RP11-317N12.1,intron_variant,,ENST00000517292,;RP11-317N12.1,intron_variant,,ENST00000523063,;,regulatory_region_variant,,ENSR00001423410,;	-	ENSG00000253642	ENST00000517292	Transcript	intron_variant,non_coding_transcript_variant						rs201521625	1		1	RP11-317N12.1	Clone_based_vega_gene		lincRNA											1/1				0.0245			0.0348	0.0041										MODIFIER		deletion														.	TCAA	.	.																					33653617
KCNU1	157855	.	GRCh37	8	36779848	36779849	+	Intron	INS	-	-	A	rs60216672		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.2597-150dup			ENST00000399881		19	.	3	23	.	0	KCNU1,intron_variant,,ENST00000399881,NM_001031836.2;KCNU1,intron_variant,,ENST00000522372,;	A	ENSG00000215262	ENST00000399881	Transcript	intron_variant						rs60216672	1		1	KCNU1	HGNC	18867	protein_coding	YES	CCDS55220.1	ENSP00000382770	A8MYU2		UPI0000F079EF	NM_001031836.2				23/26																		MODIFIER	1	insertion														.	AGA	.	.																					36779848
Unknown	0	.	GRCh37	8	49616089	49616090	+	IGR	DEL	CA	CA	-	rs34798159		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CA	CA																					3	.	3	0	.	0		-				intergenic_variant						rs34798159	1																				0.0613	0.4395		0.4107	0.5984	0.4571										MODIFIER	1	deletion														.	AGCAC	.	.																					49616088
LYPLA1	10434	.	GRCh37	8	54983791	54983791	+	Intron	DEL	G	G	-	rs35502878		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.102-5418del			ENST00000316963		3	.	3	0	.	0	LYPLA1,intron_variant,,ENST00000316963,NM_001279357.1,NM_006330.3,NM_001279356.1,NM_001279358.1,NM_001279359.1,NM_001279360.1;LYPLA1,intron_variant,,ENST00000343231,;LYPLA1,intron_variant,,ENST00000518546,;LYPLA1,intron_variant,,ENST00000521352,;LYPLA1,intron_variant,,ENST00000521898,;LYPLA1,intron_variant,,ENST00000522007,;LYPLA1,intron_variant,,ENST00000519272,;LYPLA1,intron_variant,,ENST00000519891,;LYPLA1,intron_variant,,ENST00000519926,;LYPLA1,intron_variant,,ENST00000520896,;LYPLA1,intron_variant,,ENST00000517297,;TDGF1P5,upstream_gene_variant,,ENST00000523009,;,regulatory_region_variant,,ENSR00001740766,;	-	ENSG00000120992	ENST00000316963	Transcript	intron_variant						rs35502878	1		-1	LYPLA1	HGNC	6737	protein_coding	YES	CCDS6157.1	ENSP00000320043	O75608	Q6IAQ1,E5RJ48,B4DJV9	UPI0000072858	NM_001279357.1,NM_006330.3,NM_001279356.1,NM_001279358.1,NM_001279359.1,NM_001279360.1				2/8			0.1664	0.3473		0.7341	0.16	0.5225										MODIFIER	1	deletion														.	CTGG	.	.																					54983790
Unknown	0	.	GRCh37	8	57666986	57666993	+	IGR	DEL	GTGTGTGT	GTGTGTGT	-	rs6150591		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GTGTGTGT	GTGTGTGT																					4	.	4	0	.	0		-				intergenic_variant						rs6150591	1																				0.9402	0.8357		0.9851	0.8509	0.9427										MODIFIER	1	deletion														.	CCGTGTGTGTG	.	.																					57666985
Unknown	0	.	GRCh37	8	61788223	61788224	+	IGR	DEL	GG	GG	-	rs5891781		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GG	GG																					5	.	3	3	.	0		-				intergenic_variant						rs5891781	1																																			MODIFIER	1	deletion														.	TTGGG	.	.																					61788222
NKAIN3	286183	.	GRCh37	8	63317378	63317379	+	Intron	INS	-	-	AGA	rs34922576		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.54+155694_54+155695insAAG			ENST00000523211		5	.	5	0	.	0	NKAIN3,intron_variant,,ENST00000328472,;NKAIN3,intron_variant,,ENST00000523211,NM_173688.2;NKAIN3,intron_variant,,ENST00000524201,;NKAIN3,intron_variant,,ENST00000519049,;NKAIN3,intron_variant,,ENST00000523367,;	AGA	ENSG00000185942	ENST00000523211	Transcript	intron_variant						rs34922576	1		1	NKAIN3	HGNC	26829	protein_coding	YES	CCDS55239.1	ENSP00000429073	Q8N8D7		UPI000006F596	NM_173688.2				1/6			0.1407	0.4395		0.2411	0.5487	0.5307										MODIFIER	1	insertion														.	TCA	.	.																					63317378
NKAIN3	286183	.	GRCh37	8	63737051	63737066	+	Intron	DEL	ACACACACACACACAC	ACACACACACACACAC	-	rs6150612		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACACACACACACAC	ACACACACACACACAC																c.471+77388_471+77403del			ENST00000523211		3	.	3	0	.	0	NKAIN3,intron_variant,,ENST00000328472,;NKAIN3,intron_variant,,ENST00000523211,NM_173688.2;NKAIN3,intron_variant,,ENST00000519049,;NKAIN3,intron_variant,,ENST00000523367,;	-	ENSG00000185942	ENST00000523211	Transcript	intron_variant						rs6150612	1		1	NKAIN3	HGNC	26829	protein_coding	YES	CCDS55239.1	ENSP00000429073	Q8N8D7		UPI000006F596	NM_173688.2				4/6																		MODIFIER	1	deletion														.	CAACACACACACACACACA	.	.																					63737050
PREX2	80243	.	GRCh37	8	68920674	68920676	+	Intron	DEL	AGA	AGA	-	rs5892125		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGA	AGA																c.142-9405_142-9403del			ENST00000288368		3	.	3	0	.	0	PREX2,intron_variant,,ENST00000288368,NM_024870.2,NM_025170.4;PREX2,intron_variant,,ENST00000517617,;PREX2,intron_variant,,ENST00000529398,;	-	ENSG00000046889	ENST00000288368	Transcript	intron_variant						rs5892125	1		1	PREX2	HGNC	22950	protein_coding	YES	CCDS6201.1	ENSP00000288368	Q70Z35	Q56UR8	UPI0000375435	NM_024870.2,NM_025170.4				1/39			0.8782	0.3329		0.1895	0.3042	0.4489										MODIFIER	1	deletion													1	.	AGAGAA	.	.																					68920673
XKR9	389668	.	GRCh37	8	71670512	71670515	+	Intron	DEL	TCTC	TCTC	-	rs80272143		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCTC	TCTC																n.353-31056_353-31053del			ENST00000520273		3	.	3	0	.	0	XKR9,intron_variant,,ENST00000520273,;	-	ENSG00000221947	ENST00000520273	Transcript	intron_variant,non_coding_transcript_variant						rs80272143	1		1	XKR9	HGNC	20937	processed_transcript											2/3			0.0477	0.0461			0.0835	0.0327										MODIFIER	1	deletion														.	GGTCTCT	.	.																					71670511
RP11-758M4.1	0	.	GRCh37	8	75583349	75583350	+	Intron	DEL	GT	GT	-	rs34920389		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																c.74-31243_74-31242del			ENST00000523118		3	.	3	0	.	0	RP11-758M4.1,intron_variant,,ENST00000518190,;RP11-758M4.1,intron_variant,,ENST00000523118,;RP11-758M4.1,intron_variant,,ENST00000523442,;	-	ENSG00000254349	ENST00000523118	Transcript	intron_variant						rs34920389	1		1	RP11-758M4.1	Clone_based_vega_gene		protein_coding	YES		ENSP00000430470		E5RJ19,E5RJ07,E5RIT5	UPI00001405E1					2/5			0.2201	0.2651		0.1131	0.2803	0.2904										MODIFIER	1	deletion														.	ACGTG	.	.																					75583348
HIGD1AP18	0	.	GRCh37	8	77921009	77921010	+	3'Flank	INS	-	-	A	rs11428396		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000520730		3	.	3	0	.	0	HIGD1AP18,downstream_gene_variant,,ENST00000520730,;	A	ENSG00000253952	ENST00000520730	Transcript	downstream_gene_variant						rs11428396	1	4977	-1	HIGD1AP18	HGNC	43013	processed_pseudogene	YES													0.3109	0.5937		0.4802	0.5328	0.5716										MODIFIER	1	insertion														.	GTA	.	.																					77921009
ENSR00001431859	0	.	GRCh37	8	83759093	83759115	+	IGR	DEL	TGATAGTTTAATTTAAGGAAAAA	TGATAGTTTAATTTAAGGAAAAA	-	rs11268160		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGATAGTTTAATTTAAGGAAAAA	TGATAGTTTAATTTAAGGAAAAA																			ENSR00001431859		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001431859,;	-		ENSR00001431859	RegulatoryFeature	regulatory_region_variant						rs11268160	1																				0.3253	0.2695		0.3185	0.2853	0.2321										MODIFIER	1	deletion														.	AGTGATAGTTTAATTTAAGGAAAAAT	.	.																					83759092
RALYL	138046	.	GRCh37	8	85681477	85681478	+	Intron	INS	-	-	T	rs149651525		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.296-5336dup			ENST00000517638		3	.	3	0	.	0	RALYL,intron_variant,,ENST00000517638,NM_001100391.1;RALYL,intron_variant,,ENST00000517988,;RALYL,intron_variant,,ENST00000518566,NM_001287243.1;RALYL,intron_variant,,ENST00000521268,NM_173848.5;RALYL,intron_variant,,ENST00000521376,;RALYL,intron_variant,,ENST00000521695,NM_001100393.1;RALYL,intron_variant,,ENST00000522455,NM_001100392.1;RALYL,intron_variant,,ENST00000523850,NM_001287244.1;	T	ENSG00000184672	ENST00000517638	Transcript	intron_variant						rs149651525	1		1	RALYL	HGNC	27036	protein_coding	YES	CCDS55252.1	ENSP00000430128		G3V129,E5RIX9,E5RG71	UPI00002108E6	NM_001100391.1				2/8			0.1959	0.2161		0.1359	0.2634	0.1605										MODIFIER	1	insertion														.	TCT	.	.																					85681477
CA1	759	.	GRCh37	8	86250862	86250869	+	Intron	DEL	TTTCTTTC	TTTCTTTC	-	rs56255763		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTTCTTTC	TTTCTTTC																c.38-191_38-184del			ENST00000523953		10	8	2	21	0	0	CA1,intron_variant,,ENST00000256119,NM_001738.3;CA1,intron_variant,,ENST00000431316,;CA1,intron_variant,,ENST00000432364,NM_001164830.1;CA1,intron_variant,,ENST00000517590,;CA1,intron_variant,,ENST00000517618,;CA1,intron_variant,,ENST00000519129,;CA1,intron_variant,,ENST00000519991,;CA1,intron_variant,,ENST00000520663,;CA1,intron_variant,,ENST00000521846,;CA1,intron_variant,,ENST00000522389,;CA1,intron_variant,,ENST00000522579,;CA1,intron_variant,,ENST00000522662,;CA1,intron_variant,,ENST00000522814,;CA1,intron_variant,,ENST00000523022,NM_001128830.2,NM_001128831.2,NM_001128829.2;CA1,intron_variant,,ENST00000523858,;CA1,intron_variant,,ENST00000523953,;CA1,intron_variant,,ENST00000524324,;CA1,intron_variant,,ENST00000542576,;CA1,upstream_gene_variant,,ENST00000521679,;CA1,intron_variant,,ENST00000518341,;CA1,intron_variant,,ENST00000517429,;CA1,intron_variant,,ENST00000518233,;CA1,intron_variant,,ENST00000520093,;CA1,intron_variant,,ENST00000520990,;CA1,downstream_gene_variant,,ENST00000520692,;CA1,upstream_gene_variant,,ENST00000523712,;	-	ENSG00000133742	ENST00000523953	Transcript	intron_variant						rs56255763	1		-1	CA1	HGNC	1368	protein_coding	YES	CCDS6237.1	ENSP00000430656	P00915	E5RIF9,E5RHS7,E5RHP7,E5RH81,E5RGU8,E5RG43,E5RFL2	UPI000013CEEF					3/8																		MODIFIER	1	deletion														.	TTTTTCTTTCT	.	.																					86250861
AB015752.3	101930237	.	GRCh37	8	91565086	91565087	+	Intron	INS	-	-	A	rs35179051		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.562+1492dup			ENST00000521975		5	.	3	3	.	0	LINC00534,intron_variant,,ENST00000524361,;AB015752.3,intron_variant,,ENST00000521975,;	A	ENSG00000254180	ENST00000521975	Transcript	intron_variant,non_coding_transcript_variant						rs35179051	1		-1	AB015752.3	Clone_based_vega_gene		processed_transcript	YES										4/4																		MODIFIER	1	insertion														.	TGA	.	.																					91565086
LRRC69	100130742	.	GRCh37	8	92188043	92188044	+	Intron	INS	-	-	T	rs11337903		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.652-13695dup			ENST00000448384		3	.	3	0	.	0	LRRC69,intron_variant,,ENST00000343709,;LRRC69,intron_variant,,ENST00000448384,NM_001129890.1;LRRC69,intron_variant,,ENST00000520099,;	T	ENSG00000214954	ENST00000448384	Transcript	intron_variant						rs11337903	1		1	LRRC69	HGNC	34303	protein_coding	YES		ENSP00000400803	Q6ZNQ3	E5RJ66	UPI00006C0DD3	NM_001129890.1				5/7																		MODIFIER	1	insertion														.	AGT	.	.																					92188043
TRIQK	286144	.	GRCh37	8	93971709	93971724	+	Intron	DEL	ACACACACACACACAC	ACACACACACACACAC	-	rs34816958		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACACACACACACACAC	ACACACACACACACAC																c.-180-4932_-180-4917del			ENST00000521988		4	.	4	0	.	0	TRIQK,intron_variant,,ENST00000378861,;TRIQK,intron_variant,,ENST00000517751,;TRIQK,intron_variant,,ENST00000517858,NM_001171796.1;TRIQK,intron_variant,,ENST00000518748,NM_001171795.1;TRIQK,intron_variant,,ENST00000519069,;TRIQK,intron_variant,,ENST00000519969,NM_001191036.1;TRIQK,intron_variant,,ENST00000520430,NM_001171798.1;TRIQK,intron_variant,,ENST00000520686,;TRIQK,intron_variant,,ENST00000521617,;TRIQK,intron_variant,,ENST00000521988,NM_001171797.1;TRIQK,intron_variant,,ENST00000522903,;TRIQK,intron_variant,,ENST00000522925,;TRIQK,intron_variant,,ENST00000523580,;TRIQK,intron_variant,,ENST00000524037,;TRIQK,intron_variant,,ENST00000524107,NM_001191035.1;TRIQK,intron_variant,,ENST00000537541,NM_001171799.1;CTD-3239E11.2,intron_variant,,ENST00000523197,;TRIQK,intron_variant,,ENST00000517540,;TRIQK,intron_variant,,ENST00000518400,;TRIQK,intron_variant,,ENST00000520384,;TRIQK,intron_variant,,ENST00000523375,;TRIQK,downstream_gene_variant,,ENST00000519792,;TRIQK,intron_variant,,ENST00000523060,;TRIQK,intron_variant,,ENST00000524260,;	-	ENSG00000205133	ENST00000521988	Transcript	intron_variant						rs34816958	1		-1	TRIQK	HGNC	27828	protein_coding	YES	CCDS55261.1	ENSP00000429517	Q629K1	E5RIT1	UPI0000210300	NM_001171797.1				1/4																		MODIFIER	1	deletion														.	ATACACACACACACACACA	.	.																					93971708
LINC00535	642924	.	GRCh37	8	94336197	94336198	+	Intron	DEL	TA	TA	-	rs3029768		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TA	TA																n.469+16206_469+16207del			ENST00000520096		4	.	3	3	.	0	LINC00535,intron_variant,,ENST00000520096,;	-	ENSG00000246662	ENST00000520096	Transcript	intron_variant,non_coding_transcript_variant						rs3029768	1		-1	LINC00535	HGNC	43644	antisense											4/5			0.3873	0.5043		0.626	0.4692	0.4816										MODIFIER	1	deletion														.	TGTAT	.	.																					94336196
RAD54B	25788	.	GRCh37	8	95396749	95396772	+	Intron	DEL	TTCAGTTTTGTTTGCAAAACTGAA	TTCAGTTTTGTTTGCAAAACTGAA	-	rs11273608		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTCAGTTTTGTTTGCAAAACTGAA	TTCAGTTTTGTTTGCAAAACTGAA																c.1985+2440_1985+2463del			ENST00000336148		3	.	3	0	.	0	RAD54B,intron_variant,,ENST00000336148,NM_012415.3;FSBP,intron_variant,,ENST00000517506,;RAD54B,intron_variant,,ENST00000518358,;	-	ENSG00000197275	ENST00000336148	Transcript	intron_variant						rs11273608	1		-1	RAD54B	HGNC	17228	protein_coding	YES	CCDS6262.1	ENSP00000336606	Q9Y620	E5RHN9	UPI0000070088	NM_012415.3				11/14																		MODIFIER	1	deletion														.	ATTTCAGTTTTGTTTGCAAAACTGAAA	.	.																					95396748
NCALD	83988	.	GRCh37	8	102701457	102701457	+	3'UTR	DEL	A	A	-	rs202125406		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.*80del			ENST00000395923	6/6	3	.	3	0	.	0	NCALD,3_prime_UTR_variant,,ENST00000395923,NM_001040630.1,NM_001040627.1,NM_001040629.1,NM_001040628.1;NCALD,3_prime_UTR_variant,,ENST00000311028,NM_001040626.1,NM_001040624.1;NCALD,3_prime_UTR_variant,,ENST00000220931,NM_032041.2;NCALD,3_prime_UTR_variant,,ENST00000521599,NM_001040625.1;NCALD,3_prime_UTR_variant,,ENST00000519508,;NCALD,intron_variant,,ENST00000522448,;NCALD,intron_variant,,ENST00000522951,;NCALD,downstream_gene_variant,,ENST00000520690,;KB-1107E3.1,downstream_gene_variant,,ENST00000518749,;NCALD,non_coding_transcript_exon_variant,,ENST00000522754,;,regulatory_region_variant,,ENSR00001744927,;	-	ENSG00000104490	ENST00000395923	Transcript	3_prime_UTR_variant	1122/3808					rs202125406	2		-1	NCALD	HGNC	7655	protein_coding	YES	CCDS6292.1	ENSP00000379256	P61601	E5RK89,E5RJT1,E5RJJ6,E5RIZ1,E5RIX3,E5RIG4,E5RI95,E5RI78,E5RHE8,E5RHC8,E5RGZ0,E5RFL9,B2RB70	UPI0000004090	NM_001040630.1,NM_001040627.1,NM_001040629.1,NM_001040628.1			6/6																			MODIFIER	1	sequence_alteration														.	GCAA	.	.																					102701456
ANGPT1	284	.	GRCh37	8	108367303	108367303	+	Intron	DEL	T	T	-	rs75427839		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.298-7978del			ENST00000517746		4	.	4	0	.	0	ANGPT1,intron_variant,,ENST00000297450,;ANGPT1,intron_variant,,ENST00000517746,NM_001199859.1,NM_001146.3;ANGPT1,intron_variant,,ENST00000520033,;	-	ENSG00000154188	ENST00000517746	Transcript	intron_variant						rs75427839	1		-1	ANGPT1	HGNC	484	protein_coding	YES	CCDS6306.1	ENSP00000428340	Q15389	E5RFF4,B4E3G9,B4DTQ9	UPI0000034766	NM_001199859.1,NM_001146.3				1/8			0.1354	0.3501		0.4683	0.4553	0.4571										MODIFIER	1	deletion													1	.	TGTT	.	.																					108367302
PKHD1L1	93035	.	GRCh37	8	110485747	110485748	+	Intron	INS	-	-	A	rs1018548199		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.8606-1588dup			ENST00000378402		3	.	3	0	.	0	PKHD1L1,intron_variant,,ENST00000378402,NM_177531.4;RP11-419L20.2,downstream_gene_variant,,ENST00000518703,;	A	ENSG00000205038	ENST00000378402	Transcript	intron_variant						rs1018548199	1		1	PKHD1L1	HGNC	20313	protein_coding	YES	CCDS47911.1	ENSP00000367655	Q86WI1		UPI0000E5B020	NM_177531.4				50/77																		MODIFIER	1	insertion														.	AGA	.	.																					110485747
Unknown	0	.	GRCh37	8	113190797	113190799	+	IGR	DEL	AAG	AAG	-	rs35311575		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAG	AAG																					4	.	4	0	.	0		-				intergenic_variant						rs35311575	1																				0.1029	0.4179		0.2262	0.4473	0.4233										MODIFIER	1	deletion														.	ACAAGA	.	.																					113190796
Unknown	0	.	GRCh37	8	114497594	114497595	+	IGR	INS	-	-	TGTT	rs34762154		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TGTT				intergenic_variant						rs34762154	1																				0.0794	0.1527		0.0526	0.333	0.136										MODIFIER	1	insertion														.	TCT	.	.																					114497594
TRPS1	7227	.	GRCh37	8	116454682	116454682	+	Intron	DEL	G	G	-	rs34940485		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.2701-24002del			ENST00000395715		3	.	3	0	.	0	TRPS1,intron_variant,,ENST00000220888,;TRPS1,intron_variant,,ENST00000395715,NM_014112.2,NM_001282903.1;TRPS1,intron_variant,,ENST00000518018,;TRPS1,intron_variant,,ENST00000519076,;TRPS1,intron_variant,,ENST00000520276,NM_001282902.1;	-	ENSG00000104447	ENST00000395715	Transcript	intron_variant						rs34940485	1		-1	TRPS1	HGNC	12340	protein_coding	YES	CCDS6318.2	ENSP00000379065	Q9UHF7	F8W8T0,E7EVN4,C9J6L7	UPI00002104B8	NM_014112.2,NM_001282903.1				5/6			0.0219	0.2046		0.3274	0.3181	0.4162										MODIFIER	1	deletion													1	.	TAGG	.	.																					116454681
Unknown	0	.	GRCh37	8	124176961	124176962	+	IGR	INS	-	-	A	rs35531119		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		A				intergenic_variant						rs35531119	1																				0.8729	0.7522		0.8085	0.7505	0.7249										MODIFIER	1	insertion														.	TCA	.	.																					124176961
Unknown	0	.	GRCh37	8	125798040	125798040	+	IGR	DEL	A	A	-	rs34467187		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					4	.	4	0	.	0		-				intergenic_variant						rs34467187	1																			0.2031	0.2806	0.1671		0.0903	0.2565	0.1851										MODIFIER	1	deletion														.	TGAT	.	.																					125798039
PCAT1	100750225	.	GRCh37	8	128034515	128034516	+	3'Flank	INS	-	-	A	rs77678109		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000561978		4	.	4	0	.	0	PCAT1,downstream_gene_variant,,ENST00000561978,;	A	ENSG00000253438	ENST00000561978	Transcript	downstream_gene_variant						rs77678109	1	1256	1	PCAT1	HGNC	43022	lincRNA	YES													0.025	0.111		0.0813	0.1988	0.1779										MODIFIER	1	insertion														.	TTA	.	.																					128034515
CASC8	727677	.	GRCh37	8	128488261	128488262	+	Intron	DEL	AT	AT	-	rs200041668		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AT	AT																n.1041+3066_1041+3067del			ENST00000502082		5	.	5	0	.	0	CASC8,intron_variant,,ENST00000502056,;CASC8,intron_variant,,ENST00000502082,;	-	ENSG00000246228	ENST00000502082	Transcript	intron_variant,non_coding_transcript_variant						rs200041668	1		-1	CASC8	HGNC	45129	antisense	YES										4/5		0.1831	0.0522	0.2406		0.2163	0.2674	0.1984										MODIFIER	1	deletion														.	CCATG	.	.																					128488260
PVT1	5820	.	GRCh37	8	128895428	128895429	+	Intron	INS	-	-	A	rs34330730		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.368-7404dup			ENST00000504719		4	.	4	0	.	0	PVT1,intron_variant,,ENST00000504719,;PVT1,intron_variant,,ENST00000517525,;PVT1,intron_variant,,ENST00000517790,;PVT1,intron_variant,,ENST00000518528,;PVT1,intron_variant,,ENST00000521122,;PVT1,intron_variant,,ENST00000521951,;PVT1,intron_variant,,ENST00000522963,;PVT1,intron_variant,,ENST00000523068,;PVT1,intron_variant,,ENST00000523427,;,regulatory_region_variant,,ENSR00001747505,;	A	ENSG00000249859	ENST00000504719	Transcript	intron_variant,non_coding_transcript_variant						rs34330730	1		1	PVT1	HGNC	9709	lincRNA											2/2			0.146	0.1729		0.0317	0.2535	0.1779										MODIFIER		insertion														.	GCA	.	.																					128895428
ST3GAL1	6482	.	GRCh37	8	134465953	134465955	+	3'Flank	DEL	AAG	AAG	-	rs5895191		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAG	AAG																			ENST00000319914		4	.	4	0	.	0	ST3GAL1,downstream_gene_variant,,ENST00000319914,;ST3GAL1,downstream_gene_variant,,ENST00000399640,;ST3GAL1,downstream_gene_variant,,ENST00000521180,NM_173344.2,NM_003033.3;,regulatory_region_variant,,ENSR00001442000,;,regulatory_region_variant,,ENSR00001748189,;,TF_binding_site_variant,,ENSM00908307411,;	-	ENSG00000008513	ENST00000319914	Transcript	downstream_gene_variant						rs5895191	1	1136	-1	ST3GAL1	HGNC	10862	protein_coding	YES	CCDS6373.1	ENSP00000318445	Q11201	E5RHV6,E5RH34,E5RGL4,E5RGI3,E5RG72	UPI00000015E1								0.2163	0.7824		0.9841	0.7316	0.8344										MODIFIER	1	deletion														.	TAAAGA	.	.																					134465952
ST3GAL1	6482	.	GRCh37	8	134501111	134501112	+	Intron	INS	-	-	G	rs57405580		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-579-12266dup			ENST00000319914		6	.	4	3	.	0	ST3GAL1,intron_variant,,ENST00000319914,;ST3GAL1,intron_variant,,ENST00000517668,;ST3GAL1,intron_variant,,ENST00000519924,;ST3GAL1,intron_variant,,ENST00000521180,NM_173344.2,NM_003033.3;ST3GAL1,intron_variant,,ENST00000522652,;ST3GAL1,intron_variant,,ENST00000523634,;ST3GAL1,intron_variant,,ENST00000523854,;ST3GAL1,intron_variant,,ENST00000523855,;ST3GAL1,intron_variant,,ENST00000518298,;ST3GAL1,intron_variant,,ENST00000519435,;ST3GAL1,intron_variant,,ENST00000520020,;ST3GAL1,intron_variant,,ENST00000521627,;ST3GAL1,intron_variant,,ENST00000522873,;,regulatory_region_variant,,ENSR00000231325,;	G	ENSG00000008513	ENST00000319914	Transcript	intron_variant						rs57405580	1		-1	ST3GAL1	HGNC	10862	protein_coding	YES	CCDS6373.1	ENSP00000318445	Q11201	E5RHV6,E5RH34,E5RGL4,E5RGI3,E5RG72	UPI00000015E1					3/8																		MODIFIER	1	insertion														.	CAG	.	.																					134501111
Unknown	0	.	GRCh37	8	135770568	135770569	+	IGR	INS	-	-	AAAAC	rs71576101		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		AAAAC				intergenic_variant						rs71576101	1																				0.2526	0.2291		0.245	0.3549	0.3548										MODIFIER	1	insertion														.	AAA	.	.																					135770568
RP11-149P24.1	0	.	GRCh37	8	137155699	137155700	+	Intron	INS	-	-	GT	rs3064089		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.331-18997_331-18996dup			ENST00000523150		5	.	5	0	.	0	RP11-149P24.1,intron_variant,,ENST00000502901,;RP11-149P24.1,intron_variant,,ENST00000523150,;	GT	ENSG00000253248	ENST00000523150	Transcript	intron_variant,non_coding_transcript_variant						rs3064089	1		1	RP11-149P24.1	Clone_based_vega_gene		lincRNA	YES										2/4			0.2322	0.4885		0.6508	0.4374	0.5542										MODIFIER	1	insertion														.	TGG	.	.																					137155699
RP11-30J20.1	0	.	GRCh37	8	137786853	137786855	+	Intron	DEL	AGA	AGA	-	rs60909054		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGA	AGA																n.85-15221_85-15219del			ENST00000517345		4	.	4	0	.	0	RP11-30J20.1,intron_variant,,ENST00000517345,;RP11-30J20.1,intron_variant,,ENST00000524346,;	-	ENSG00000254101	ENST00000517345	Transcript	intron_variant,non_coding_transcript_variant						rs60909054	1		1	RP11-30J20.1	Clone_based_vega_gene		lincRNA											1/3			0.1112	0.3573		0.5139	0.4294	0.5409										MODIFIER		deletion														.	ATAGAA	.	.																					137786852
Unknown	0	.	GRCh37	8	138755225	138755230	+	IGR	DEL	TCTATA	TCTATA	-	rs71300304		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TCTATA	TCTATA																					3	.	3	0	.	0		-				intergenic_variant						rs71300304	1																				0.1952	0.4914		0.4663	0.5378	0.3855										MODIFIER	1	deletion														.	ACTCTATAT	.	.																					138755224
COL22A1	169044	.	GRCh37	8	139844032	139844033	+	Intron	INS	-	-	C	rs11386378		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.845+1249_845+1250insG			ENST00000303045		6	.	3	5	.	0	COL22A1,intron_variant,,ENST00000303045,NM_152888.1;COL22A1,intron_variant,,ENST00000435777,;COL22A1,upstream_gene_variant,,ENST00000517515,;	C	ENSG00000169436	ENST00000303045	Transcript	intron_variant						rs11386378	1		-1	COL22A1	HGNC	22989	protein_coding	YES	CCDS6376.1	ENSP00000303153	Q8NFW1		UPI00001C1EA1	NM_152888.1				5/64		0.5803	0.4584	0.6297		0.6964	0.6054	0.5644										MODIFIER	1	insertion														.	GGA	.	.																					139844032
Unknown	0	.	GRCh37	8	139993219	139993219	+	IGR	DEL	T	T	-	rs200380191		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					4	.	4	0	.	0		-				intergenic_variant						rs200380191	1																																			MODIFIER	1	deletion														.	TCTT	.	.																					139993218
TRAPPC9	83696	.	GRCh37	8	140807568	140807569	+	Intron	DEL	GT	GT	-	rs560198114		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																c.3350-63124_3350-63123del			ENST00000389328		5	.	3	3	.	0	TRAPPC9,intron_variant,,ENST00000389327,;TRAPPC9,intron_variant,,ENST00000389328,NM_031466.5;TRAPPC9,intron_variant,,ENST00000438773,NM_001160372.1;TRAPPC9,intron_variant,,ENST00000520857,;TRAPPC9,intron_variant,,ENST00000519482,;TRAPPC9,intron_variant,,ENST00000521667,;TRAPPC9,intron_variant,,ENST00000521700,;TRAPPC9,intron_variant,,ENST00000522504,;TRAPPC9,intron_variant,,ENST00000523777,;TRAPPC9,intron_variant,,ENST00000524162,;	-	ENSG00000167632	ENST00000389328	Transcript	intron_variant						rs560198114	1		-1	TRAPPC9	HGNC	30832	protein_coding	YES	CCDS34946.1	ENSP00000373979	Q96Q05		UPI0000DBEF2B	NM_031466.5				21/22				0.0029			0.003	0.0102										MODIFIER	1	deletion													1	.	CCGTG	.	.																					140807567
TRAPPC9	83696	.	GRCh37	8	141034499	141034499	+	Intron	DEL	T	T	-	rs35795692		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.2851-323del			ENST00000389328		3	.	3	0	.	0	TRAPPC9,intron_variant,,ENST00000389327,;TRAPPC9,intron_variant,,ENST00000389328,NM_031466.5;TRAPPC9,intron_variant,,ENST00000438773,NM_001160372.1;TRAPPC9,intron_variant,,ENST00000520857,;TRAPPC9,intron_variant,,ENST00000517667,;TRAPPC9,intron_variant,,ENST00000520532,;TRAPPC9,intron_variant,,ENST00000521667,;TRAPPC9,intron_variant,,ENST00000523777,;	-	ENSG00000167632	ENST00000389328	Transcript	intron_variant						rs35795692	1		-1	TRAPPC9	HGNC	30832	protein_coding	YES	CCDS34946.1	ENSP00000373979	Q96Q05		UPI0000DBEF2B	NM_031466.5				17/22																		MODIFIER	1	deletion													1	.	TCTT	.	.																					141034498
Unknown	0	.	GRCh37	8	142936880	142936880	+	IGR	DEL	G	G	-	rs142989694		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					6	.	6	0	.	0		-				intergenic_variant						rs142989694	1																																			MODIFIER	1	deletion														.	GAGG	.	.																					142936879
TSNARE1	203062	.	GRCh37	8	143310945	143310946	+	Splice_Region	DEL	GA	GA	-	rs367749353		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GA	GA																c.1447-6_1447-5del			ENST00000307180		4	.	4	0	.	0	TSNARE1,splice_region_variant,,ENST00000307180,NM_145003.3;TSNARE1,splice_region_variant,,ENST00000520166,;TSNARE1,splice_region_variant,,ENST00000524325,;	-	ENSG00000171045	ENST00000307180	Transcript	splice_region_variant,intron_variant						rs367749353	1		-1	TSNARE1	HGNC	26437	protein_coding	YES	CCDS6384.1	ENSP00000303437	Q96NA8	E5RHW3,A0AVG3	UPI00001AEE5E	NM_145003.3				12/13									0.008208	0.007153								LOW	1	deletion														.	GGGAG	.	.												0.0001365	0.0003172	5.958e-05		5.599e-05	0.0005031	0.0001373			143310944
TOP1MT	116447	.	GRCh37	8	144404538	144404541	+	Intron	DEL	ACAG	ACAG	-	rs1310700892		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACAG	ACAG																c.961-985_961-982del			ENST00000329245		38	31	7	18	0	0	TOP1MT,intron_variant,,ENST00000329245,NM_052963.2;TOP1MT,intron_variant,,ENST00000519139,;TOP1MT,intron_variant,,ENST00000519148,NM_001258447.1;TOP1MT,intron_variant,,ENST00000521193,NM_001258446.1;TOP1MT,intron_variant,,ENST00000523676,;TOP1MT,downstream_gene_variant,,ENST00000518007,;TOP1MT,downstream_gene_variant,,ENST00000518760,;TOP1MT,downstream_gene_variant,,ENST00000519591,;TOP1MT,downstream_gene_variant,,ENST00000520950,;TOP1MT,downstream_gene_variant,,ENST00000522041,;TOP1MT,intron_variant,,ENST00000518951,;TOP1MT,downstream_gene_variant,,ENST00000522121,;TOP1MT,downstream_gene_variant,,ENST00000523417,;	-	ENSG00000184428	ENST00000329245	Transcript	intron_variant						rs1310700892	1		-1	TOP1MT	HGNC	29787	protein_coding	YES	CCDS6400.1	ENSP00000328835	Q969P6	E5KMK7,Q8TBP3,E5RJ95,E5RJ33,E5RFS0	UPI000013716D	NM_052963.2				7/13																		MODIFIER	1	deletion														.	ACACAGG	.	.																					144404537
ZC3H3	23144	.	GRCh37	8	144619845	144619845	+	Intron	DEL	G	G	-	rs10719055		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.1364+328del			ENST00000262577		7	.	7	0	.	0	ZC3H3,intron_variant,,ENST00000262577,NM_015117.2;7SK,upstream_gene_variant,,ENST00000408472,;7SK,upstream_gene_variant,,ENST00000517300,;RP11-661A12.5,downstream_gene_variant,,ENST00000530600,;	-	ENSG00000014164	ENST00000262577	Transcript	intron_variant						rs10719055	1		-1	ZC3H3	HGNC	28972	protein_coding	YES	CCDS6402.1	ENSP00000262577	Q8IXZ2		UPI0000160D96	NM_015117.2				2/11			0.2201	0.2709		0.0804	0.1978	0.2515										MODIFIER	1	deletion														.	CTGG	.	.																					144619844
ZNF707	286075	.	GRCh37	8	144772152	144772152	+	Intron	DEL	G	G	-	rs35228840		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.-52-69del			ENST00000532205		9	.	6	13	.	0	ZNF707,intron_variant,,ENST00000358656,NM_001100598.1,NM_001288808.1,NM_001288806.1;ZNF707,intron_variant,,ENST00000418203,;ZNF707,intron_variant,,ENST00000442058,;ZNF707,intron_variant,,ENST00000454097,NM_001100599.1;ZNF707,intron_variant,,ENST00000526315,;ZNF707,intron_variant,,ENST00000526970,;ZNF707,intron_variant,,ENST00000529833,;ZNF707,intron_variant,,ENST00000530574,;ZNF707,intron_variant,,ENST00000532158,NM_173831.3;ZNF707,intron_variant,,ENST00000532205,NM_001288805.1;ZNF707,intron_variant,,ENST00000534303,;ZNF707,intron_variant,,ENST00000527561,;ZNF707,intron_variant,,ENST00000530341,;ZNF707,intron_variant,,ENST00000531811,;ZNF707,intron_variant,,ENST00000532571,;ZNF707,intron_variant,,ENST00000525185,;ZNF707,intron_variant,,ENST00000525538,;ZNF707,intron_variant,,ENST00000525619,;ZNF707,intron_variant,,ENST00000525862,;ZNF707,intron_variant,,ENST00000527293,;ZNF707,intron_variant,,ENST00000528134,;ZNF707,intron_variant,,ENST00000528456,;ZNF707,intron_variant,,ENST00000531985,;ZNF707,intron_variant,,ENST00000532003,;ZNF707,intron_variant,,ENST00000532486,;ZNF707,intron_variant,,ENST00000533031,;ZNF707,intron_variant,,ENST00000533254,;ZNF707,intron_variant,,ENST00000534589,;ZNF707,upstream_gene_variant,,ENST00000531254,;	-	ENSG00000181135	ENST00000532205	Transcript	intron_variant						rs35228840	1		1	ZNF707	HGNC	27815	protein_coding	YES	CCDS47932.1	ENSP00000436212	Q96C28	E9PS67,E9PQ20,E9PNV7,E9PHZ0	UPI0000160D8F	NM_001288805.1				4/7			0.0318	0.464		0.1081	0.6541	0.3507										MODIFIER	1	deletion														.	GTGG	.	.																					144772151
CCDC166	100130274	.	GRCh37	8	144783901	144783901	+	3'Flank	DEL	C	C	-	rs34813024		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																			ENST00000542437		7	.	4	3	.	0	CCDC166,downstream_gene_variant,,ENST00000542437,NM_001162914.1;RP11-429J17.2,downstream_gene_variant,,ENST00000531565,;ZNF707,intron_variant,,ENST00000527561,;	-	ENSG00000255181	ENST00000542437	Transcript	downstream_gene_variant						rs34813024	1	4963	-1	CCDC166	HGNC	41910	protein_coding	YES	CCDS55280.1	ENSP00000437468	P0CW27		UPI00016623E2	NM_001162914.1						0.3387	0.1831	0.415		0.2054	0.5775	0.3865										MODIFIER	1	deletion														.	GACA	.	.																					144783900
ZNF250	58500	.	GRCh37	8	146105452	146105452	+	3'UTR	DEL	A	A	-	rs61668478		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.*1448del			ENST00000292579	6/6	3	.	3	0	.	0	ZNF250,3_prime_UTR_variant,,ENST00000292579,NM_021061.4,NM_001109689.3;ZNF250,intron_variant,,ENST00000342660,;ZNF250,intron_variant,,ENST00000543949,;ZNF250,downstream_gene_variant,,ENST00000417550,;ZNF250,downstream_gene_variant,,ENST00000525694,;ZNF250,downstream_gene_variant,,ENST00000533221,;ZNF250,downstream_gene_variant,,ENST00000533622,;ZNF250,intron_variant,,ENST00000528258,;ZNF250,intron_variant,,ENST00000529780,;ZNF250,intron_variant,,ENST00000533543,;,regulatory_region_variant,,ENSR00001749307,;	-	ENSG00000196150	ENST00000292579	Transcript	3_prime_UTR_variant	3248/6364					rs61668478	1		-1	ZNF250	HGNC	13044	protein_coding	YES	CCDS34972.1	ENSP00000292579	P15622		UPI0000197F51	NM_021061.4,NM_001109689.3			6/6																			MODIFIER	1	deletion														.	TCAA	.	.																					146105451
CARM1P1	0	.	GRCh37	9	2967657	2967657	+	Intron	DEL	A	A	-	rs61085701		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																n.428-19375del			ENST00000426329		5	.	3	3	.	0	CARM1P1,intron_variant,,ENST00000426329,;,regulatory_region_variant,,ENSR00001749632,;	-	ENSG00000227835	ENST00000426329	Transcript	intron_variant,non_coding_transcript_variant						rs61085701	1		-1	CARM1P1	HGNC	23392	transcribed_unprocessed_pseudogene	YES										4/10																		MODIFIER	1	deletion														.	TTAA	.	.																					2967656
GLDC	2731	.	GRCh37	9	6639395	6639396	+	Intron	INS	-	-	T	rs59912052		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.334+5218_334+5219insA			ENST00000321612		7	.	4	5	.	0	GLDC,intron_variant,,ENST00000321612,NM_000170.2;RP11-106A1.2,non_coding_transcript_exon_variant,,ENST00000332361,;,regulatory_region_variant,,ENSR00001446184,;	T	ENSG00000178445	ENST00000321612	Transcript	intron_variant						rs59912052	1		-1	GLDC	HGNC	4313	protein_coding	YES	CCDS34987.1	ENSP00000370737	P23378		UPI0000684276	NM_000170.2				2/24		0.6979	0.8691	0.7003		0.7044	0.5109	0.6503										MODIFIER	1	insertion													1	.	TCG	.	.																					6639395
PTPRD	5789	.	GRCh37	9	9540260	9540261	+	Intron	INS	-	-	C	rs56080030		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-237+34471_-237+34472insG			ENST00000381196		3	.	3	0	.	0	PTPRD,intron_variant,,ENST00000381196,NM_002839.3;PTPRD,intron_variant,,ENST00000463477,;	C	ENSG00000153707	ENST00000381196	Transcript	intron_variant						rs56080030	1		-1	PTPRD	HGNC	9668	protein_coding	YES	CCDS43786.1	ENSP00000370593	P23468	C9J6E4,B4DK48	UPI0000132990	NM_002839.3				5/42		0.3081	0.4236	0.3242		0.2093	0.3678	0.181										MODIFIER	1	insertion													1	.	CAT	.	.																					9540260
PES1P2	0	.	GRCh37	9	13982327	13982327	+	5'Flank	DEL	T	T	-	rs34015971		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																			ENST00000449745		3	.	3	0	.	0	PES1P2,upstream_gene_variant,,ENST00000449745,;	-	ENSG00000229268	ENST00000449745	Transcript	upstream_gene_variant						rs34015971	1	3847	1	PES1P2	HGNC	44059	processed_pseudogene	YES																												MODIFIER	1	deletion														.	CATT	.	.																					13982326
NFIB	4781	.	GRCh37	9	14185091	14185092	+	Intron	INS	-	-	AATA	rs57241853		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.563-5313_563-5312insTATT			ENST00000380953		5	.	5	0	.	0	NFIB,intron_variant,,ENST00000380934,NM_001190738.1;NFIB,intron_variant,,ENST00000380953,NM_001190737.1;NFIB,intron_variant,,ENST00000380959,NM_005596.3;NFIB,intron_variant,,ENST00000397575,;NFIB,intron_variant,,ENST00000397579,;NFIB,intron_variant,,ENST00000397581,;NFIB,upstream_gene_variant,,ENST00000380924,;NFIB,upstream_gene_variant,,ENST00000543693,NM_001282787.1;	AATA	ENSG00000147862	ENST00000380953	Transcript	intron_variant						rs57241853	1		-1	NFIB	HGNC	7785	protein_coding	YES	CCDS55291.1	ENSP00000370340	O00712		UPI0000211140	NM_001190737.1				2/10			0.6989	0.9813		0.9603	0.996	0.9898										MODIFIER	1	insertion													1	.	AGT	.	.																					14185091
ZDHHC21	340481	.	GRCh37	9	14623644	14623644	+	Intron	DEL	A	A	-	rs71322000		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.622-3964del			ENST00000380916		4	.	4	0	.	0	ZDHHC21,intron_variant,,ENST00000380916,NM_178566.4;	-	ENSG00000175893	ENST00000380916	Transcript	intron_variant						rs71322000	1		-1	ZDHHC21	HGNC	20750	protein_coding	YES	CCDS6475.1	ENSP00000370303	Q8IVQ6		UPI00000745E6	NM_178566.4				8/9			0.5787	0.7248		0.6141	0.6869	0.771										MODIFIER	1	deletion														.	AGAA	.	.																					14623643
CCDC171	203238	.	GRCh37	9	15761881	15761882	+	Intron	DEL	AA	AA	-	rs34656827		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																c.2672-15715_2672-15714del			ENST00000380701		3	.	3	0	.	0	CCDC171,intron_variant,,ENST00000297641,;CCDC171,intron_variant,,ENST00000380701,NM_173550.2;CCDC171,intron_variant,,ENST00000449575,;	-	ENSG00000164989	ENST00000380701	Transcript	intron_variant						rs34656827	1		1	CCDC171	HGNC	29828	protein_coding	YES	CCDS6481.1	ENSP00000370077	Q6TFL3	Q8NCV3	UPI000021C44B	NM_173550.2				18/25			0.0227	0.5807		0.6319	0.495	0.4519										MODIFIER	1	deletion														.	TCAAA	.	.																					15761880
Unknown	0	.	GRCh37	9	16105451	16105451	+	IGR	DEL	C	C	-	rs34392949		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																					3	.	3	0	.	0		-				intergenic_variant						rs34392949	1																				0.8079	0.3213		0.1091	0.3936	0.3681										MODIFIER	1	deletion														.	CACC	.	.																					16105450
CNTLN	54875	.	GRCh37	9	17273628	17273629	+	Intron	INS	-	-	AG	rs3840729		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.850-103_850-102insAG			ENST00000380647		9	.	3	12	.	0	CNTLN,intron_variant,,ENST00000262360,;CNTLN,intron_variant,,ENST00000380641,NM_001114395.1;CNTLN,intron_variant,,ENST00000380647,;CNTLN,intron_variant,,ENST00000425824,NM_017738.2;	AG	ENSG00000044459	ENST00000380647	Transcript	intron_variant						rs3840729	1		1	CNTLN	HGNC	23432	protein_coding	YES	CCDS43789.1	ENSP00000370021	Q9NXG0		UPI0000458809					5/25		0.3347	0.3298	0.245		0.3502	0.2853	0.4397										MODIFIER	1	insertion														.	ACT	.	.																					17273628
Unknown	0	.	GRCh37	9	18244086	18244089	+	IGR	DEL	TGTG	TGTG	-	rs5896777		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TGTG	TGTG																					3	.	3	0	.	0		-				intergenic_variant						rs5896777	1																																			MODIFIER	1	deletion														.	TTTGTGT	.	.																					18244085
Unknown	0	.	GRCh37	9	22255095	22255095	+	IGR	DEL	T	T	-	rs547632000		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					3	.	3	0	.	0		-				intergenic_variant						rs547632000	1																																			MODIFIER	1	deletion														.	GATT	.	.																					22255094
Unknown	0	.	GRCh37	9	31148859	31148860	+	IGR	INS	-	-	T	rs77643103		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs77643103	1																				0.5719	0.3588		0.4673	0.4483	0.5										MODIFIER	1	insertion														.	ACT	.	.																					31148859
B4GALT1	2683	.	GRCh37	9	33137646	33137650	+	Intron	DEL	TTAGA	TTAGA	-	rs75219428		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTAGA	TTAGA																c.413-2228_413-2224del			ENST00000379731		7	3	4	4	4	0	B4GALT1,intron_variant,,ENST00000379731,NM_001497.3;B4GALT1,intron_variant,,ENST00000535206,;	-	ENSG00000086062	ENST00000379731	Transcript	intron_variant						rs75219428	1		-1	B4GALT1	HGNC	924	protein_coding	YES	CCDS6535.1	ENSP00000369055	P15291	B7ZAH9,B4DMM8	UPI000002D22E	NM_001497.3				1/5																		MODIFIER	1	deletion													1	.	CCTTAGAG	.	.																					33137645
AQP7	364	.	GRCh37	9	33393517	33393518	+	Intron	INS	-	-	C	rs111966548		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.144+1558dup			ENST00000297988		6	3	3	7	0	0	AQP7,intron_variant,,ENST00000297988,NM_001170.1;AQP7,intron_variant,,ENST00000377425,;AQP7,intron_variant,,ENST00000379506,;AQP7,intron_variant,,ENST00000379507,;AQP7,intron_variant,,ENST00000439678,;AQP7,intron_variant,,ENST00000537089,;AQP7,intron_variant,,ENST00000539936,;AQP7,intron_variant,,ENST00000541274,;AQP7,upstream_gene_variant,,ENST00000379503,;,regulatory_region_variant,,ENSR00001751849,;	C	ENSG00000165269	ENST00000297988	Transcript	intron_variant						rs111966548	1		-1	AQP7	HGNC	640	protein_coding	YES	CCDS6541.1	ENSP00000297988	O14520	Q5T5L3	UPI0000125D23	NM_001170.1				3/7																		MODIFIER	1	insertion													1	.	AGC	.	.																					33393517
RP11-133O22.6	0	.	GRCh37	9	33807034	33807035	+	Intron	DEL	GT	GT	-	rs113439098		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GT	GT																n.170-7124_170-7123del			ENST00000454429		3	.	3	0	.	0	RP11-133O22.6,intron_variant,,ENST00000454429,;	-	ENSG00000235481	ENST00000454429	Transcript	intron_variant,non_coding_transcript_variant						rs113439098	1		-1	RP11-133O22.6	Clone_based_vega_gene		antisense	YES										1/3																		MODIFIER	1	deletion														.	CAGTG	.	.																					33807033
UBAP2	55833	.	GRCh37	9	33989202	33989203	+	Intron	DEL	TT	TT	-	rs34957423		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																c.289-79_289-78del			ENST00000379238		7	.	7	0	.	0	UBAP2,intron_variant,,ENST00000360802,NM_018449.2;UBAP2,intron_variant,,ENST00000379238,;UBAP2,intron_variant,,ENST00000379239,NM_001282529.1;UBAP2,intron_variant,,ENST00000412543,;UBAP2,intron_variant,,ENST00000418786,;UBAP2,intron_variant,,ENST00000449054,;UBAP2,intron_variant,,ENST00000539807,;UBAP2,upstream_gene_variant,,ENST00000421278,;	-	ENSG00000137073	ENST00000379238	Transcript	intron_variant						rs34957423	1		-1	UBAP2	HGNC	14185	protein_coding	YES	CCDS6547.1	ENSP00000368540	Q5T6F2	Q5JV03	UPI0000140784					4/28																		MODIFIER	1	deletion														.	TCTTT	.	.																					33989201
PIGO	84720	.	GRCh37	9	35099416	35099419	+	5'Flank	DEL	CTGT	CTGT	-	rs56091834		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTGT	CTGT																			ENST00000378617		6	.	3	3	.	0	PIGO,upstream_gene_variant,,ENST00000298004,NM_001201484.1;FAM214B,downstream_gene_variant,,ENST00000322813,NM_025182.2;PIGO,upstream_gene_variant,,ENST00000341666,;STOML2,downstream_gene_variant,,ENST00000356493,NM_013442.1,NM_001287032.1;PIGO,upstream_gene_variant,,ENST00000361778,NM_152850.3;FAM214B,downstream_gene_variant,,ENST00000378554,;FAM214B,downstream_gene_variant,,ENST00000378557,;FAM214B,downstream_gene_variant,,ENST00000378561,;FAM214B,downstream_gene_variant,,ENST00000378566,;PIGO,upstream_gene_variant,,ENST00000378617,NM_032634.3;STOML2,downstream_gene_variant,,ENST00000452248,NM_001287031.1;FAM214B,downstream_gene_variant,,ENST00000488109,;FAM214B,downstream_gene_variant,,ENST00000603301,;FAM214B,downstream_gene_variant,,ENST00000605244,;RP11-182N22.8,downstream_gene_variant,,ENST00000431804,;PIGO,upstream_gene_variant,,ENST00000472208,;STOML2,downstream_gene_variant,,ENST00000487490,;PIGO,upstream_gene_variant,,ENST00000492770,;PIGO,upstream_gene_variant,,ENST00000465745,;PIGO,upstream_gene_variant,,ENST00000474436,;STOML2,downstream_gene_variant,,ENST00000488050,;	-	ENSG00000165282	ENST00000378617	Transcript	upstream_gene_variant						rs56091834	1	2871	-1	PIGO	HGNC	23215	protein_coding	YES	CCDS6575.1	ENSP00000367880	Q8TEQ8		UPI0000048EF6	NM_032634.3							0.1884	0.2017		0.0714	0.2068	0.3037										MODIFIER	1	deletion													1	.	TCCTGTC	.	.																					35099415
FAM214B	80256	.	GRCh37	9	35110490	35110491	+	5'UTR	INS	-	T	T	rs5897594		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.-1976dup			ENST00000378561	1/8	6	.	0	3	.	3	FAM214B,5_prime_UTR_variant,,ENST00000378561,;FAM214B,intron_variant,,ENST00000322813,NM_025182.2;FAM214B,intron_variant,,ENST00000378554,;FAM214B,intron_variant,,ENST00000378557,;FAM214B,intron_variant,,ENST00000378566,;FAM214B,intron_variant,,ENST00000488109,;FAM214B,intron_variant,,ENST00000603301,;FAM214B,intron_variant,,ENST00000605244,;FAM214B,intron_variant,,ENST00000605104,;FAM214B,intron_variant,,ENST00000605392,;,regulatory_region_variant,,ENSR00000418574,;	T	ENSG00000005238	ENST00000378561	Transcript	5_prime_UTR_variant	1081-1082/5771					rs5897594	1		-1	FAM214B	HGNC	25666	protein_coding	YES	CCDS6578.1	ENSP00000367823	Q7L5A3		UPI0000169E3E				1/8				0.3949	0.5836		0.5694	0.493	0.4387										MODIFIER	1	insertion														.	TCT	.	.																					35110490
RP11-262H14.1	100996870	.	GRCh37	9	66464673	66464674	+	Intron	DEL	TG	TG	-	rs113415960		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																n.225-918_225-917del			ENST00000424345		6	4	2	11	11	0	RP11-262H14.1,intron_variant,,ENST00000424345,;RP11-262H14.1,intron_variant,,ENST00000427509,;RP11-262H14.1,downstream_gene_variant,,ENST00000452184,;	-	ENSG00000238113	ENST00000424345	Transcript	intron_variant,non_coding_transcript_variant						rs113415960	1		1	RP11-262H14.1	Clone_based_vega_gene		lincRNA	YES										2/4																		MODIFIER	1	deletion														.	ACTGT	.	.																					66464672
RP11-318K12.3	0	.	GRCh37	9	66833697	66833759	+	5'Flank	INS	TTCACTTTCCTAGAGCAGGTTTGAAACACTGTTTTTGTAGTATCTAGAACTGGACACTTGGAA	TTCACTTTCCTAGAGCAGGTTTGAAACACTGTTTTTGTAGTATCTAGAACTGGACACTTGGAA	CTTCACTTTCCTAGAGCAGGTTTGAAACACTGTTTTTGTAGTATCTAGAACTGGACACTTGGAA	rs377516594		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTCACTTTCCTAGAGCAGGTTTGAAACACTGTTTTTGTAGTATCTAGAACTGGACACTTGGAA	TTCACTTTCCTAGAGCAGGTTTGAAACACTGTTTTTGTAGTATCTAGAACTGGACACTTGGAA																			ENST00000602407		25	.	2	36	.	1	RP11-318K12.3,upstream_gene_variant,,ENST00000602407,;	TTGTAGTATCTGCAACTGGACATTTGGAGCGCTATTTGGCCTATAGTGAAGAAGGAAATATCTTCCCATAAAAACTAGACAGAAACATTCTCAGAAACTTGTTTGTGATGTGTGTAATCAACTAACAGAGTTGAACCTTTCTTTTGATAGAGCAGTTTTGAAACACTCTTTTTGCAGAATCTGCAAGTGGATATTAGGATAGATTTGAGGATTTCGTTGGAAATGGGAATATATTCATATAAAATCTAGACAGAAGCATTCTCACAAACTTGTTGGTGATGTGTGTACTCAACTAACAGAGTTGAACCTTTCTTTTGATAGAGCAGTTTTGAAACACTCTTTTTGTAGAGTCTGCAAGTGGATATTTGGATAGATTGAGGATTTCGTTGGGAAAGGGAATATCTTCACATAAAATCTAGAAGGACGCATTCTCAGAAACATCTTCATGATGTTTGCATTCAAGTCACAGAAGTGAACACTTCACTTTCCTAGAGCAGGTTTGAAACACTGTTTTTGTAGTATCTAGAACTGGACACTTGGAA	ENSG00000270092	ENST00000602407	Transcript	upstream_gene_variant						rs377516594	2	2903	1	RP11-318K12.3	Clone_based_vega_gene		processed_pseudogene	YES																												MODIFIER	1	indel														.	TTTGTAGTATCTGCAACTGGACATTTGGAGCGCTATTTGGCCTATAGTGAAGAAGGAAATATCTTCCCATAAAAACTAGACAGAAACATTCTCAGAAACTTGTTTGTGATGTGTGTAATCAACTAACAGAGTTGAACCTTTCTTTTGATAGAGCAGTTTTGAAACACTCTTTTTGCAGAATCTGCAAGTGGATATTAGGATAGATTTGAGGATTTCGTTGGAAATGGGAATATATTCATATAAAATCTAGACAGAAGCATTCTCACAAACTTGTTGGTGATGTGTGTACTCAACTAACAGAGTTGAACCTTTCTTTTGATAGAGCAGTTTTGAAACACTCTTTTTGTAGAGTCTGCAAGTGGATATTTGGATAGATTGAGGATTTCGTTGGGAAAGGGAATATCTTCACATAAAATCTAGAAGGACGCATTCTCAGAAACATCTTCATGATGTTTGCATTCAAGTCACAGAAGTGAACATTCACTTTCCTAGAGCAGGTTTGAAACACTGTTTTTGTAGTATCTAGAACTGGACACTTGGAAC	.	.																					66833219
AQP7P1	0	.	GRCh37	9	67282933	67282933	+	Intron	DEL	T	T	-	rs5898015		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																n.361-1102del			ENST00000334576		6	4	2	4	4	0	AQP7P1,intron_variant,,ENST00000334576,;AQP7P1,intron_variant,,ENST00000412626,;RP11-236F9.2,upstream_gene_variant,,ENST00000444603,;	-	ENSG00000186466	ENST00000334576	Transcript	intron_variant,non_coding_transcript_variant						rs5898015	1		-1	AQP7P1	HGNC	32048	unprocessed_pseudogene	YES										2/8		0.2698	0.2133	0.2522		0.3304	0.2485	0.318										MODIFIER	1	deletion														.	CATG	.	.																					67282932
RP11-764K9.1	0	.	GRCh37	9	68401175	68401176	+	RNA	INS	-	-	T	rs113540596		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.644dup			ENST00000417843	3/5	4	.	4	0	.	0	RP11-764K9.1,non_coding_transcript_exon_variant,,ENST00000417843,;	T	ENSG00000225411	ENST00000417843	Transcript	non_coding_transcript_exon_variant	644-645/2878					rs113540596	1		-1	RP11-764K9.1	Clone_based_vega_gene		lincRNA	YES									3/5				0.2073	0.049		0.372	0.0427	0.1043										MODIFIER	1	insertion														.	ACT	.	.																					68401175
RP11-764K9.1	0	.	GRCh37	9	68407616	68407616	+	Intron	DEL	A	A	-	rs138037746		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																n.68-235del			ENST00000417843		6	4	2	7	7	0	RP11-764K9.1,intron_variant,,ENST00000417843,;RNA5SP284,upstream_gene_variant,,ENST00000384547,;,regulatory_region_variant,,ENSR00001753230,;,TF_binding_site_variant,,ENSM00527702866,;	-	ENSG00000225411	ENST00000417843	Transcript	intron_variant,non_coding_transcript_variant						rs138037746	1		-1	RP11-764K9.1	Clone_based_vega_gene		lincRNA	YES										1/4																		MODIFIER	1	deletion														.	GCAG	.	.																					68407615
RP11-764K9.4	0	.	GRCh37	9	68430022	68430025	+	Intron	DEL	CAAA	CAAA	-	rs112735354		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAAA	CAAA																n.787+145_787+148del			ENST00000376334		38	.	3	40	.	0	RP11-764K9.4,intron_variant,,ENST00000376334,;	-	ENSG00000215548	ENST00000376334	Transcript	intron_variant,non_coding_transcript_variant						rs112735354	1		-1	RP11-764K9.4	Clone_based_vega_gene		unprocessed_pseudogene	YES										7/8																		MODIFIER	1	deletion														.	CTCAAAC	.	.																					68430021
RP11-764K9.4	0	.	GRCh37	9	68438314	68438314	+	Intron	DEL	T	T	-	rs1235743462		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																n.412+244del			ENST00000376334		6	4	2	7	7	0	RP11-764K9.4,intron_variant,,ENST00000376334,;	-	ENSG00000215548	ENST00000376334	Transcript	intron_variant,non_coding_transcript_variant						rs1235743462	1		-1	RP11-764K9.4	Clone_based_vega_gene		unprocessed_pseudogene	YES										3/8																		MODIFIER	1	deletion														.	TATT	.	.																					68438313
RP11-764K9.4	0	.	GRCh37	9	68439545	68439545	+	Intron	DEL	C	C	-	rs1267075856		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	C	C																n.287-862del			ENST00000376334		3	.	3	0	.	0	RP11-764K9.4,intron_variant,,ENST00000376334,;	-	ENSG00000215548	ENST00000376334	Transcript	intron_variant,non_coding_transcript_variant						rs1267075856	1		-1	RP11-764K9.4	Clone_based_vega_gene		unprocessed_pseudogene	YES										2/8																		MODIFIER	1	deletion														.	GTCT	.	.																					68439544
RP11-460N11.2	0	.	GRCh37	9	69837149	69837153	+	Intron	DEL	ATTAA	ATTAA	-	rs140843738		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ATTAA	ATTAA																n.258+2395_258+2399del			ENST00000455242		4	.	4	0	.	0	RP11-460N11.2,intron_variant,,ENST00000455242,;	-	ENSG00000197550	ENST00000455242	Transcript	intron_variant,non_coding_transcript_variant						rs140843738	1		1	RP11-460N11.2	Clone_based_vega_gene		unprocessed_pseudogene	YES										3/4																		MODIFIER	1	deletion														.	AGATTAAA	.	.																					69837148
APBA1	320	.	GRCh37	9	72177297	72177297	+	Intron	DEL	T	T	-	rs11393335		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.-69-45102del			ENST00000265381		3	.	3	0	.	0	APBA1,intron_variant,,ENST00000265381,NM_001163.3;	-	ENSG00000107282	ENST00000265381	Transcript	intron_variant						rs11393335	1		-1	APBA1	HGNC	578	protein_coding	YES	CCDS6630.1	ENSP00000265381	Q02410		UPI000013D611	NM_001163.3				1/12																		MODIFIER	1	deletion														.	TCTT	.	.																					72177296
MAMDC2	256691	.	GRCh37	9	72786253	72786254	+	Intron	INS	-	-	T	rs11376987		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1651+716dup			ENST00000377182		3	.	3	0	.	0	MAMDC2,intron_variant,,ENST00000377182,NM_153267.4;MAMDC2-AS1,intron_variant,,ENST00000377178,;MAMDC2-AS1,intron_variant,,ENST00000448377,;MAMDC2-AS1,intron_variant,,ENST00000535188,;MAMDC2-AS1,intron_variant,,ENST00000591368,;MAMDC2-AS1,downstream_gene_variant,,ENST00000420573,;MAMDC2,downstream_gene_variant,,ENST00000460688,;	T	ENSG00000165072	ENST00000377182	Transcript	intron_variant						rs11376987	1		1	MAMDC2	HGNC	23673	protein_coding	YES	CCDS6631.1	ENSP00000366387	Q7Z304		UPI000013E44F	NM_153267.4				11/13			0.7239	0.7925		0.7222	0.7495	0.6401										MODIFIER	1	insertion														.	AAT	.	.																					72786253
TRPM3	80036	.	GRCh37	9	73913011	73913011	+	Intron	DEL	A	A	-	rs11288806		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.183+148558del			ENST00000357533		3	.	3	0	.	0	TRPM3,intron_variant,,ENST00000357533,;TRPM3,intron_variant,,ENST00000423814,;TRPM3,intron_variant,,ENST00000354500,;	-	ENSG00000083067	ENST00000357533	Transcript	intron_variant						rs11288806	1		-1	TRPM3	HGNC	17992	protein_coding			ENSP00000350140		H7BYP1,A2A3F7	UPI000066DA55					1/24			0.1059	0.3242		0.255	0.174	0.1421										MODIFIER		deletion													1	.	AGAA	.	.																					73913010
ENSR00001753830	0	.	GRCh37	9	74905012	74905013	+	IGR	INS	-	-	C	rs144246432		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001753830		4	.	4	0	.	0	,regulatory_region_variant,,ENSR00001753830,;	C		ENSR00001753830	RegulatoryFeature	regulatory_region_variant						rs144246432	1																				0.7799	0.5735		0.244	0.6471	0.4376										MODIFIER	1	insertion														.	TGC	.	.																					74905012
ZFAND5	7763	.	GRCh37	9	74971755	74971755	+	Intron	DEL	A	A	-	rs1291969582		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.493+92del			ENST00000237937		4	.	4	0	.	0	ZFAND5,intron_variant,,ENST00000237937,NM_006007.3,NM_001102421.2,NM_001278244.1;ZFAND5,intron_variant,,ENST00000343431,NM_001278245.1,NM_001278243.1;ZFAND5,intron_variant,,ENST00000376960,;ZFAND5,intron_variant,,ENST00000376962,NM_001102420.2;ZFAND5,downstream_gene_variant,,ENST00000376956,;ZFAND5,intron_variant,,ENST00000471197,;ZFAND5,intron_variant,,ENST00000488164,;ZFAND5,downstream_gene_variant,,ENST00000487330,;,regulatory_region_variant,,ENSR00001753843,;	-	ENSG00000107372	ENST00000237937	Transcript	intron_variant						rs1291969582,COSV52988528	1		-1	ZFAND5	HGNC	13008	protein_coding	YES	CCDS6642.1	ENSP00000237937	O76080		UPI000013C322	NM_006007.3,NM_001102421.2,NM_001278244.1				5/5												0,1						MODIFIER	1	deletion			0,1											.	TTAT	.	.																					74971754
TMC1	117531	.	GRCh37	9	75270658	75270658	+	Intron	DEL	A	A	-	rs34249073		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.16+7089del			ENST00000297784		8	.	4	8	.	0	TMC1,intron_variant,,ENST00000297784,NM_138691.2;TMC1,intron_variant,,ENST00000340019,;TMC1,intron_variant,,ENST00000396237,;TMC1,downstream_gene_variant,,ENST00000492418,;RPS20P24,downstream_gene_variant,,ENST00000457473,;	-	ENSG00000165091	ENST00000297784	Transcript	intron_variant						rs34249073	1		1	TMC1	HGNC	16513	protein_coding	YES	CCDS6643.1	ENSP00000297784	Q8TDI8		UPI0000161FA9	NM_138691.2				5/23			0.7821	0.4712		0.4425	0.4294	0.4387										MODIFIER	1	deletion													1	.	TCAA	.	.																					75270657
ANXA1	301	.	GRCh37	9	75783796	75783797	+	Intron	INS	-	-	GTGTGTGTGT	rs3832643		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.862-129_862-120dup			ENST00000376911		6	.	3	26	.	0	ANXA1,intron_variant,,ENST00000257497,NM_000700.1;ANXA1,intron_variant,,ENST00000376911,;ANXA1,non_coding_transcript_exon_variant,,ENST00000491192,;ANXA1,downstream_gene_variant,,ENST00000489109,;ANXA1,downstream_gene_variant,,ENST00000495713,;	GTGTGTGTGT	ENSG00000135046	ENST00000376911	Transcript	intron_variant						rs3832643	1		1	ANXA1	HGNC	533	protein_coding	YES	CCDS6645.1	ENSP00000366109	P04083	Q5TZZ9,Q5T3N0,Q05BR2	UPI0000001C4C					10/11																		MODIFIER	1	insertion														.	AGG	.	.																					75783796
Unknown	0	.	GRCh37	9	83592756	83592757	+	IGR	INS	-	-	T	rs35794446		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		T				intergenic_variant						rs35794446	1																																			MODIFIER	1	insertion														.	TCT	.	.																					83592756
TLE1	7088	.	GRCh37	9	84248213	84248214	+	Intron	INS	-	-	GT	rs56327119		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.594+59_594+60insAC			ENST00000376499		29	.	6	26	.	0	TLE1,intron_variant,,ENST00000376472,;TLE1,intron_variant,,ENST00000376499,NM_005077.3;TLE1,intron_variant,,ENST00000418319,;TLE1,downstream_gene_variant,,ENST00000376463,;	GTGTGTGTGTGT	ENSG00000196781	ENST00000376499	Transcript	intron_variant						rs56327119	2		-1	TLE1	HGNC	11837	protein_coding	YES	CCDS6661.1	ENSP00000365682	Q04724		UPI0000137034	NM_005077.3				8/19																		MODIFIER	1	sequence_alteration														.	CCGTGTGTGTGTG	.	.																					84248203
RP11-15B24.5	0	.	GRCh37	9	85090719	85090722	+	Intron	DEL	CTGC	CTGC	-	rs36142154		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTGC	CTGC																n.279-16141_279-16138del			ENST00000586399		4	.	4	0	.	0	RP11-15B24.5,intron_variant,,ENST00000586399,;RP11-15B24.5,intron_variant,,ENST00000590298,;RP11-15B24.5,intron_variant,,ENST00000590791,;RP11-15B24.5,intron_variant,,ENST00000591257,;	-	ENSG00000228430	ENST00000586399	Transcript	intron_variant,non_coding_transcript_variant						rs36142154	1		1	RP11-15B24.5	Clone_based_vega_gene		lincRNA											3/5			0.4312	0.3588		0.5427	0.2644	0.2791										MODIFIER	1	deletion														.	GTCTGCC	.	.																					85090718
Unknown	0	.	GRCh37	9	87082268	87082269	+	IGR	INS	-	-	T	rs1282114510		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	4	2	6	6	0		T				intergenic_variant						rs1282114510	1																																			MODIFIER	1	insertion														.	TGG	.	.																					87082268
Unknown	0	.	GRCh37	9	87941019	87941019	+	IGR	DEL	A	A	-	rs34258384		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					6	.	3	3	.	0		-				intergenic_variant						rs34258384	1																				0.4871	0.6513		0.8581	0.7594	0.7863										MODIFIER	1	deletion														.	AGAA	.	.																					87941018
Unknown	0	.	GRCh37	9	88072615	88072616	+	IGR	INS	-	-	G	rs11408340		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		G				intergenic_variant						rs11408340	1																																			MODIFIER	1	insertion														.	ACG	.	.																					88072615
DAPK1	1612	.	GRCh37	9	90167246	90167247	+	Intron	INS	-	-	GAAGGGATATCTGCAGCTGGAA	rs6151066		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.63-52622_63-52621insAAGGGATATCTGCAGCTGGAAG			ENST00000408954		3	.	3	0	.	0	DAPK1,intron_variant,,ENST00000358077,NM_001288731.1;DAPK1,intron_variant,,ENST00000408954,NM_004938.2;DAPK1,intron_variant,,ENST00000469640,;DAPK1,intron_variant,,ENST00000472284,NM_001288729.1,NM_001288730.1;DAPK1,intron_variant,,ENST00000491893,;DAPK1-IT1,upstream_gene_variant,,ENST00000431813,;DAPK1,intron_variant,,ENST00000472344,;DAPK1,intron_variant,,ENST00000496522,;DAPK1,intron_variant,,ENST00000469067,;DAPK1,intron_variant,,ENST00000489291,;,regulatory_region_variant,,ENSR00001755309,;	GAAGGGATATCTGCAGCTGGAA	ENSG00000196730	ENST00000408954	Transcript	intron_variant						rs6151066	1		1	DAPK1	HGNC	2674	protein_coding	YES	CCDS43842.1	ENSP00000386135	P53355		UPI0000210C2F	NM_004938.2				2/25			0.1445	0.1513		0.0456	0.3002	0.1145										MODIFIER	1	insertion														.	AGG	.	.																					90167246
DAPK1	1612	.	GRCh37	9	90327963	90327964	+	3'Flank	DEL	TG	TG	-	rs72407569		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																			ENST00000408954		7	3	4	5	5	0	DAPK1,downstream_gene_variant,,ENST00000358077,NM_001288731.1;DAPK1,downstream_gene_variant,,ENST00000408954,NM_004938.2;DAPK1,downstream_gene_variant,,ENST00000469640,;DAPK1,downstream_gene_variant,,ENST00000472284,NM_001288729.1,NM_001288730.1;,regulatory_region_variant,,ENSR00001755335,;	-	ENSG00000196730	ENST00000408954	Transcript	downstream_gene_variant						rs72407569	1	4420	1	DAPK1	HGNC	2674	protein_coding	YES	CCDS43842.1	ENSP00000386135	P53355		UPI0000210C2F	NM_004938.2																						MODIFIER	1	deletion														.	TTTGT	.	.																					90327962
ENSR00001755402	0	.	GRCh37	9	90851862	90851863	+	IGR	INS	-	-	T	rs138567735		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001755402		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001755402,;	T		ENSR00001755402	RegulatoryFeature	regulatory_region_variant						rs138567735	1																			0.0717	0.0507	0.0519		0.0784	0.1213	0.0562										MODIFIER	1	insertion														.	CCG	.	.																					90851862
NXNL2	158046	.	GRCh37	9	91181910	91181911	+	Intron	INS	-	-	CTATCTATCTATCTAC	rs34244217		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.303-4077_303-4076insCCTATCTATCTATCTA			ENST00000375855		3	.	3	0	.	0	NXNL2,intron_variant,,ENST00000375855,NM_145283.2;NXNL2,intron_variant,,ENST00000478686,;	CTATCTATCTATCTAC	ENSG00000130045	ENST00000375855	Transcript	intron_variant						rs34244217	1		1	NXNL2	HGNC	30482	protein_coding		CCDS6679.1	ENSP00000365015	Q5VZ03		UPI000013CD57	NM_145283.2				1/2																		MODIFIER	1	insertion														.	ATC	.	.																					91181910
Unknown	0	.	GRCh37	9	97243128	97243130	+	IGR	DEL	TTG	TTG	-	rs74396308		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TTG	TTG																					3	.	3	0	.	0		-				intergenic_variant						rs74396308	1																				0.2625	0.5029		0.3403	0.3171	0.2781										MODIFIER	1	deletion														.	TTTTGT	.	.																					97243127
Unknown	0	.	GRCh37	9	100523095	100523096	+	IGR	INS	-	-	C	rs139767705		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		C				intergenic_variant						rs139767705	1																				0.115	0.1037		0.2034	0.0686	0.0613										MODIFIER	1	insertion														.	CTC	.	.																					100523095
GABBR2	9568	.	GRCh37	9	101267705	101267706	+	Intron	INS	-	-	GT	rs59702034		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.631-8911_631-8910dup			ENST00000259455		6	3	3	4	4	0	GABBR2,intron_variant,,ENST00000259455,NM_005458.7;GABBR2,intron_variant,,ENST00000477471,;	GT	ENSG00000136928	ENST00000259455	Transcript	intron_variant						rs59702034	1		-1	GABBR2	HGNC	4507	protein_coding	YES	CCDS6736.1	ENSP00000259455	O75899	H9NIL8	UPI0000035832	NM_005458.7				3/18																		MODIFIER	1	insertion													1	.	AGG	.	.																					101267705
Unknown	0	.	GRCh37	9	104835094	104835095	+	IGR	INS	-	-	CCTGTCTACAG	rs57319360		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		CCTGTCTACAG				intergenic_variant						rs57319360	1																				0.0877	0.1787		0.0794	0.3479	0.2526										MODIFIER	1	insertion														.	TTC	.	.																					104835094
Unknown	0	.	GRCh37	9	107712928	107712931	+	IGR	DEL	CTCA	CTCA	-	rs58000150		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTCA	CTCA																					3	.	3	0	.	0		-				intergenic_variant						rs58000150	1																				0.4138	0.1412		0.002	0.1451	0.1268										MODIFIER	1	deletion														.	GTCTCAC	.	.																					107712927
RP11-308N19.4	100996590	.	GRCh37	9	109393806	109393807	+	Intron	INS	-	-	TATTTTTGGTAAATAATGGTTTTCCATGGTTTGTGTATGTTTGGGTACTTTGATATTTTATGTACAGTATATAATACA	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.260-6628_260-6627insTGGTAAATAATGGTTTTCCATGGTTTGTGTATGTTTGGGTACTTTGATATTTTATGTACAGTATATAATACATATTTT			ENST00000444985		3	.	3	0	.	0	RP11-308N19.4,intron_variant,,ENST00000444985,;	TATTTTTGGTAAATAATGGTTTTCCATGGTTTGTGTATGTTTGGGTACTTTGATATTTTATGTACAGTATATAATACA	ENSG00000234229	ENST00000444985	Transcript	intron_variant,non_coding_transcript_variant							1		1	RP11-308N19.4	Clone_based_vega_gene		lincRNA	YES										1/6																		MODIFIER	1	insertion														.	GGT	.	.																					109393806
Unknown	0	.	GRCh37	9	116511364	116511365	+	IGR	INS	-	-	TG	rs34948305		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	0	.	0		TG				intergenic_variant						rs34948305	1																				0.882	0.8256		0.9643	0.7445	0.8098										MODIFIER	1	insertion														.	ACT	.	.																					116511364
DFNB31	25861	.	GRCh37	9	117242761	117242762	+	Intron	INS	-	-	AGAG	rs57662659		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.619-1714_619-1711dup			ENST00000362057		5	.	3	3	.	0	DFNB31,intron_variant,,ENST00000265134,NM_001083885.2;DFNB31,intron_variant,,ENST00000362057,NM_001173425.1,NM_015404.3;DFNB31,intron_variant,,ENST00000374057,;,regulatory_region_variant,,ENSR00001463062,;	AGAG	ENSG00000095397	ENST00000362057	Transcript	intron_variant						rs57662659	1		-1	DFNB31	HGNC	16361	protein_coding	YES	CCDS6806.1	ENSP00000354623	Q9P202		UPI00001C1EA6	NM_001173425.1,NM_015404.3				1/11			0.8048	0.5865		0.4206	0.4811	0.455										MODIFIER	1	insertion													1	.	GAA	.	.																					117242761
TNC	3371	.	GRCh37	9	117849978	117849979	+	Intron	DEL	TT	TT	-	rs752435283		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TT	TT																c.458-427_458-426del			ENST00000350763		3	.	3	0	.	0	TNC,intron_variant,,ENST00000340094,;TNC,intron_variant,,ENST00000341037,;TNC,intron_variant,,ENST00000345230,;TNC,intron_variant,,ENST00000346706,;TNC,intron_variant,,ENST00000350763,NM_002160.3;TNC,intron_variant,,ENST00000423613,;TNC,intron_variant,,ENST00000535648,;TNC,intron_variant,,ENST00000537320,;TNC,intron_variant,,ENST00000542877,;TNC,downstream_gene_variant,,ENST00000534839,;,regulatory_region_variant,,ENSR00001758471,;,regulatory_region_variant,,ENSR00001758472,;	-	ENSG00000041982	ENST00000350763	Transcript	intron_variant						rs752435283	1		-1	TNC	HGNC	5318	protein_coding	YES	CCDS6811.1	ENSP00000265131	P24821	F5H5D6	UPI000013D5BD	NM_002160.3				2/27																		MODIFIER	1	deletion													1	.	TCTTT	.	.																					117849977
ASTN2	23245	.	GRCh37	9	119214111	119214112	+	Intron	INS	-	-	TCTG	rs34661668		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.3345-9283_3345-9280dup			ENST00000361209		3	.	3	0	.	0	ASTN2,intron_variant,,ENST00000288520,NM_198186.3;ASTN2,intron_variant,,ENST00000313400,;ASTN2,intron_variant,,ENST00000341734,NM_198187.3,NM_198188.2,NM_001184734.1;ASTN2,intron_variant,,ENST00000361209,NM_014010.4;ASTN2,intron_variant,,ENST00000361477,;ASTN2,intron_variant,,ENST00000373986,;ASTN2,intron_variant,,ENST00000373996,;,regulatory_region_variant,,ENSR00001463532,;	TCTG	ENSG00000148219	ENST00000361209	Transcript	intron_variant						rs34661668	1		-1	ASTN2	HGNC	17021	protein_coding	YES	CCDS6815.1	ENSP00000354504	O75129	B7ZKP3,B2RCB6	UPI00002116D7	NM_014010.4				19/21			0.8858	0.7522		0.7917	0.665	0.7873										MODIFIER	1	insertion														.	GAT	.	.																					119214111
ASTN2	23245	.	GRCh37	9	119909717	119909718	+	Intron	INS	-	-	AC	rs35703147		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.1016-51289_1016-51288dup			ENST00000361209		3	.	3	0	.	0	ASTN2,intron_variant,,ENST00000313400,;ASTN2,intron_variant,,ENST00000361209,NM_014010.4;ASTN2,intron_variant,,ENST00000361477,;ASTN2,intron_variant,,ENST00000373986,;ASTN2,intron_variant,,ENST00000373996,;	AC	ENSG00000148219	ENST00000361209	Transcript	intron_variant						rs35703147	1		-1	ASTN2	HGNC	17021	protein_coding	YES	CCDS6815.1	ENSP00000354504	O75129	B7ZKP3,B2RCB6	UPI00002116D7	NM_014010.4				3/21																		MODIFIER	1	insertion														.	AAA	.	.																					119909717
Unknown	0	.	GRCh37	9	121293330	121293330	+	IGR	DEL	A	A	-	rs59188768		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs59188768	1																				0.3654	0.3415		0.2063	0.4274	0.4847										MODIFIER	1	deletion														.	CTAA	.	.																					121293329
TRAF1	7185	.	GRCh37	9	123677491	123677491	+	Intron	DEL	G	G	-	rs11331426		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.229-913del			ENST00000373887		3	.	3	2	.	0	TRAF1,intron_variant,,ENST00000373887,NM_005658.4;TRAF1,intron_variant,,ENST00000540010,NM_001190945.1;TRAF1,upstream_gene_variant,,ENST00000546084,NM_001190947.1;,regulatory_region_variant,,ENSR00001464283,;	-	ENSG00000056558	ENST00000373887	Transcript	intron_variant						rs11331426,COSV65869014	1		-1	TRAF1	HGNC	12031	protein_coding	YES	CCDS6825.1	ENSP00000362994	Q13077		UPI0000001079	NM_005658.4				3/7		0.4537	0.112	0.5634		0.502	0.5636	0.6748				0,1						MODIFIER	1	deletion			0,1											.	ATGT	.	.																					123677490
RP11-343J18.2	0	.	GRCh37	9	128920807	128920810	+	Intron	DEL	GCGT	GCGT	-	rs55678398		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GCGT	GCGT																n.236-1002_236-999del			ENST00000441473		4	.	4	0	.	0	RP11-343J18.2,intron_variant,,ENST00000441473,;	-	ENSG00000232413	ENST00000441473	Transcript	intron_variant,non_coding_transcript_variant						rs55678398	1		1	RP11-343J18.2	Clone_based_vega_gene		lincRNA	YES										1/1																		MODIFIER	1	deletion														.	GCGCGTG	.	.																					128920806
LMX1B	4010	.	GRCh37	9	129431521	129431523	+	Intron	DEL	GAG	GAG	-	rs35558800		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAG	GAG																c.327-21590_327-21588del			ENST00000355497		4	.	4	0	.	0	LMX1B,intron_variant,,ENST00000355497,NM_001174146.1;LMX1B,intron_variant,,ENST00000373474,;LMX1B,intron_variant,,ENST00000425646,NM_001174147.1,NM_002316.3;LMX1B,intron_variant,,ENST00000526117,;LMX1B,intron_variant,,ENST00000561065,;	-	ENSG00000136944	ENST00000355497	Transcript	intron_variant						rs35558800	1		1	LMX1B	HGNC	6654	protein_coding	YES	CCDS55343.1	ENSP00000347684	O60663	Q9UE66,B7ZLH2	UPI0001CE94D0	NM_001174146.1				2/7			0.5582	0.4078		0.5466	0.4523	0.4274										MODIFIER	1	deletion													1	.	GCGAGG	.	.																					129431520
FNBP1	23048	.	GRCh37	9	132685991	132685991	+	Intron	DEL	T	T	-	rs11290705		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.1170+132del			ENST00000446176		4	.	4	0	.	0	FNBP1,intron_variant,,ENST00000355681,;FNBP1,intron_variant,,ENST00000420781,;FNBP1,intron_variant,,ENST00000446176,NM_015033.2;FNBP1,intron_variant,,ENST00000449089,;FNBP1,upstream_gene_variant,,ENST00000443566,;FNBP1,intron_variant,,ENST00000478129,;FNBP1,intron_variant,,ENST00000482107,;	-	ENSG00000187239	ENST00000446176	Transcript	intron_variant						rs11290705	1		-1	FNBP1	HGNC	17069	protein_coding	YES	CCDS48040.1	ENSP00000413625	Q96RU3	B7ZL12	UPI000022408C	NM_015033.2				10/16																		MODIFIER	1	deletion													1	.	TGTT	.	.																					132685990
GTF3C5	9328	.	GRCh37	9	135906038	135906038	+	5'Flank	DEL	A	A	-	rs8193015		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																			ENST00000372108		3	.	3	0	.	0	GTF3C5,upstream_gene_variant,,ENST00000342018,;GTF3C5,upstream_gene_variant,,ENST00000372095,;GTF3C5,upstream_gene_variant,,ENST00000372097,NM_012087.3;GTF3C5,upstream_gene_variant,,ENST00000372099,;GTF3C5,upstream_gene_variant,,ENST00000372108,NM_001122823.1;GTF3C5,upstream_gene_variant,,ENST00000439697,;GTF3C5,upstream_gene_variant,,ENST00000440319,;GTF3C5,upstream_gene_variant,,ENST00000485692,;,regulatory_region_variant,,ENSR00000242528,;	-	ENSG00000148308	ENST00000372108	Transcript	upstream_gene_variant						rs8193015	1	353	1	GTF3C5	HGNC	4668	protein_coding	YES	CCDS48050.1	ENSP00000361180	Q9Y5Q8	Q5T7U0	UPI000046FE5A	NM_001122823.1							0.3336	0.3228		0.2361	0.3648	0.1912										MODIFIER	1	deletion														.	TCAA	.	.																					135906037
VAV2	7410	.	GRCh37	9	136839020	136839024	+	Intron	DEL	CAGAA	CAGAA	-	rs150760277		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CAGAA	CAGAA																c.204+18173_204+18177del			ENST00000371850		4	.	4	0	.	0	VAV2,intron_variant,,ENST00000371850,NM_001134398.1;VAV2,intron_variant,,ENST00000371851,;VAV2,intron_variant,,ENST00000406606,NM_003371.3;VAV2,intron_variant,,ENST00000486113,;,regulatory_region_variant,,ENSR00001760776,;	-	ENSG00000160293	ENST00000371850	Transcript	intron_variant						rs150760277	1		-1	VAV2	HGNC	12658	protein_coding	YES	CCDS48053.1	ENSP00000360916	P52735		UPI000013E06E	NM_001134398.1				1/29																		MODIFIER	1	deletion														.	GGCAGAAA	.	.																					136839019
ENSR00001760824	0	.	GRCh37	9	137168340	137168349	+	IGR	DEL	GCCGGCCCCA	GCCGGCCCCA	-	rs76142093		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GCCGGCCCCA	GCCGGCCCCA																			ENSR00001760824		5	.	5	0	.	0	,regulatory_region_variant,,ENSR00001760824,;	-		ENSR00001760824	RegulatoryFeature	regulatory_region_variant						rs76142093	1																				0.0053	0.0562			0.0815	0.0307										MODIFIER	1	deletion														.	CTGCCGGCCCCAG	.	.																					137168339
COL5A1	1289	.	GRCh37	9	137577787	137577790	+	Intron	DEL	CCAT	CCAT	-	rs146827064		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CCAT	CCAT																c.110-4956_110-4953del			ENST00000371817		7	4	3	4	4	0	COL5A1,intron_variant,,ENST00000371817,NM_001278074.1,NM_000093.4;COL5A1,intron_variant,,ENST00000464187,;	-	ENSG00000130635	ENST00000371817	Transcript	intron_variant						rs146827064	1		1	COL5A1	HGNC	2209	protein_coding	YES	CCDS6982.1	ENSP00000360882	P20908	Q9UML4,Q96HC0,Q59EE7	UPI0000210EE3	NM_001278074.1,NM_000093.4				1/65			0.0688	0.1729		0.0873	0.1879	0.1401										MODIFIER	1	deletion													1	.	CACCATC	.	.																					137577786
Unknown	0	.	GRCh37	9	138091218	138091238	+	IGR	DEL	ACTGGGAGAAAGGAAGCCAGC	ACTGGGAGAAAGGAAGCCAGC	-	rs151143420		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	ACTGGGAGAAAGGAAGCCAGC	ACTGGGAGAAAGGAAGCCAGC																					3	.	3	0	.	0		-				intergenic_variant						rs151143420	1																			0.1733	0.3101	0.1095		0.0427	0.2187	0.1217										MODIFIER	1	deletion														.	TAACTGGGAGAAAGGAAGCCAGCC	.	.																					138091217
Unknown	0	.	GRCh37	9	138195904	138195905	+	IGR	INS	-	-	TGGA	rs56107667		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					7	4	3	4	4	0		TGGA				intergenic_variant						rs56107667	1																				0.354	0.2176		0.2153	0.2962	0.2239										MODIFIER	1	insertion														.	GGT	.	.																					138195904
NELFB	25920	.	GRCh37	9	140161636	140161642	+	Intron	DEL	GGCTGAG	GGCTGAG	AG	rs544060553		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GGCTGAG	GGCTGAG																c.1239-56_1239-52del			ENST00000343053		23	.	12	8	.	8	NELFB,intron_variant,,ENST00000343053,NM_015456.3;	GTGGAG	ENSG00000188986	ENST00000343053	Transcript	intron_variant						rs544060553	2		1	NELFB	HGNC	24324	protein_coding	YES	CCDS7040.1	ENSP00000339495	Q8WX92		UPI0000070699	NM_015456.3				9/12			0.5113	0.7421		0.4772	0.7097	0.6708										MODIFIER	1	sequence_alteration														.	GTGTGGGGCTGAGG	.	.																					140161631
ADARB2	105	.	GRCh37	10	1737815	1737816	+	Intron	DEL	GA	GA	-	rs5782591		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GA	GA																c.100+41429_100+41430del			ENST00000381312		6	.	4	7	.	0	ADARB2,intron_variant,,ENST00000381312,NM_018702.3;	-	ENSG00000185736	ENST00000381312	Transcript	intron_variant						rs5782591	1		-1	ADARB2	HGNC	227	protein_coding	YES	CCDS7058.1	ENSP00000370713	Q9NS39	Q5VW43	UPI0000071776	NM_018702.3				1/9			0.2587	0.6902		0.6567	0.5517	0.7178										MODIFIER	1	deletion														.	GTGAG	.	.																					1737814
ADARB2	105	.	GRCh37	10	1739166	1739166	+	Intron	DEL	T	T	-	rs11404553		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.100+40079del			ENST00000381312		3	.	3	0	.	0	ADARB2,intron_variant,,ENST00000381312,NM_018702.3;	-	ENSG00000185736	ENST00000381312	Transcript	intron_variant						rs11404553	1		-1	ADARB2	HGNC	227	protein_coding	YES	CCDS7058.1	ENSP00000370713	Q9NS39	Q5VW43	UPI0000071776	NM_018702.3				1/9			0.1747	0.0922		0.2083	0.173	0.1166										MODIFIER	1	deletion														.	GATT	.	.																					1739165
Unknown	0	.	GRCh37	10	2400704	2400705	+	IGR	INS	-	-	GGCCA	rs138186582		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		GGCCA				intergenic_variant						rs138186582	1																																			MODIFIER	1	insertion														.	GCG	.	.																					2400704
Unknown	0	.	GRCh37	10	3062325	3062325	+	IGR	DEL	T	T	-	rs10707891		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																					5	.	3	5	.	0		-				intergenic_variant						rs10707891	1																			0.2660	0.6339	0.1614		0.0615	0.1302	0.1933										MODIFIER	1	deletion														.	TATC	.	.																					3062324
RP11-464C19.2	0	.	GRCh37	10	3872814	3872815	+	5'Flank	INS	-	-	A	rs200974512		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000413339		6	.	3	3	.	0	RP11-464C19.2,upstream_gene_variant,,ENST00000413339,;	A	ENSG00000230573	ENST00000413339	Transcript	upstream_gene_variant						rs200974512	1	3327	1	RP11-464C19.2	Clone_based_vega_gene		lincRNA	YES													0.0008	0.0029		0.0129	0.005											MODIFIER	1	insertion														.	CCA	.	.																					3872814
ENSR00001516736	0	.	GRCh37	10	3993299	3993300	+	IGR	INS	-	-	A	rs71392421		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENSR00001516736		3	.	3	0	.	0	,regulatory_region_variant,,ENSR00001516736,;	A		ENSR00001516736	RegulatoryFeature	regulatory_region_variant						rs71392421	1																			0.6034	0.2655	0.7608		0.8085	0.6441	0.6953										MODIFIER	1	insertion														.	GGG	.	.																					3993299
Unknown	0	.	GRCh37	10	4610613	4610614	+	IGR	INS	-	-	CA	rs34142498		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					5	.	5	1	.	0		CA				intergenic_variant						rs34142498	1																				0.4501	0.647		0.6111	0.5149	0.5266										MODIFIER	1	insertion														.	AGC	.	.																					4610613
PROSER2	254427	.	GRCh37	10	11896619	11896619	+	Intron	DEL	T	T	-	rs11342646		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	T	T																c.138+2419del			ENST00000277570		3	.	3	0	.	0	PROSER2,intron_variant,,ENST00000277570,NM_153256.3;PROSER2,intron_variant,,ENST00000444604,;PROSER2-AS1,intron_variant,,ENST00000445498,;PROSER2-AS1,downstream_gene_variant,,ENST00000453242,;PROSER2,intron_variant,,ENST00000474155,;	-	ENSG00000148426	ENST00000277570	Transcript	intron_variant						rs11342646	1		1	PROSER2	HGNC	23728	protein_coding	YES	CCDS7085.1	ENSP00000277570	Q86WR7	D3DRR9	UPI00001F8B49	NM_153256.3				2/3																		MODIFIER	1	deletion														.	AGTT	.	.																					11896618
CCDC3	83643	.	GRCh37	10	12944829	12944830	+	Intron	INS	-	-	C	rs11369051		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.550-4151_550-4150insG			ENST00000378825		6	.	6	0	.	0	CCDC3,intron_variant,,ENST00000378825,NM_031455.3;CCDC3,intron_variant,,ENST00000378839,NM_001282658.1;,regulatory_region_variant,,ENSR00000969869,;,regulatory_region_variant,,ENSR00001517808,;	C	ENSG00000151468	ENST00000378825	Transcript	intron_variant						rs11369051	1		-1	CCDC3	HGNC	23813	protein_coding	YES	CCDS7093.1	ENSP00000368102	Q9BQI4	Q5VYV9	UPI000006E69C	NM_031455.3				2/2			0.7095	0.8919		0.7232	0.9314	0.8231										MODIFIER	1	insertion														.	TAG	.	.																					12944829
UCMA	221044	.	GRCh37	10	13261885	13261897	+	3'Flank	DEL	AAAACCCTGAAGT	AAAACCCTGAAGT	-	rs36009252		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AAAACCCTGAAGT	AAAACCCTGAAGT																			ENST00000378681		3	.	3	0	.	0	UCMA,downstream_gene_variant,,ENST00000378681,NM_145314.1;UCMA,downstream_gene_variant,,ENST00000463405,;RNU6-6P,downstream_gene_variant,,ENST00000606623,NR_002752.2;,regulatory_region_variant,,ENSR00000258238,;,regulatory_region_variant,,ENSR00001517844,;,TF_binding_site_variant,,ENSM00528839352,;,TF_binding_site_variant,,ENSM00529043564,;,TF_binding_site_variant,,ENSM00528710440,;,TF_binding_site_variant,,ENSM00529167900,;,TF_binding_site_variant,,ENSM00529341041,;,TF_binding_site_variant,,ENSM00528282441,;,TF_binding_site_variant,,ENSM00529153827,;	-	ENSG00000165623	ENST00000378681	Transcript	downstream_gene_variant						rs36009252	1	1870	-1	UCMA	HGNC	25205	protein_coding	YES	CCDS31147.1	ENSP00000367952	Q8WVF2		UPI000015F8FB	NM_145314.1							0.1589	0.183		0.3234	0.1183	0.138										MODIFIER	1	deletion														.	TGAAAACCCTGAAGTA	.	.																					13261884
HSPA14	51182	.	GRCh37	10	14882040	14882041	+	Intron	INS	-	-	AT	rs140243251		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.139-17_139-16dup			ENST00000378372		17	.	3	13	.	0	HSPA14,intron_variant,,ENST00000378372,NM_016299.3;HSPA14,intron_variant,,ENST00000437161,NM_001278205.1;HSPA14,intron_variant,,ENST00000441647,;CDNF,upstream_gene_variant,,ENST00000378442,;CDNF,upstream_gene_variant,,ENST00000465530,NM_001029954.2;HSPA14,intron_variant,,ENST00000493178,;HSPA14,intron_variant,,ENST00000493863,;CDNF,upstream_gene_variant,,ENST00000378441,;CDNF,upstream_gene_variant,,ENST00000466269,;	AT	ENSG00000187522	ENST00000378372	Transcript	intron_variant						rs140243251	1		1	HSPA14	HGNC	29526	protein_coding	YES	CCDS7103.1	ENSP00000367623	Q0VDF9	B4DYI5	UPI000013D6A8	NM_016299.3				2/13																		MODIFIER	1	insertion														.	TAA	.	.												0.002654	0.0002206	0.0008445	0.004697	0.0007185	0.002746	0.003712	0.002122	0.00288	14882040
FAM171A1	221061	.	GRCh37	10	15309884	15309885	+	Intron	INS	-	-	ACTAAGA	rs11281586		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.418+7969_418+7970insTCTTAGT			ENST00000378116		3	.	3	0	.	0	FAM171A1,intron_variant,,ENST00000378116,NM_001010924.1;FAM171A1,intron_variant,,ENST00000455654,;	ACTAAGA	ENSG00000148468	ENST00000378116	Transcript	intron_variant						rs11281586	1		-1	FAM171A1	HGNC	23522	protein_coding	YES	CCDS31154.1	ENSP00000367356	Q5VUB5		UPI00001414CA	NM_001010924.1				3/7			0.8956	0.9885		0.999	0.998	0.999										MODIFIER	1	insertion														.	TCA	.	.																					15309884
Unknown	0	.	GRCh37	10	16005417	16005417	+	IGR	DEL	A	A	-	rs61269546		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					3	.	3	0	.	0		-				intergenic_variant						rs61269546	1																				0.2814	0.2291		0.1815	0.2575	0.2505										MODIFIER	1	deletion														.	TGAA	.	.																					16005416
CUBN	8029	.	GRCh37	10	16868293	16868294	+	Intron	INS	-	-	CATATTTACATG	rs1554778713		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.10765-1213_10765-1212insCATGTAAATATG			ENST00000377833		4	.	4	0	.	0	CUBN,intron_variant,,ENST00000377833,NM_001081.3;	CATATTTACATG	ENSG00000107611	ENST00000377833	Transcript	intron_variant						rs1554778713	1		-1	CUBN	HGNC	2548	protein_coding	YES	CCDS7113.1	ENSP00000367064	O60494	B3KQA6	UPI00001AE8F4	NM_001081.3				66/66			0.4062	0.2911		0.2857	0.16	0.137										MODIFIER	1	insertion													1	.	AAC	.	.																					16868293
CUBN	8029	.	GRCh37	10	17110578	17110578	+	Intron	DEL	A	A	-	rs746874227		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.2791+26del			ENST00000377833		16	.	3	15	.	0	CUBN,intron_variant,,ENST00000377833,NM_001081.3;	-	ENSG00000107611	ENST00000377833	Transcript	intron_variant						rs746874227	1		-1	CUBN	HGNC	2548	protein_coding	YES	CCDS7113.1	ENSP00000367064	O60494	B3KQA6	UPI00001AE8F4	NM_001081.3				20/66																		MODIFIER	1	deletion													1	.	GGAA	.	.												0.006593	0.003922	0.009023	0.008349	0.006181	0.0022	0.006595	0.009358	0.008275	17110577
PTPLA	9200	.	GRCh37	10	17630198	17630199	+	3'Flank	INS	-	-	A	rs5783555		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000361271		3	.	3	0	.	0	PTPLA,downstream_gene_variant,,ENST00000361271,NM_014241.3;PTPLA,downstream_gene_variant,,ENST00000498812,;	A	ENSG00000165996	ENST00000361271	Transcript	downstream_gene_variant						rs5783555	1	1759	-1	PTPLA	HGNC	9639	protein_coding	YES	CCDS7121.1	ENSP00000355308	B0YJ81	J3KT94	UPI000036666A	NM_014241.3							1	0.9986		1	1	1										MODIFIER	1	insertion													1	.	TCA	.	.																					17630198
SVILP1	645954	.	GRCh37	10	31005791	31005792	+	Intron	DEL	AA	AA	-	rs377628660		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AA	AA																n.2353-55_2353-54del			ENST00000422642		5	.	5	0	.	0	SVILP1,intron_variant,,ENST00000422642,;SVILP1,intron_variant,,ENST00000429171,;	-	ENSG00000234814	ENST00000422642	Transcript	intron_variant,non_coding_transcript_variant						rs377628660	1		1	SVILP1	HGNC	44959	transcribed_unprocessed_pseudogene	YES										16/17																		MODIFIER	1	deletion														.	TCAAA	.	.																					31005790
PARD3	56288	.	GRCh37	10	34726009	34726010	+	Intron	INS	-	-	AAAA	rs35137394		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																c.714+13235_714+13236insTTTT			ENST00000374789		3	.	3	0	.	0	PARD3,intron_variant,,ENST00000340077,NM_001184792.1;PARD3,intron_variant,,ENST00000346874,NM_001184787.1;PARD3,intron_variant,,ENST00000350537,NM_001184788.1,NM_001184789.1;PARD3,intron_variant,,ENST00000374773,NM_001184793.1;PARD3,intron_variant,,ENST00000374776,NM_001184794.1;PARD3,intron_variant,,ENST00000374788,NM_001184785.1;PARD3,intron_variant,,ENST00000374789,NM_019619.3;PARD3,intron_variant,,ENST00000374790,;PARD3,intron_variant,,ENST00000374794,NM_001184791.1;PARD3,intron_variant,,ENST00000545260,NM_001184790.1;PARD3,intron_variant,,ENST00000545693,NM_001184786.1;	AAAA	ENSG00000148498	ENST00000374789	Transcript	intron_variant						rs35137394	1		-1	PARD3	HGNC	16051	protein_coding	YES	CCDS7178.1	ENSP00000363921	Q8TEW0		UPI0000073A9F	NM_019619.3				5/24			0.3888	0.6412		0.5605	0.6799	0.5992										MODIFIER	1	insertion														.	TTA	.	.																					34726009
Unknown	0	.	GRCh37	10	42361335	42361336	+	IGR	INS	-	-	AC	rs370644911		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					6	4	2	5	5	0		AC				intergenic_variant						rs370644911	1																																			MODIFIER	1	insertion														.	GTA	.	.																					42361335
Unknown	0	.	GRCh37	10	42387515	42392239	+	IGR	INS	CTCTAATGGAATGGAATGAAATAATCCATGGACACGAATGTAATCATCATCGAATAGAATCGAATGGAATCATCGTATGGACTCGAATGGAATAATCATTGAACGGAATCGAATGGAATCATCGTCGAATGGAGGAAACAAATGGAATCATCATAGAATGGAAATGAAAGGGGTCATCATCCAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAACGGAATTGAATGGAATCATCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAAATGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTAACATCGAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATCCATGGACTAGAATGCAATCATCCTCAAATGGAATCGAATGGAATCGTCGAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCGGATGGAAACGAATGGAATCATTATCGAATGGAATCGAATGGAATCATGAAATGGAATCAGATGGAATCATCATCAAATGGAATCAAATACAATTATGGAATGAAATCCAATGTGATCATCATCAAATGGAATCGAACGGAATCATCATCCACTGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAACGAATGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAAAGAATGGAATCATCATAGAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAAAGGAAACGAATGGAATGAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCAAATGGCCACGAATGGAATCATCTAATAAAATAGAATGGAATAATCCATGGACTCGAATGCAATCATCATCAAATGGAATCGAATGGAATCAGCGAATGGAATCAAATGGAGTAAACATTGAACGGAATCGAATGGAATCTTCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCTTCAGATGGAAATGAATGGAATCATCAAACAATGGATTCGAATGGATTCATTGAATGGAATCAGAAGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAAAGTAATCATCGAATGGTCTCGAATGGAATCATTATCAATTGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCAAATGGACTCAAATGGAATTATTCTCAAATGGAATCAAATGGAATTATCGAATGGACCGAATGGAATTATCGAATGCAATCAAATAGAATCATCGAATGGACTCGAATGGAATCATCGAATGGAATGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATAGAATGGAATCATCGAGTGGAATCAAATGGAATCATCATCAAATGGAATCGAATGTAATCATCATCAAATGGAATCAAAAATAAACATCGTCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTGGAATGGAATCATCTTCAAATGGAAAGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATTGAATGGATTCAAATCGAATAAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGCATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATTATCCATGGACACGAATGCAATCATCATCGAATAGAACCCAATGGAATCATCAAATGAACTCGAATGGAATAATCATTGAACGGGATCGAATGGAATCATCGCCGAACGGAAACGAATGGAAACATCATCGAATGGAAATGAAAGGAGTCATCATCTATTGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAAGGGAATTGAAAGGAATCGTCATCGAATGGATTGAATGCAATCATCGAATGGTCTCGAATGGAATAATCTCCAAATGGAATGGAAAGGAATCATCGTATAGATTCGAATGGAATTATCATCGAAAGGACTCAGATGGAATCAACATCAAACGGAATCAAACGGAGTTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATTGATGGACTCGTATGCAATCATCATCAAATGGAATTAAATGGAATCGTCAAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAATAGAATTATGGAATGAAATCCAATGTGATCATCATTGAATGGACTCGAATGGAACCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAATGAATGGAATTATCATGAAATTGAAATGGATGGATTCATCACCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATTGAATCGAATGGAATCATTGAATGGAATCGAAAGGAATCCTCATCAGATGGAAATGAATGGAATCATCATATAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAATGGAATCATCGAATGGTATTGAATGGAATCATTATCCAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAAAGGAATTATCCTCAACTGGAATCAAATGGAATTATCAAATGCAATCGAATGGAATTATCGAATGCAATCGAGTAGAATCATCGAATGGACTCGAATGGTATCATCGAATGGAACGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCGAGTGGAATCGAATGGAATCACGATTAAATGGAATCGAATGTAATCATCAAATGGAATCAAAAATAACAATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAAACCTCATTGAATGGAAATGAAAGGAGTCATCAAATAATGGAATCGCATGGAATCATCATCAAATGGATTTGAATGGAATCATCATCAAATGGAATCTAATGGAATCATTGAAAGGAATTGAATGGAATCGTCATCGAATGAATTGAATGTAATCATCGATTGGTCTCGAATGGAATCATCATCAAATGGAAAGGAATGGAATCATCGCAAAGAATCGAATGGAATTATCATTGAATGGAGTCGAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGTCCCGAATGCAATCATCATCGAATAGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATCAAATGGAATCATCGTCGAATGGAAACGAATGGAATCATCATCGAATGGAAGTGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATGAAATGGAATCGAATGGAATCATCATCGAATGGATTCTAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTTAATGCAATCATTGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATCAAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGGATTATCAAATGCAATCGAAGAGAATCATCGAATGGACTCGAATGAAATAATCTAATGGGATGGAATGGAATAATCCATGGACTCGAATGCTCTCATCATCGAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAACAATCATTCAACGGAATCGAATGGAATCATCATTGGATGGAAACGAATGCAATCATCATCGAATGGAATTGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATTGAGTAGAATTATGGAATGAAATCCAATGTGATC	CTCTAATGGAATGGAATGAAATAATCCATGGACACGAATGTAATCATCATCGAATAGAATCGAATGGAATCATCGTATGGACTCGAATGGAATAATCATTGAACGGAATCGAATGGAATCATCGTCGAATGGAGGAAACAAATGGAATCATCATAGAATGGAAATGAAAGGGGTCATCATCCAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAACGGAATTGAATGGAATCATCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAAATGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTAACATCGAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATCCATGGACTAGAATGCAATCATCCTCAAATGGAATCGAATGGAATCGTCGAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCGGATGGAAACGAATGGAATCATTATCGAATGGAATCGAATGGAATCATGAAATGGAATCAGATGGAATCATCATCAAATGGAATCAAATACAATTATGGAATGAAATCCAATGTGATCATCATCAAATGGAATCGAACGGAATCATCATCCACTGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAACGAATGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAAAGAATGGAATCATCATAGAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAAAGGAAACGAATGGAATGAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCAAATGGCCACGAATGGAATCATCTAATAAAATAGAATGGAATAATCCATGGACTCGAATGCAATCATCATCAAATGGAATCGAATGGAATCAGCGAATGGAATCAAATGGAGTAAACATTGAACGGAATCGAATGGAATCTTCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCTTCAGATGGAAATGAATGGAATCATCAAACAATGGATTCGAATGGATTCATTGAATGGAATCAGAAGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAAAGTAATCATCGAATGGTCTCGAATGGAATCATTATCAATTGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCAAATGGACTCAAATGGAATTATTCTCAAATGGAATCAAATGGAATTATCGAATGGACCGAATGGAATTATCGAATGCAATCAAATAGAATCATCGAATGGACTCGAATGGAATCATCGAATGGAATGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATAGAATGGAATCATCGAGTGGAATCAAATGGAATCATCATCAAATGGAATCGAATGTAATCATCATCAAATGGAATCAAAAATAAACATCGTCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTGGAATGGAATCATCTTCAAATGGAAAGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATTGAATGGATTCAAATCGAATAAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGCATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATTATCCATGGACACGAATGCAATCATCATCGAATAGAACCCAATGGAATCATCAAATGAACTCGAATGGAATAATCATTGAACGGGATCGAATGGAATCATCGCCGAACGGAAACGAATGGAAACATCATCGAATGGAAATGAAAGGAGTCATCATCTATTGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAAGGGAATTGAAAGGAATCGTCATCGAATGGATTGAATGCAATCATCGAATGGTCTCGAATGGAATAATCTCCAAATGGAATGGAAAGGAATCATCGTATAGATTCGAATGGAATTATCATCGAAAGGACTCAGATGGAATCAACATCAAACGGAATCAAACGGAGTTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATTGATGGACTCGTATGCAATCATCATCAAATGGAATTAAATGGAATCGTCAAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAATAGAATTATGGAATGAAATCCAATGTGATCATCATTGAATGGACTCGAATGGAACCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAATGAATGGAATTATCATGAAATTGAAATGGATGGATTCATCACCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATTGAATCGAATGGAATCATTGAATGGAATCGAAAGGAATCCTCATCAGATGGAAATGAATGGAATCATCATATAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAATGGAATCATCGAATGGTATTGAATGGAATCATTATCCAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAAAGGAATTATCCTCAACTGGAATCAAATGGAATTATCAAATGCAATCGAATGGAATTATCGAATGCAATCGAGTAGAATCATCGAATGGACTCGAATGGTATCATCGAATGGAACGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCGAGTGGAATCGAATGGAATCACGATTAAATGGAATCGAATGTAATCATCAAATGGAATCAAAAATAACAATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAAACCTCATTGAATGGAAATGAAAGGAGTCATCAAATAATGGAATCGCATGGAATCATCATCAAATGGATTTGAATGGAATCATCATCAAATGGAATCTAATGGAATCATTGAAAGGAATTGAATGGAATCGTCATCGAATGAATTGAATGTAATCATCGATTGGTCTCGAATGGAATCATCATCAAATGGAAAGGAATGGAATCATCGCAAAGAATCGAATGGAATTATCATTGAATGGAGTCGAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGTCCCGAATGCAATCATCATCGAATAGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATCAAATGGAATCATCGTCGAATGGAAACGAATGGAATCATCATCGAATGGAAGTGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATGAAATGGAATCGAATGGAATCATCATCGAATGGATTCTAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTTAATGCAATCATTGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATCAAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGGATTATCAAATGCAATCGAAGAGAATCATCGAATGGACTCGAATGAAATAATCTAATGGGATGGAATGGAATAATCCATGGACTCGAATGCTCTCATCATCGAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAACAATCATTCAACGGAATCGAATGGAATCATCATTGGATGGAAACGAATGCAATCATCATCGAATGGAATTGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATTGAGTAGAATTATGGAATGAAATCCAATGTGATC	ATCTCTAATGGAATGGAATGAAATAATCCATGGACACGAATGTAATCATCATCGAATAGAATCGAATGGAATCATCGTATGGACTCGAATGGAATAATCATTGAACGGAATCGAATGGAATCATCGTCGAATGGAGGAAACAAATGGAATCATCATAGAATGGAAATGAAAGGGGTCATCATCCAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAACGGAATTGAATGGAATCATCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAAATGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTAACATCGAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATCCATGGACTAGAATGCAATCATCCTCAAATGGAATCGAATGGAATCGTCGAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCGGATGGAAACGAATGGAATCATTATCGAATGGAATCGAATGGAATCATGAAATGGAATCAGATGGAATCATCATCAAATGGAATCAAATACAATTATGGAATGAAATCCAATGTGATCATCATCAAATGGAATCGAACGGAATCATCATCCACTGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAACGAATGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAAAGAATGGAATCATCATAGAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAAAGGAAACGAATGGAATGAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCAAATGGCCACGAATGGAATCATCTAATAAAATAGAATGGAATAATCCATGGACTCGAATGCAATCATCATCAAATGGAATCGAATGGAATCAGCGAATGGAATCAAATGGAGTAAACATTGAACGGAATCGAATGGAATCTTCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCTTCAGATGGAAATGAATGGAATCATCAAACAATGGATTCGAATGGATTCATTGAATGGAATCAGAAGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAAAGTAATCATCGAATGGTCTCGAATGGAATCATTATCAATTGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCAAATGGACTCAAATGGAATTATTCTCAAATGGAATCAAATGGAATTATCGAATGGACCGAATGGAATTATCGAATGCAATCAAATAGAATCATCGAATGGACTCGAATGGAATCATCGAATGGAATGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATAGAATGGAATCATCGAGTGGAATCAAATGGAATCATCATCAAATGGAATCGAATGTAATCATCATCAAATGGAATCAAAAATAAACATCGTCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTGGAATGGAATCATCTTCAAATGGAAAGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATTGAATGGATTCAAATCGAATAAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGCATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATTATCCATGGACACGAATGCAATCATCATCGAATAGAACCCAATGGAATCATCAAATGAACTCGAATGGAATAATCATTGAACGGGATCGAATGGAATCATCGCCGAACGGAAACGAATGGAAACATCATCGAATGGAAATGAAAGGAGTCATCATCTATTGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAAGGGAATTGAAAGGAATCGTCATCGAATGGATTGAATGCAATCATCGAATGGTCTCGAATGGAATAATCTCCAAATGGAATGGAAAGGAATCATCGTATAGATTCGAATGGAATTATCATCGAAAGGACTCAGATGGAATCAACATCAAACGGAATCAAACGGAGTTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATTGATGGACTCGTATGCAATCATCATCAAATGGAATTAAATGGAATCGTCAAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAATAGAATTATGGAATGAAATCCAATGTGATCATCATTGAATGGACTCGAATGGAACCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAATGAATGGAATTATCATGAAATTGAAATGGATGGATTCATCACCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATTGAATCGAATGGAATCATTGAATGGAATCGAAAGGAATCCTCATCAGATGGAAATGAATGGAATCATCATATAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAATGGAATCATCGAATGGTATTGAATGGAATCATTATCCAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAAAGGAATTATCCTCAACTGGAATCAAATGGAATTATCAAATGCAATCGAATGGAATTATCGAATGCAATCGAGTAGAATCATCGAATGGACTCGAATGGTATCATCGAATGGAACGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCGAGTGGAATCGAATGGAATCACGATTAAATGGAATCGAATGTAATCATCAAATGGAATCAAAAATAACAATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAAACCTCATTGAATGGAAATGAAAGGAGTCATCAAATAATGGAATCGCATGGAATCATCATCAAATGGATTTGAATGGAATCATCATCAAATGGAATCTAATGGAATCATTGAAAGGAATTGAATGGAATCGTCATCGAATGAATTGAATGTAATCATCGATTGGTCTCGAATGGAATCATCATCAAATGGAAAGGAATGGAATCATCGCAAAGAATCGAATGGAATTATCATTGAATGGAGTCGAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGTCCCGAATGCAATCATCATCGAATAGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATCAAATGGAATCATCGTCGAATGGAAACGAATGGAATCATCATCGAATGGAAGTGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATGAAATGGAATCGAATGGAATCATCATCGAATGGATTCTAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTTAATGCAATCATTGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATCAAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGGATTATCAAATGCAATCGAAGAGAATCATCGAATGGACTCGAATGAAATAATCTAATGGGATGGAATGGAATAATCCATGGACTCGAATGCTCTCATCATCGAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAACAATCATTCAACGGAATCGAATGGAATCATCATTGGATGGAAACGAATGCAATCATCATCGAATGGAATTGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATTGAGTAGAATTATGGAATGAAATCCAATGTGATC	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	CTCTAATGGAATGGAATGAAATAATCCATGGACACGAATGTAATCATCATCGAATAGAATCGAATGGAATCATCGTATGGACTCGAATGGAATAATCATTGAACGGAATCGAATGGAATCATCGTCGAATGGAGGAAACAAATGGAATCATCATAGAATGGAAATGAAAGGGGTCATCATCCAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAACGGAATTGAATGGAATCATCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAAATGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTAACATCGAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATCCATGGACTAGAATGCAATCATCCTCAAATGGAATCGAATGGAATCGTCGAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCGGATGGAAACGAATGGAATCATTATCGAATGGAATCGAATGGAATCATGAAATGGAATCAGATGGAATCATCATCAAATGGAATCAAATACAATTATGGAATGAAATCCAATGTGATCATCATCAAATGGAATCGAACGGAATCATCATCCACTGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAACGAATGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAAAGAATGGAATCATCATAGAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAAAGGAAACGAATGGAATGAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCAAATGGCCACGAATGGAATCATCTAATAAAATAGAATGGAATAATCCATGGACTCGAATGCAATCATCATCAAATGGAATCGAATGGAATCAGCGAATGGAATCAAATGGAGTAAACATTGAACGGAATCGAATGGAATCTTCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCTTCAGATGGAAATGAATGGAATCATCAAACAATGGATTCGAATGGATTCATTGAATGGAATCAGAAGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAAAGTAATCATCGAATGGTCTCGAATGGAATCATTATCAATTGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCAAATGGACTCAAATGGAATTATTCTCAAATGGAATCAAATGGAATTATCGAATGGACCGAATGGAATTATCGAATGCAATCAAATAGAATCATCGAATGGACTCGAATGGAATCATCGAATGGAATGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATAGAATGGAATCATCGAGTGGAATCAAATGGAATCATCATCAAATGGAATCGAATGTAATCATCATCAAATGGAATCAAAAATAAACATCGTCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTGGAATGGAATCATCTTCAAATGGAAAGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATTGAATGGATTCAAATCGAATAAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGCATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATTATCCATGGACACGAATGCAATCATCATCGAATAGAACCCAATGGAATCATCAAATGAACTCGAATGGAATAATCATTGAACGGGATCGAATGGAATCATCGCCGAACGGAAACGAATGGAAACATCATCGAATGGAAATGAAAGGAGTCATCATCTATTGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAAGGGAATTGAAAGGAATCGTCATCGAATGGATTGAATGCAATCATCGAATGGTCTCGAATGGAATAATCTCCAAATGGAATGGAAAGGAATCATCGTATAGATTCGAATGGAATTATCATCGAAAGGACTCAGATGGAATCAACATCAAACGGAATCAAACGGAGTTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATTGATGGACTCGTATGCAATCATCATCAAATGGAATTAAATGGAATCGTCAAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAATAGAATTATGGAATGAAATCCAATGTGATCATCATTGAATGGACTCGAATGGAACCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAATGAATGGAATTATCATGAAATTGAAATGGATGGATTCATCACCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATTGAATCGAATGGAATCATTGAATGGAATCGAAAGGAATCCTCATCAGATGGAAATGAATGGAATCATCATATAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAATGGAATCATCGAATGGTATTGAATGGAATCATTATCCAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAAAGGAATTATCCTCAACTGGAATCAAATGGAATTATCAAATGCAATCGAATGGAATTATCGAATGCAATCGAGTAGAATCATCGAATGGACTCGAATGGTATCATCGAATGGAACGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCGAGTGGAATCGAATGGAATCACGATTAAATGGAATCGAATGTAATCATCAAATGGAATCAAAAATAACAATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAAACCTCATTGAATGGAAATGAAAGGAGTCATCAAATAATGGAATCGCATGGAATCATCATCAAATGGATTTGAATGGAATCATCATCAAATGGAATCTAATGGAATCATTGAAAGGAATTGAATGGAATCGTCATCGAATGAATTGAATGTAATCATCGATTGGTCTCGAATGGAATCATCATCAAATGGAAAGGAATGGAATCATCGCAAAGAATCGAATGGAATTATCATTGAATGGAGTCGAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGTCCCGAATGCAATCATCATCGAATAGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATCAAATGGAATCATCGTCGAATGGAAACGAATGGAATCATCATCGAATGGAAGTGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATGAAATGGAATCGAATGGAATCATCATCGAATGGATTCTAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTTAATGCAATCATTGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATCAAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGGATTATCAAATGCAATCGAAGAGAATCATCGAATGGACTCGAATGAAATAATCTAATGGGATGGAATGGAATAATCCATGGACTCGAATGCTCTCATCATCGAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAACAATCATTCAACGGAATCGAATGGAATCATCATTGGATGGAAACGAATGCAATCATCATCGAATGGAATTGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATTGAGTAGAATTATGGAATGAAATCCAATGTGATC	CTCTAATGGAATGGAATGAAATAATCCATGGACACGAATGTAATCATCATCGAATAGAATCGAATGGAATCATCGTATGGACTCGAATGGAATAATCATTGAACGGAATCGAATGGAATCATCGTCGAATGGAGGAAACAAATGGAATCATCATAGAATGGAAATGAAAGGGGTCATCATCCAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAACGGAATTGAATGGAATCATCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAAATGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTAACATCGAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATCCATGGACTAGAATGCAATCATCCTCAAATGGAATCGAATGGAATCGTCGAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCGGATGGAAACGAATGGAATCATTATCGAATGGAATCGAATGGAATCATGAAATGGAATCAGATGGAATCATCATCAAATGGAATCAAATACAATTATGGAATGAAATCCAATGTGATCATCATCAAATGGAATCGAACGGAATCATCATCCACTGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAACGAATGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAAAGAATGGAATCATCATAGAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAAAGGAAACGAATGGAATGAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCAAATGGCCACGAATGGAATCATCTAATAAAATAGAATGGAATAATCCATGGACTCGAATGCAATCATCATCAAATGGAATCGAATGGAATCAGCGAATGGAATCAAATGGAGTAAACATTGAACGGAATCGAATGGAATCTTCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCTTCAGATGGAAATGAATGGAATCATCAAACAATGGATTCGAATGGATTCATTGAATGGAATCAGAAGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAAAGTAATCATCGAATGGTCTCGAATGGAATCATTATCAATTGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCAAATGGACTCAAATGGAATTATTCTCAAATGGAATCAAATGGAATTATCGAATGGACCGAATGGAATTATCGAATGCAATCAAATAGAATCATCGAATGGACTCGAATGGAATCATCGAATGGAATGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATAGAATGGAATCATCGAGTGGAATCAAATGGAATCATCATCAAATGGAATCGAATGTAATCATCATCAAATGGAATCAAAAATAAACATCGTCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTGGAATGGAATCATCTTCAAATGGAAAGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATTGAATGGATTCAAATCGAATAAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGCATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATTATCCATGGACACGAATGCAATCATCATCGAATAGAACCCAATGGAATCATCAAATGAACTCGAATGGAATAATCATTGAACGGGATCGAATGGAATCATCGCCGAACGGAAACGAATGGAAACATCATCGAATGGAAATGAAAGGAGTCATCATCTATTGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAAGGGAATTGAAAGGAATCGTCATCGAATGGATTGAATGCAATCATCGAATGGTCTCGAATGGAATAATCTCCAAATGGAATGGAAAGGAATCATCGTATAGATTCGAATGGAATTATCATCGAAAGGACTCAGATGGAATCAACATCAAACGGAATCAAACGGAGTTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATTGATGGACTCGTATGCAATCATCATCAAATGGAATTAAATGGAATCGTCAAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAATAGAATTATGGAATGAAATCCAATGTGATCATCATTGAATGGACTCGAATGGAACCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAATGAATGGAATTATCATGAAATTGAAATGGATGGATTCATCACCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATTGAATCGAATGGAATCATTGAATGGAATCGAAAGGAATCCTCATCAGATGGAAATGAATGGAATCATCATATAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAATGGAATCATCGAATGGTATTGAATGGAATCATTATCCAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAAAGGAATTATCCTCAACTGGAATCAAATGGAATTATCAAATGCAATCGAATGGAATTATCGAATGCAATCGAGTAGAATCATCGAATGGACTCGAATGGTATCATCGAATGGAACGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCGAGTGGAATCGAATGGAATCACGATTAAATGGAATCGAATGTAATCATCAAATGGAATCAAAAATAACAATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAAACCTCATTGAATGGAAATGAAAGGAGTCATCAAATAATGGAATCGCATGGAATCATCATCAAATGGATTTGAATGGAATCATCATCAAATGGAATCTAATGGAATCATTGAAAGGAATTGAATGGAATCGTCATCGAATGAATTGAATGTAATCATCGATTGGTCTCGAATGGAATCATCATCAAATGGAAAGGAATGGAATCATCGCAAAGAATCGAATGGAATTATCATTGAATGGAGTCGAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGTCCCGAATGCAATCATCATCGAATAGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATCAAATGGAATCATCGTCGAATGGAAACGAATGGAATCATCATCGAATGGAAGTGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATGAAATGGAATCGAATGGAATCATCATCGAATGGATTCTAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTTAATGCAATCATTGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATCAAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGGATTATCAAATGCAATCGAAGAGAATCATCGAATGGACTCGAATGAAATAATCTAATGGGATGGAATGGAATAATCCATGGACTCGAATGCTCTCATCATCGAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAACAATCATTCAACGGAATCGAATGGAATCATCATTGGATGGAAACGAATGCAATCATCATCGAATGGAATTGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATTGAGTAGAATTATGGAATGAAATCCAATGTGATC																					185	.	0	195	.	3		GAATGGACTTTAATGGAATCATTAAATGGACTCGAATGGAATCATTATTGAATGGAATTGAATGGAATCTTCCAATGGTCTCGAATGGAATTATTATCAAATGGAACCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACCCAAATGGAATTATCCTCAAATGGAATAGAATGGAATTATCGAATGCAATCGAATAGAATCATCGAATGGACTCGAGTGGAATCATCGAATGGAATGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATCGAATGGAATCATTGAGTGGAATCGAATGGAATCACGATCAAATGGAATCGAATGTAATCATCATCAAATGGAATCAAAATAACCATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCAACATCAAATGGAACCGAATGGAATCCTCGTTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCACATGGAATCATCATCTAATGGAATCGAATGGAATCATCATCGAATGGACTCATCATCAAATCGAATCTAATGGCATCATTGAAAGGAATTGAATGGAACCGTCATCGAATGAATTGAATGCAATCATTGAATGGTCTCGAATGGAATCATCTTCAAATGGAAAGGAATGGAATCATCGCATGGAATCAAATGGAATTATCATTGAATGGACCGAATGGAATCAACATCAAACGGAATCAAACGGAATTATTGAATGGAATCGGAGAGAATCATCGAATGGCCACGAATGGAATCATCTAATGGAGTGGAATGGAATAATCCCTTGACCCGAATGCAATCATCATCAAATAGAATCGAATGGAATCATCGAATGTACTCGAATGGAATAATCAAACGGAATCGAATGGAATCATCGTCGAATGGAAACGAATGGAATCATCATCGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAACGGAATCGCATGGAATCATCATCAAATGGAATCTAATGGAATCGTTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTGTCGAATGGAATCATCTTCAAATGGCATGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATCGAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGAATTATCAAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATCCATGGACTCGAATGCAATCATCATCAAATGGAATAGAGTGGAATCGGCGAATGAACTCGAATGGAATAAACATTGAACGGAATCGAATGGAATCATCATCGGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGAAATCGAATAGAACTATGGAATGAAATCCAATATGATCATCATCGAATGGACTCGAGCGGAATCATCATCCAATGGAAGCTAATGGAATCAAAATCGTATGGAATCGAATGGAAACACCATCGAATTGAAACGAATGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCGAATGGCATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAATGAATGGAATCATCACTGAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGGATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAAAGGAATCATTATTGAATGGAATTGAATGGAATCATCGAATGGTCTCGAATGGAATCATTATCAAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAATGGAATTATCCTCAAATGGAATCGAAGGGAATTATCTAATGCAATCGAATAGAATTATCGAATGCAATCGAATAGAATCATCGAGTGGACTCGAATGGAATCATCGAGTGGAATGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATAGAATGGAATCATCGAGTGGAATCGAATGGAATCACAATCAAATGGCATCGAATGTAATCATCATCAAATGGAATCAAAAATAACCATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATTAAATGGAATCATCATCAAATCAAATCTAATGGTATCATTGAACGGAATTGAATGGAACCGTCATCTAATGAATTGAATGCAATCATCGAATGGTCCCGAATGGAATCATCTACAAATGGAAAGGAATGGAATCATCGCATAGAATCGAATGGAATTATGATTGAATGGACCGAATGGAATCAACATCAAACTTAATCAAACGGAATTATCGAATGGAATCGGAAAGAATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGACTCGAATGCAATCATCATCGAATAGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATCGAATGGAATCATCGTCGAACGGAAACAAATGGAATCATCATCGAATGCAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGCATGGAATCATCATCGAATGGAATCGAATGGAATCGTCGAATGGACTCGAAAGGAATAAACATTGAACGGAATCCAATGCAGTCTTCACCGGATGGAAACGAATGGAATCATCATCGAATTGAATGGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAATAGAATTATGGAATGAAACCCAATGTGATCATCATCGAACGGACTTGAATGGAATCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAACGAATGGAATTATCATGAAATTGAAAAGGAAGGACTCATCATCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCTAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCATCATATGGAAATGAATGCAATCATCATTGAATGGAATCGAATGGATTCATTGAATGGAATCACATAGAATCATCGAATGGACTTGAATGGAAACATTGAATGGACTCGAATGGAATCATTATTGAATGGAATTCAATGGAATCATCGAATGGTCTCGAATAGAATCATTATCAAATGGAATCGAATGGAATAATTATCGAATGGAATCGAATGGAACAATCATGGAATGGACTCAAATGGCATTATCCTCAAATGGAATTGAATGGATTTATCAAATGCAATCGAATGGAATTATAGAATGCCATCAAATAGAATCATCGAATGGACTCGAATGGAATCATCGAATGGAATGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCGAGTGGAATCGAATAGAATCATGATCAAATGGAATCAAGTGTAATCATCATCAAATGGAATCAAAAATAACCATCATCAGTTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAATCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATAATCATCGAATGGAATCTAATGGAATCATTGAACAGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGCATCATCTTCAAATGGAAAGGAATGGAATCATCGCATAGAATCGAATGGAATTGTCATTGAATGGACTCGAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGCCTCGAATGGAATCATCTCTAATGGAATGGAATGAAATAATCCATGGACACGAATGTAATCATCATCGAATAGAATCGAATGGAATCATCGTATGGACTCGAATGGAATAATCATTGAACGGAATCGAATGGAATCATCGTCGAATGGAGGAAACAAATGGAATCATCATAGAATGGAAATGAAAGGGGTCATCATCCAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAACGGAATTGAATGGAATCATCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAAATGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTAACATCGAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATCCATGGACTAGAATGCAATCATCCTCAAATGGAATCGAATGGAATCGTCGAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCGGATGGAAACGAATGGAATCATTATCGAATGGAATCGAATGGAATCATGAAATGGAATCAGATGGAATCATCATCAAATGGAATCAAATACAATTATGGAATGAAATCCAATGTGATCATCATCAAATGGAATCGAACGGAATCATCATCCACTGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAACGAATGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAAAGAATGGAATCATCATAGAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAAAGGAAACGAATGGAATGAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCAAATGGCCACGAATGGAATCATCTAATAAAATAGAATGGAATAATCCATGGACTCGAATGCAATCATCATCAAATGGAATCGAATGGAATCAGCGAATGGAATCAAATGGAGTAAACATTGAACGGAATCGAATGGAATCTTCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCTTCAGATGGAAATGAATGGAATCATCAAACAATGGATTCGAATGGATTCATTGAATGGAATCAGAAGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAAAGTAATCATCGAATGGTCTCGAATGGAATCATTATCAATTGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCAAATGGACTCAAATGGAATTATTCTCAAATGGAATCAAATGGAATTATCGAATGGACCGAATGGAATTATCGAATGCAATCAAATAGAATCATCGAATGGACTCGAATGGAATCATCGAATGGAATGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATAGAATGGAATCATCGAGTGGAATCAAATGGAATCATCATCAAATGGAATCGAATGTAATCATCATCAAATGGAATCAAAAATAAACATCGTCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTGGAATGGAATCATCTTCAAATGGAAAGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATTGAATGGATTCAAATCGAATAAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGCATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATTATCCATGGACACGAATGCAATCATCATCGAATAGAACCCAATGGAATCATCAAATGAACTCGAATGGAATAATCATTGAACGGGATCGAATGGAATCATCGCCGAACGGAAACGAATGGAAACATCATCGAATGGAAATGAAAGGAGTCATCATCTATTGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAAGGGAATTGAAAGGAATCGTCATCGAATGGATTGAATGCAATCATCGAATGGTCTCGAATGGAATAATCTCCAAATGGAATGGAAAGGAATCATCGTATAGATTCGAATGGAATTATCATCGAAAGGACTCAGATGGAATCAACATCAAACGGAATCAAACGGAGTTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATTGATGGACTCGTATGCAATCATCATCAAATGGAATTAAATGGAATCGTCAAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAATAGAATTATGGAATGAAATCCAATGTGATCATCATTGAATGGACTCGAATGGAACCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAATGAATGGAATTATCATGAAATTGAAATGGATGGATTCATCACCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATTGAATCGAATGGAATCATTGAATGGAATCGAAAGGAATCCTCATCAGATGGAAATGAATGGAATCATCATATAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAATGGAATCATCGAATGGTATTGAATGGAATCATTATCCAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAAAGGAATTATCCTCAACTGGAATCAAATGGAATTATCAAATGCAATCGAATGGAATTATCGAATGCAATCGAGTAGAATCATCGAATGGACTCGAATGGTATCATCGAATGGAACGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCGAGTGGAATCGAATGGAATCACGATTAAATGGAATCGAATGTAATCATCAAATGGAATCAAAAATAACAATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAAACCTCATTGAATGGAAATGAAAGGAGTCATCAAATAATGGAATCGCATGGAATCATCATCAAATGGATTTGAATGGAATCATCATCAAATGGAATCTAATGGAATCATTGAAAGGAATTGAATGGAATCGTCATCGAATGAATTGAATGTAATCATCGATTGGTCTCGAATGGAATCATCATCAAATGGAAAGGAATGGAATCATCGCAAAGAATCGAATGGAATTATCATTGAATGGAGTCGAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGTCCCGAATGCAATCATCATCGAATAGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATCAAATGGAATCATCGTCGAATGGAAACGAATGGAATCATCATCGAATGGAAGTGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATGAAATGGAATCGAATGGAATCATCATCGAATGGATTCTAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTTAATGCAATCATTGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATCAAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGGATTATCAAATGCAATCGAAGAGAATCATCGAATGGACTCGAATGAAATAATCTAATGGGATGGAATGGAATAATCCATGGACTCGAATGCTCTCATCATCGAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAACAATCATTCAACGGAATCGAATGGAATCATCATTGGATGGAAACGAATGCAATCATCATCGAATGGAATTGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATTGAGTAGAATTATGGAATGAAATCCAATGTGATC				intergenic_variant							36																																			MODIFIER	1	indel														.	TCGAATGGACTTTAATGGAATCATTAAATGGACTCGAATGGAATCATTATTGAATGGAATTGAATGGAATCTTCCAATGGTCTCGAATGGAATTATTATCAAATGGAACCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACCCAAATGGAATTATCCTCAAATGGAATAGAATGGAATTATCGAATGCAATCGAATAGAATCATCGAATGGACTCGAGTGGAATCATCGAATGGAATGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATCGAATGGAATCATTGAGTGGAATCGAATGGAATCACGATCAAATGGAATCGAATGTAATCATCATCAAATGGAATCAAAATAACCATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCAACATCAAATGGAACCGAATGGAATCCTCGTTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCACATGGAATCATCATCTAATGGAATCGAATGGAATCATCATCGAATGGACTCATCATCAAATCGAATCTAATGGCATCATTGAAAGGAATTGAATGGAACCGTCATCGAATGAATTGAATGCAATCATTGAATGGTCTCGAATGGAATCATCTTCAAATGGAAAGGAATGGAATCATCGCATGGAATCAAATGGAATTATCATTGAATGGACCGAATGGAATCAACATCAAACGGAATCAAACGGAATTATTGAATGGAATCGGAGAGAATCATCGAATGGCCACGAATGGAATCATCTAATGGAGTGGAATGGAATAATCCCTTGACCCGAATGCAATCATCATCAAATAGAATCGAATGGAATCATCGAATGTACTCGAATGGAATAATCAAACGGAATCGAATGGAATCATCGTCGAATGGAAACGAATGGAATCATCATCGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAACGGAATCGCATGGAATCATCATCAAATGGAATCTAATGGAATCGTTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTGTCGAATGGAATCATCTTCAAATGGCATGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATCGAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGAATTATCAAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATCCATGGACTCGAATGCAATCATCATCAAATGGAATAGAGTGGAATCGGCGAATGAACTCGAATGGAATAAACATTGAACGGAATCGAATGGAATCATCATCGGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGAAATCGAATAGAACTATGGAATGAAATCCAATATGATCATCATCGAATGGACTCGAGCGGAATCATCATCCAATGGAAGCTAATGGAATCAAAATCGTATGGAATCGAATGGAAACACCATCGAATTGAAACGAATGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCGAATGGCATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAATGAATGGAATCATCACTGAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGGATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAAAGGAATCATTATTGAATGGAATTGAATGGAATCATCGAATGGTCTCGAATGGAATCATTATCAAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAATGGAATTATCCTCAAATGGAATCGAAGGGAATTATCTAATGCAATCGAATAGAATTATCGAATGCAATCGAATAGAATCATCGAGTGGACTCGAATGGAATCATCGAGTGGAATGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATAGAATGGAATCATCGAGTGGAATCGAATGGAATCACAATCAAATGGCATCGAATGTAATCATCATCAAATGGAATCAAAAATAACCATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATTAAATGGAATCATCATCAAATCAAATCTAATGGTATCATTGAACGGAATTGAATGGAACCGTCATCTAATGAATTGAATGCAATCATCGAATGGTCCCGAATGGAATCATCTACAAATGGAAAGGAATGGAATCATCGCATAGAATCGAATGGAATTATGATTGAATGGACCGAATGGAATCAACATCAAACTTAATCAAACGGAATTATCGAATGGAATCGGAAAGAATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGACTCGAATGCAATCATCATCGAATAGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATCGAATGGAATCATCGTCGAACGGAAACAAATGGAATCATCATCGAATGCAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGCATGGAATCATCATCGAATGGAATCGAATGGAATCGTCGAATGGACTCGAAAGGAATAAACATTGAACGGAATCCAATGCAGTCTTCACCGGATGGAAACGAATGGAATCATCATCGAATTGAATGGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAATAGAATTATGGAATGAAACCCAATGTGATCATCATCGAACGGACTTGAATGGAATCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAACGAATGGAATTATCATGAAATTGAAAAGGAAGGACTCATCATCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCTAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCATCATATGGAAATGAATGCAATCATCATTGAATGGAATCGAATGGATTCATTGAATGGAATCACATAGAATCATCGAATGGACTTGAATGGAAACATTGAATGGACTCGAATGGAATCATTATTGAATGGAATTCAATGGAATCATCGAATGGTCTCGAATAGAATCATTATCAAATGGAATCGAATGGAATAATTATCGAATGGAATCGAATGGAACAATCATGGAATGGACTCAAATGGCATTATCCTCAAATGGAATTGAATGGATTTATCAAATGCAATCGAATGGAATTATAGAATGCCATCAAATAGAATCATCGAATGGACTCGAATGGAATCATCGAATGGAATGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCGAGTGGAATCGAATAGAATCATGATCAAATGGAATCAAGTGTAATCATCATCAAATGGAATCAAAAATAACCATCATCAGTTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAATCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATAATCATCGAATGGAATCTAATGGAATCATTGAACAGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGCATCATCTTCAAATGGAAAGGAATGGAATCATCGCATAGAATCGAATGGAATTGTCATTGAATGGACTCGAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGCCTCGAATGGAATCCTCTAATGGAATGGAATGAAATAATCCATGGACACGAATGTAATCATCATCGAATAGAATCGAATGGAATCATCGTATGGACTCGAATGGAATAATCATTGAACGGAATCGAATGGAATCATCGTCGAATGGAGGAAACAAATGGAATCATCATAGAATGGAAATGAAAGGGGTCATCATCCAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAACGGAATTGAATGGAATCATCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAAATGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTAACATCGAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATCCATGGACTAGAATGCAATCATCCTCAAATGGAATCGAATGGAATCGTCGAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCGGATGGAAACGAATGGAATCATTATCGAATGGAATCGAATGGAATCATGAAATGGAATCAGATGGAATCATCATCAAATGGAATCAAATACAATTATGGAATGAAATCCAATGTGATCATCATCAAATGGAATCGAACGGAATCATCATCCACTGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAACGAATGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAAAGAATGGAATCATCATAGAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAAAGGAAACGAATGGAATGAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCAAATGGCCACGAATGGAATCATCTAATAAAATAGAATGGAATAATCCATGGACTCGAATGCAATCATCATCAAATGGAATCGAATGGAATCAGCGAATGGAATCAAATGGAGTAAACATTGAACGGAATCGAATGGAATCTTCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATTGAATGGAATCGAATGGAATCATCTTCAGATGGAAATGAATGGAATCATCAAACAATGGATTCGAATGGATTCATTGAATGGAATCAGAAGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAAAGTAATCATCGAATGGTCTCGAATGGAATCATTATCAATTGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCAAATGGACTCAAATGGAATTATTCTCAAATGGAATCAAATGGAATTATCGAATGGACCGAATGGAATTATCGAATGCAATCAAATAGAATCATCGAATGGACTCGAATGGAATCATCGAATGGAATGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATAGAATGGAATCATCGAGTGGAATCAAATGGAATCATCATCAAATGGAATCGAATGTAATCATCATCAAATGGAATCAAAAATAAACATCGTCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTGGAATGGAATCATCTTCAAATGGAAAGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATTGAATGGATTCAAATCGAATAAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGCATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATTATCCATGGACACGAATGCAATCATCATCGAATAGAACCCAATGGAATCATCAAATGAACTCGAATGGAATAATCATTGAACGGGATCGAATGGAATCATCGCCGAACGGAAACGAATGGAAACATCATCGAATGGAAATGAAAGGAGTCATCATCTATTGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCGAATGGAATCTAATGGAATCATTGAAGGGAATTGAAAGGAATCGTCATCGAATGGATTGAATGCAATCATCGAATGGTCTCGAATGGAATAATCTCCAAATGGAATGGAAAGGAATCATCGTATAGATTCGAATGGAATTATCATCGAAAGGACTCAGATGGAATCAACATCAAACGGAATCAAACGGAGTTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGAAATAGAATGGAATAATTGATGGACTCGTATGCAATCATCATCAAATGGAATTAAATGGAATCGTCAAATGGACTCGAATGGAATAAATATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAATAGAATTATGGAATGAAATCCAATGTGATCATCATTGAATGGACTCGAATGGAACCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAATGAATGGAATTATCATGAAATTGAAATGGATGGATTCATCACCGAATGGATTCGAATGGAATCATCGAATGAAATTGATTGAAATCATCATCAAATTGAATCGAATGGAATCATTGAATGGAATCGAAAGGAATCCTCATCAGATGGAAATGAATGGAATCATCATATAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCGAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATGGAATAGAATGGAATCATCGAATGGTATTGAATGGAATCATTATCCAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAAAGGAATTATCCTCAACTGGAATCAAATGGAATTATCAAATGCAATCGAATGGAATTATCGAATGCAATCGAGTAGAATCATCGAATGGACTCGAATGGTATCATCGAATGGAACGGAATGGAATAGTCAATGAACTCGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCGAGTGGAATCGAATGGAATCACGATTAAATGGAATCGAATGTAATCATCAAATGGAATCAAAAATAACAATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAAACCTCATTGAATGGAAATGAAAGGAGTCATCAAATAATGGAATCGCATGGAATCATCATCAAATGGATTTGAATGGAATCATCATCAAATGGAATCTAATGGAATCATTGAAAGGAATTGAATGGAATCGTCATCGAATGAATTGAATGTAATCATCGATTGGTCTCGAATGGAATCATCATCAAATGGAAAGGAATGGAATCATCGCAAAGAATCGAATGGAATTATCATTGAATGGAGTCGAATGGAATCAACATCAAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGCCACGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGTCCCGAATGCAATCATCATCGAATAGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATCAAATGGAATCATCGTCGAATGGAAACGAATGGAATCATCATCGAATGGAAGTGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATGAAATGGAATCGAATGGAATCATCATCGAATGGATTCTAATGGAATCATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTTAATGCAATCATTGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATCAAATGGACTCAAATGGAATCAACATCAAACGGAATCAAACGGGATTATCAAATGCAATCGAAGAGAATCATCGAATGGACTCGAATGAAATAATCTAATGGGATGGAATGGAATAATCCATGGACTCGAATGCTCTCATCATCGAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAACAATCATTCAACGGAATCGAATGGAATCATCATTGGATGGAAACGAATGCAATCATCATCGAATGGAATTGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATTGAGTAGAATTATGGAATGAAATCCAATGTGATCA	.	.																					42383337
Unknown	0	.	GRCh37	10	42399094	42399095	+	IGR	INS	-	-	TT	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					24	21	3	31	0	0		TT				intergenic_variant							1																																			MODIFIER	1	insertion														.	TCT	.	.																					42399094
Unknown	0	.	GRCh37	10	42399681	42399682	+	IGR	INS	-	-	C	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					18	13	5	23	0	0		C				intergenic_variant							1																																			MODIFIER	1	insertion														.	CTT	.	.																					42399681
Unknown	0	.	GRCh37	10	42527766	42527767	+	IGR	INS	-	-	CC	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					74	63	11	58	0	0		CC				intergenic_variant							1																																			MODIFIER	1	insertion														.	AAA	.	.																					42527766
Unknown	0	.	GRCh37	10	42527767	42527768	+	IGR	INS	-	-	CT	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					102	65	37	61	0	0		CT				intergenic_variant							1																																			MODIFIER	1	insertion														.	AAC	.	.																					42527767
Unknown	0	.	GRCh37	10	42527811	42527812	+	IGR	INS	-	-	AA	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					36	31	5	60	0	0		AA				intergenic_variant							1																																			MODIFIER	1	insertion														.	ACA	.	.																					42527811
Unknown	0	.	GRCh37	10	42529101	42529101	+	IGR	DEL	G	G	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																					151	124	27	140	0	0		-				intergenic_variant							1																																			MODIFIER	1	deletion														.	CAGA	.	.																					42529100
Unknown	0	.	GRCh37	10	42529122	42529122	+	IGR	DEL	A	A	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					201	154	47	152	0	0		-				intergenic_variant							1																																			MODIFIER	1	deletion														.	TTAC	.	.																					42529121
Unknown	0	.	GRCh37	10	42529124	42529124	+	IGR	DEL	A	A	-	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					188	153	35	156	0	0		-				intergenic_variant							1																																			MODIFIER	1	deletion														.	ACAA	.	.																					42529123
Unknown	0	.	GRCh37	10	42529126	42529127	+	IGR	INS	-	-	T	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					124	112	12	165	0	0		T				intergenic_variant							1																																			MODIFIER	1	insertion														.	AAC	.	.																					42529126
Unknown	0	.	GRCh37	10	42534904	42534905	+	IGR	INS	-	-	GA	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					87	54	32	71	71	0		GA				intergenic_variant							1																																			MODIFIER	1	insertion														.	CTA	.	.																					42534904
Unknown	0	.	GRCh37	10	42597893	42600160	+	IGR	INS	AATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATTGAGTGGAATCGAATGGAATCATGATCAAATGTAATCAAAAGTAATCATCATCCAATGGAATCAGAAATAACCATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGAAATCGAATGGAATCATCATCAATTGGAATCTAATGGAATCATTGAACAGAATTGAATGGAATCTTCATCGAATGAATTGAATGCAATCATCGAATGTTCTCGAATGCAATCATATTCAAATAGAATGGAATTTAATAATCGCATAAAATCGAATGAAATTATCATCGAATGGACTCGAATCGAATCAACATCAAATGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATCATCTAATGGATTGGAATGGAATAATCCATGGACACGAATGCAATCATCATCCAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCCTTGAACGGAATCGATTGGAATCATCATCGGATGGATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAGTAGAATTATGGAATGCAATCCAATGTGATCATCATCGAATGGACTCGAATGGAATCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAAGGAAAGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCCAATGAAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCAAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAATGAATGGTATCATCATAGAATGGAATCAAATGGATTCATTGAATGGAATCAGATGGAATCATCCAATGGACTTGAATGGAATCATTGAATGTACTGGAATGGAATCATTATTGAATAGAATTGAATGGAATCATGGAATGGTCTCGAATGGTATCATTATGAAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAATGGAATTATCCTCAAATGGAATCAAATGGAATTATCGAATGCAATCGAATGGAATTATCGAATGCAATCGAATAGAATCATCGAATGGGCTCGATTGGAATTATCGAATGGAATTTAATGGAATAATTGAACGGAATTGAATCGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAAAGGAATGGAGTCATCGCATAGAATCGAATGGAATTATCATTGAATGGACTCGAATGGAATCAACATCAAACGGATTCAAACGGAATTATTGAATGGATTCGAAGAGTCATTGAATGACTCGAATGGAATCATCTAATAAAATGGAATCAAATAATCCATGGACTCGAATGCAATCATCATCGAATGGTATCGAATGGAATCATTCAATGGACTCGAATGCAATAATCATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCAGATGGAATCTAATGGAAACATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATTGAATGGAATTATCATCGAATTGACTCGAATGGAATCAACATCTAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGATTCGAATGCAATCATCATCGAATGGAATCAAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATTGAATGGAATCATCATCGGATGGAAACGAATGGAATCGTCATCGAATGGAATCGAATGGAATCATCAAATGGGATCAGATGGAATCATCATCAAATGGAATCGAATA	AATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATTGAGTGGAATCGAATGGAATCATGATCAAATGTAATCAAAAGTAATCATCATCCAATGGAATCAGAAATAACCATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGAAATCGAATGGAATCATCATCAATTGGAATCTAATGGAATCATTGAACAGAATTGAATGGAATCTTCATCGAATGAATTGAATGCAATCATCGAATGTTCTCGAATGCAATCATATTCAAATAGAATGGAATTTAATAATCGCATAAAATCGAATGAAATTATCATCGAATGGACTCGAATCGAATCAACATCAAATGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATCATCTAATGGATTGGAATGGAATAATCCATGGACACGAATGCAATCATCATCCAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCCTTGAACGGAATCGATTGGAATCATCATCGGATGGATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAGTAGAATTATGGAATGCAATCCAATGTGATCATCATCGAATGGACTCGAATGGAATCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAAGGAAAGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCCAATGAAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCAAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAATGAATGGTATCATCATAGAATGGAATCAAATGGATTCATTGAATGGAATCAGATGGAATCATCCAATGGACTTGAATGGAATCATTGAATGTACTGGAATGGAATCATTATTGAATAGAATTGAATGGAATCATGGAATGGTCTCGAATGGTATCATTATGAAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAATGGAATTATCCTCAAATGGAATCAAATGGAATTATCGAATGCAATCGAATGGAATTATCGAATGCAATCGAATAGAATCATCGAATGGGCTCGATTGGAATTATCGAATGGAATTTAATGGAATAATTGAACGGAATTGAATCGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAAAGGAATGGAGTCATCGCATAGAATCGAATGGAATTATCATTGAATGGACTCGAATGGAATCAACATCAAACGGATTCAAACGGAATTATTGAATGGATTCGAAGAGTCATTGAATGACTCGAATGGAATCATCTAATAAAATGGAATCAAATAATCCATGGACTCGAATGCAATCATCATCGAATGGTATCGAATGGAATCATTCAATGGACTCGAATGCAATAATCATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCAGATGGAATCTAATGGAAACATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATTGAATGGAATTATCATCGAATTGACTCGAATGGAATCAACATCTAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGATTCGAATGCAATCATCATCGAATGGAATCAAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATTGAATGGAATCATCATCGGATGGAAACGAATGGAATCGTCATCGAATGGAATCGAATGGAATCATCAAATGGGATCAGATGGAATCATCATCAAATGGAATCGAATA	CAATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATTGAGTGGAATCGAATGGAATCATGATCAAATGTAATCAAAAGTAATCATCATCCAATGGAATCAGAAATAACCATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGAAATCGAATGGAATCATCATCAATTGGAATCTAATGGAATCATTGAACAGAATTGAATGGAATCTTCATCGAATGAATTGAATGCAATCATCGAATGTTCTCGAATGCAATCATATTCAAATAGAATGGAATTTAATAATCGCATAAAATCGAATGAAATTATCATCGAATGGACTCGAATCGAATCAACATCAAATGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATCATCTAATGGATTGGAATGGAATAATCCATGGACACGAATGCAATCATCATCCAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCCTTGAACGGAATCGATTGGAATCATCATCGGATGGATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAGTAGAATTATGGAATGCAATCCAATGTGATCATCATCGAATGGACTCGAATGGAATCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAAGGAAAGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCCAATGAAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCAAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAATGAATGGTATCATCATAGAATGGAATCAAATGGATTCATTGAATGGAATCAGATGGAATCATCCAATGGACTTGAATGGAATCATTGAATGTACTGGAATGGAATCATTATTGAATAGAATTGAATGGAATCATGGAATGGTCTCGAATGGTATCATTATGAAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAATGGAATTATCCTCAAATGGAATCAAATGGAATTATCGAATGCAATCGAATGGAATTATCGAATGCAATCGAATAGAATCATCGAATGGGCTCGATTGGAATTATCGAATGGAATTTAATGGAATAATTGAACGGAATTGAATCGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAAAGGAATGGAGTCATCGCATAGAATCGAATGGAATTATCATTGAATGGACTCGAATGGAATCAACATCAAACGGATTCAAACGGAATTATTGAATGGATTCGAAGAGTCATTGAATGACTCGAATGGAATCATCTAATAAAATGGAATCAAATAATCCATGGACTCGAATGCAATCATCATCGAATGGTATCGAATGGAATCATTCAATGGACTCGAATGCAATAATCATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCAGATGGAATCTAATGGAAACATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATTGAATGGAATTATCATCGAATTGACTCGAATGGAATCAACATCTAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGATTCGAATGCAATCATCATCGAATGGAATCAAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATTGAATGGAATCATCATCGGATGGAAACGAATGGAATCGTCATCGAATGGAATCGAATGGAATCATCAAATGGGATCAGATGGAATCATCATCAAATGGAATCGAATA	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATTGAGTGGAATCGAATGGAATCATGATCAAATGTAATCAAAAGTAATCATCATCCAATGGAATCAGAAATAACCATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGAAATCGAATGGAATCATCATCAATTGGAATCTAATGGAATCATTGAACAGAATTGAATGGAATCTTCATCGAATGAATTGAATGCAATCATCGAATGTTCTCGAATGCAATCATATTCAAATAGAATGGAATTTAATAATCGCATAAAATCGAATGAAATTATCATCGAATGGACTCGAATCGAATCAACATCAAATGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATCATCTAATGGATTGGAATGGAATAATCCATGGACACGAATGCAATCATCATCCAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCCTTGAACGGAATCGATTGGAATCATCATCGGATGGATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAGTAGAATTATGGAATGCAATCCAATGTGATCATCATCGAATGGACTCGAATGGAATCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAAGGAAAGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCCAATGAAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCAAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAATGAATGGTATCATCATAGAATGGAATCAAATGGATTCATTGAATGGAATCAGATGGAATCATCCAATGGACTTGAATGGAATCATTGAATGTACTGGAATGGAATCATTATTGAATAGAATTGAATGGAATCATGGAATGGTCTCGAATGGTATCATTATGAAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAATGGAATTATCCTCAAATGGAATCAAATGGAATTATCGAATGCAATCGAATGGAATTATCGAATGCAATCGAATAGAATCATCGAATGGGCTCGATTGGAATTATCGAATGGAATTTAATGGAATAATTGAACGGAATTGAATCGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAAAGGAATGGAGTCATCGCATAGAATCGAATGGAATTATCATTGAATGGACTCGAATGGAATCAACATCAAACGGATTCAAACGGAATTATTGAATGGATTCGAAGAGTCATTGAATGACTCGAATGGAATCATCTAATAAAATGGAATCAAATAATCCATGGACTCGAATGCAATCATCATCGAATGGTATCGAATGGAATCATTCAATGGACTCGAATGCAATAATCATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCAGATGGAATCTAATGGAAACATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATTGAATGGAATTATCATCGAATTGACTCGAATGGAATCAACATCTAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGATTCGAATGCAATCATCATCGAATGGAATCAAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATTGAATGGAATCATCATCGGATGGAAACGAATGGAATCGTCATCGAATGGAATCGAATGGAATCATCAAATGGGATCAGATGGAATCATCATCAAATGGAATCGAATA	AATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATTGAGTGGAATCGAATGGAATCATGATCAAATGTAATCAAAAGTAATCATCATCCAATGGAATCAGAAATAACCATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGAAATCGAATGGAATCATCATCAATTGGAATCTAATGGAATCATTGAACAGAATTGAATGGAATCTTCATCGAATGAATTGAATGCAATCATCGAATGTTCTCGAATGCAATCATATTCAAATAGAATGGAATTTAATAATCGCATAAAATCGAATGAAATTATCATCGAATGGACTCGAATCGAATCAACATCAAATGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATCATCTAATGGATTGGAATGGAATAATCCATGGACACGAATGCAATCATCATCCAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCCTTGAACGGAATCGATTGGAATCATCATCGGATGGATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAGTAGAATTATGGAATGCAATCCAATGTGATCATCATCGAATGGACTCGAATGGAATCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAAGGAAAGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCCAATGAAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCAAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAATGAATGGTATCATCATAGAATGGAATCAAATGGATTCATTGAATGGAATCAGATGGAATCATCCAATGGACTTGAATGGAATCATTGAATGTACTGGAATGGAATCATTATTGAATAGAATTGAATGGAATCATGGAATGGTCTCGAATGGTATCATTATGAAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAATGGAATTATCCTCAAATGGAATCAAATGGAATTATCGAATGCAATCGAATGGAATTATCGAATGCAATCGAATAGAATCATCGAATGGGCTCGATTGGAATTATCGAATGGAATTTAATGGAATAATTGAACGGAATTGAATCGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAAAGGAATGGAGTCATCGCATAGAATCGAATGGAATTATCATTGAATGGACTCGAATGGAATCAACATCAAACGGATTCAAACGGAATTATTGAATGGATTCGAAGAGTCATTGAATGACTCGAATGGAATCATCTAATAAAATGGAATCAAATAATCCATGGACTCGAATGCAATCATCATCGAATGGTATCGAATGGAATCATTCAATGGACTCGAATGCAATAATCATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCAGATGGAATCTAATGGAAACATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATTGAATGGAATTATCATCGAATTGACTCGAATGGAATCAACATCTAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGATTCGAATGCAATCATCATCGAATGGAATCAAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATTGAATGGAATCATCATCGGATGGAAACGAATGGAATCGTCATCGAATGGAATCGAATGGAATCATCAAATGGGATCAGATGGAATCATCATCAAATGGAATCGAATA																					163	.	6	129	.	0		TCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCAAACGGAAACAGATGGAATCATCATCAAATGGAATCGAGTAGAATTATGGAATGCAATCCAATGTGATCATCATCGAATGGTCTCGAATGGAATCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAAGGAATGGAATTATCATGAAATTGAAATGGATGGTCTCATCATCGAATGGATTCCAATGAAATCATCAAATGAAATTGATTGAAGTCATCATCAAATGGAATCAAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAATGAATGGAATCATCATAGAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCCAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATAGAATTCAATGGAATCATTGAATGGTCTCGAATGGAATCATTATCAAATGGAATCGAATGGAATCACCGACTAGAATCGAATGGAACAATCATCGAATGGACTCAAATGGAATTATCCTCAAATGGAATCAAATGGAATTATCGAATGCAATCGAATGGAATTATCGAATGCAATCGAATAGAATCATCGAATGGGCTCGAATGGAATCATCGAATGGAATGGAATGGAATAGACAATGCAATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATTGAGTGGAATCGAATGGAATCATGATCAAATGTAATCAAAAGTAATCATCATCCAATGGAATCAGAAATAACCATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGAAATCGAATGGAATCATCATCAATTGGAATCTAATGGAATCATTGAACAGAATTGAATGGAATCTTCATCGAATGAATTGAATGCAATCATCGAATGTTCTCGAATGCAATCATATTCAAATAGAATGGAATTTAATAATCGCATAAAATCGAATGAAATTATCATCGAATGGACTCGAATCGAATCAACATCAAATGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATCATCTAATGGATTGGAATGGAATAATCCATGGACACGAATGCAATCATCATCCAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCCTTGAACGGAATCGATTGGAATCATCATCGGATGGATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAGTAGAATTATGGAATGCAATCCAATGTGATCATCATCGAATGGACTCGAATGGAATCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAAGGAAAGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCCAATGAAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCAAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAATGAATGGTATCATCATAGAATGGAATCAAATGGATTCATTGAATGGAATCAGATGGAATCATCCAATGGACTTGAATGGAATCATTGAATGTACTGGAATGGAATCATTATTGAATAGAATTGAATGGAATCATGGAATGGTCTCGAATGGTATCATTATGAAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAATGGAATTATCCTCAAATGGAATCAAATGGAATTATCGAATGCAATCGAATGGAATTATCGAATGCAATCGAATAGAATCATCGAATGGGCTCGATTGGAATTATCGAATGGAATTTAATGGAATAATTGAACGGAATTGAATCGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAAAGGAATGGAGTCATCGCATAGAATCGAATGGAATTATCATTGAATGGACTCGAATGGAATCAACATCAAACGGATTCAAACGGAATTATTGAATGGATTCGAAGAGTCATTGAATGACTCGAATGGAATCATCTAATAAAATGGAATCAAATAATCCATGGACTCGAATGCAATCATCATCGAATGGTATCGAATGGAATCATTCAATGGACTCGAATGCAATAATCATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCAGATGGAATCTAATGGAAACATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATTGAATGGAATTATCATCGAATTGACTCGAATGGAATCAACATCTAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGATTCGAATGCAATCATCATCGAATGGAATCAAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATTGAATGGAATCATCATCGGATGGAAACGAATGGAATCGTCATCGAATGGAATCGAATGGAATCATCAAATGGGATCAGATGGAATCATCATCAAATGGAATCGAATA				intergenic_variant							13																																			MODIFIER	1	indel														.	ATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCAAACGGAAACAGATGGAATCATCATCAAATGGAATCGAGTAGAATTATGGAATGCAATCCAATGTGATCATCATCGAATGGTCTCGAATGGAATCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAAGGAATGGAATTATCATGAAATTGAAATGGATGGTCTCATCATCGAATGGATTCCAATGAAATCATCAAATGAAATTGATTGAAGTCATCATCAAATGGAATCAAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAATGAATGGAATCATCATAGAATGGAATCGAATGGATTCATTGAATGGAATCAGATGGAATCATCCAATGGACTTGAATGGAATCATTGAATGGACTCGAATGGAATCATTATTGAATAGAATTCAATGGAATCATTGAATGGTCTCGAATGGAATCATTATCAAATGGAATCGAATGGAATCACCGACTAGAATCGAATGGAACAATCATCGAATGGACTCAAATGGAATTATCCTCAAATGGAATCAAATGGAATTATCGAATGCAATCGAATGGAATTATCGAATGCAATCGAATAGAATCATCGAATGGGCTCGAATGGAATCATCGAATGGAATGGAATGGAATAGACAATGAATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATTGAGTGGAATCGAATGGAATCATGATCAAATGTAATCAAAAGTAATCATCATCCAATGGAATCAGAAATAACCATCATCAATTGGTATTGAATGGAATTGTCATCAAATGGAATTCAAAGGAATCATCATCAAATGGAACCGAATGGAATCCTCATTGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGAAATCGAATGGAATCATCATCAATTGGAATCTAATGGAATCATTGAACAGAATTGAATGGAATCTTCATCGAATGAATTGAATGCAATCATCGAATGTTCTCGAATGCAATCATATTCAAATAGAATGGAATTTAATAATCGCATAAAATCGAATGAAATTATCATCGAATGGACTCGAATCGAATCAACATCAAATGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATCATCTAATGGATTGGAATGGAATAATCCATGGACACGAATGCAATCATCATCCAATGGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCCTTGAACGGAATCGATTGGAATCATCATCGGATGGATACGAATGGAATCATCATTGAATGGAATCGAATGGAATCATCAAATGGAATCAGATGGAATCATCATCAAATGGAATCGAGTAGAATTATGGAATGCAATCCAATGTGATCATCATCGAATGGACTCGAATGGAATCATCATCCAATGGAAACTAATGGAATCAACATCGAATGGAATCGAATGGAAACACCATCGAATTGAAAGGAAAGGAATTATCATGAAATTGAAATGGATGGACTCATCATCGAATGGATTCCAATGAAATCATCGAATGAAATTGATTGAAATCATCATCAAATGGAATCAAATGGAATCATTGAATGGAATCGAATGGAATCATCATCAGATGGAAATGAATGGTATCATCATAGAATGGAATCAAATGGATTCATTGAATGGAATCAGATGGAATCATCCAATGGACTTGAATGGAATCATTGAATGTACTGGAATGGAATCATTATTGAATAGAATTGAATGGAATCATGGAATGGTCTCGAATGGTATCATTATGAAATGGAATCGAATGGAATCACCGAATAGAATCGAATGGAACAATCATCGAATGGACTCAAATGGAATTATCCTCAAATGGAATCAAATGGAATTATCGAATGCAATCGAATGGAATTATCGAATGCAATCGAATAGAATCATCGAATGGGCTCGATTGGAATTATCGAATGGAATTTAATGGAATAATTGAACGGAATTGAATCGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAAAGGAATGGAGTCATCGCATAGAATCGAATGGAATTATCATTGAATGGACTCGAATGGAATCAACATCAAACGGATTCAAACGGAATTATTGAATGGATTCGAAGAGTCATTGAATGACTCGAATGGAATCATCTAATAAAATGGAATCAAATAATCCATGGACTCGAATGCAATCATCATCGAATGGTATCGAATGGAATCATTCAATGGACTCGAATGCAATAATCATTGAACGGAATCGAATGGAATCATCATCAGATGGAAACGAATGGAATCATCATCGAATGGAAATGAAAGGAGTCATCATCTAATGGAATCGCATGGAATCATCATCAAATGGAATCGAATGGAATCATCATCAGATGGAATCTAATGGAAACATTGAACGGAATTGAATGGAATCGTCATCGAATGAATTGAATGCAATCATCGAATGGTCTCGAATGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATTGAATGGAATTATCATCGAATTGACTCGAATGGAATCAACATCTAACGGAATCAAACGGAATTATCGAATGGAATCGAAGAGAATCATCGAATGGACTCGAATGGAATCATCTAATGGAATGGAATGGAATAATCCATGGATTCGAATGCAATCATCATCGAATGGAATCAAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATTGAATGGAATCATCATCGGATGGAAACGAATGGAATCGTCATCGAATGGAATCGAATGGAATCATCAAATGGGATCAGATGGAATCATCATCAAATGGAATCGAATAG	.	.																					42597159
KSR1P1	0	.	GRCh37	10	42641878	42641879	+	3'Flank	INS	-	-	ATT	novel		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000446298		6	4	2	4	4	0	KSR1P1,downstream_gene_variant,,ENST00000446298,;	ATT	ENSG00000229485	ENST00000446298	Transcript	downstream_gene_variant							1	2879	-1	KSR1P1	HGNC	44977	processed_pseudogene	YES																												MODIFIER	1	insertion														.	TCT	.	.																					42641878
Unknown	0	.	GRCh37	10	43394732	43394733	+	IGR	INS	-	-	ACTTCAGA	rs56864780		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		ACTTCAGA				intergenic_variant						rs56864780	1																				0.1944	0.1628		0.0397	0.3002	0.0787										MODIFIER	1	insertion														.	AGA	.	.																					43394732
Unknown	0	.	GRCh37	10	43774132	43774133	+	IGR	INS	-	-	G	rs57778074		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		G				intergenic_variant						rs57778074	1																				0.7224	0.9697		1	0.999	1										MODIFIER	1	insertion														.	TTG	.	.																					43774132
CEP164P1	0	.	GRCh37	10	45546611	45546612	+	Intron	INS	-	-	T	rs869158529		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																n.411+14363dup			ENST00000456938		3	.	3	0	.	0	CEP164P1,intron_variant,,ENST00000456938,;CEP164P1,intron_variant,,ENST00000598522,;CEP164P1,intron_variant,,ENST00000599308,;CEP164P1,intron_variant,,ENST00000602156,;DUXAP4,upstream_gene_variant,,ENST00000603046,;	T	ENSG00000226937	ENST00000456938	Transcript	intron_variant,non_coding_transcript_variant						rs869158529	1		-1	CEP164P1	HGNC	44988	processed_transcript	YES										5/6																		MODIFIER	1	insertion														.	ACT	.	.																					45546611
SGMS1	259230	.	GRCh37	10	52288605	52288607	+	Intron	DEL	AGA	AGA	-	rs10549824		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AGA	AGA																c.-588-8926_-588-8924del			ENST00000361781		3	.	3	0	.	0	SGMS1,intron_variant,,ENST00000361781,NM_147156.3;SGMS1,intron_variant,,ENST00000429490,;SGMS1,intron_variant,,ENST00000608287,;SGMS1,intron_variant,,ENST00000609445,;	-	ENSG00000198964	ENST00000361781	Transcript	intron_variant						rs10549824	1		-1	SGMS1	HGNC	29799	protein_coding	YES	CCDS7240.1	ENSP00000354829		R4GNI5,D3DWC4,E6ZCI7	UPI000000D9FC	NM_147156.3				2/10			0.4009	0.1974		0.1081	0.2286	0.1074										MODIFIER	1	deletion														.	AGAGAA	.	.																					52288604
Unknown	0	.	GRCh37	10	57459545	57459545	+	IGR	DEL	A	A	-	rs11316730		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																					8	.	8	0	.	0		-				intergenic_variant						rs11316730	1																				0.3389	0.3617		0.4187	0.5139	0.3712										MODIFIER	1	deletion														.	TGAA	.	.																					57459544
Unknown	0	.	GRCh37	10	58985278	58985279	+	IGR	INS	-	-	TAAG	rs35353871		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		TAAG				intergenic_variant						rs35353871	1																				0.6188	0.3156		0.1895	0.3817	0.3885										MODIFIER	1	insertion														.	AAT	.	.																					58985278
Unknown	0	.	GRCh37	10	59003045	59003046	+	IGR	INS	-	-	CATTAAAT	rs71020969		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					4	.	4	0	.	0		CATTAAAT				intergenic_variant						rs71020969	1																				0.4463	0.1888		0.1885	0.1491	0.1871										MODIFIER	1	insertion														.	AAC	.	.																					59003045
Unknown	0	.	GRCh37	10	59409237	59409238	+	IGR	INS	-	-	AAC	rs71023769		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AAC				intergenic_variant						rs71023769	1																				0.1263	0.1311		0.0942	0.2386	0.1851										MODIFIER	1	insertion														.	CAA	.	.																					59409237
ARID5B	84159	.	GRCh37	10	63662433	63662434	+	Intron	DEL	TG	TG	-	rs59459790		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TG	TG																c.276+288_276+289del			ENST00000279873		3	.	3	0	.	0	ARID5B,intron_variant,,ENST00000279873,NM_032199.2;,regulatory_region_variant,,ENSR00000979015,;,TF_binding_site_variant,,ENSM00641569828,;	-	ENSG00000150347	ENST00000279873	Transcript	intron_variant						rs59459790	1		1	ARID5B	HGNC	17362	protein_coding	YES	CCDS31208.1	ENSP00000279873	Q14865		UPI00001606F0	NM_032199.2				2/9			0.3623	0.3934		0.2411	0.4264	0.319										MODIFIER	1	deletion													1	.	GATGT	.	.																					63662432
ANXA2P3	0	.	GRCh37	10	66588809	66588810	+	3'Flank	INS	-	-	T	rs5785659		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																			ENST00000404883		4	.	4	0	.	0	ANXA2P3,downstream_gene_variant,,ENST00000404883,;	T	ENSG00000216740	ENST00000404883	Transcript	downstream_gene_variant						rs5785659	1	2473	1	ANXA2P3	HGNC	540	processed_pseudogene	YES													0.9743	0.8458		0.8284	0.83	0.8967										MODIFIER	1	insertion														.	TGT	.	.																					66588809
Unknown	0	.	GRCh37	10	67082034	67082035	+	IGR	DEL	AG	AG	-	rs138369397		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	AG	AG																					4	.	4	0	.	0		-				intergenic_variant						rs138369397	1																			0.1120	0.0091	0.2421		0.1319	0.171	0.0777										MODIFIER	1	deletion														.	ACAGG	.	.																					67082033
Unknown	0	.	GRCh37	10	67544956	67544957	+	IGR	DEL	GA	GA	-	rs10567763		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GA	GA																					5	.	3	4	.	0		-				intergenic_variant						rs10567763	1																																			MODIFIER	1	deletion														.	GCGAG	.	.																					67544955
CTNNA3	29119	.	GRCh37	10	67917250	67917265	+	Intron	DEL	TAGATAGATAGATAGA	TAGATAGATAGATAGA	-	rs34507083		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	TAGATAGATAGATAGA	TAGATAGATAGATAGA																c.1885-54258_1885-54243del			ENST00000433211		4	.	4	0	.	0	CTNNA3,intron_variant,,ENST00000373744,NM_001127384.1;CTNNA3,intron_variant,,ENST00000433211,NM_013266.2;	-	ENSG00000183230	ENST00000433211	Transcript	intron_variant						rs34507083	1		-1	CTNNA3	HGNC	2511	protein_coding	YES	CCDS7269.1	ENSP00000389714	Q9UI47	Q5SW23,A6NKP0	UPI000004A0E6	NM_013266.2				13/17																		MODIFIER	1	deletion													1	.	TGTAGATAGATAGATAGAT	.	.																					67917249
MYPN	84665	.	GRCh37	10	69919449	69919449	+	Intron	DEL	A	A	-	rs36077235		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	A	A																c.1459+1065del			ENST00000358913		3	.	3	0	.	0	MYPN,intron_variant,,ENST00000354393,;MYPN,intron_variant,,ENST00000358913,NM_032578.3,NM_001256267.1;MYPN,intron_variant,,ENST00000373675,;MYPN,intron_variant,,ENST00000540630,;RN7SKP202,downstream_gene_variant,,ENST00000410439,;	-	ENSG00000138347	ENST00000358913	Transcript	intron_variant						rs36077235	1		1	MYPN	HGNC	23246	protein_coding	YES	CCDS7275.1	ENSP00000351790	Q86TC9	A5PKT7	UPI00002288CF	NM_032578.3,NM_001256267.1				7/19		0.5653	0.5371	0.719		0.3155	0.7008	0.6125										MODIFIER	1	deletion													1	.	TCAT	.	.																					69919448
SLC25A16	8034	.	GRCh37	10	70252644	70252644	+	Intron	DEL	G	-	-	rs201774649		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	G	G																c.610+245del			ENST00000609923		9	5	4	4	0	0	SLC25A16,intron_variant,,ENST00000539557,;SLC25A16,intron_variant,,ENST00000609923,NM_152707.3;SLC25A16,upstream_gene_variant,,ENST00000608053,;SLC25A16,intron_variant,,ENST00000265870,;SLC25A16,intron_variant,,ENST00000493963,;SLC25A16,downstream_gene_variant,,ENST00000474927,;,regulatory_region_variant,,ENSR00000980053,;	-	ENSG00000122912	ENST00000609923	Transcript	intron_variant						rs201774649	1		-1	SLC25A16	HGNC	10986	protein_coding	YES	CCDS7280.1	ENSP00000476815	P16260	B4DPV4	UPI00000704FB	NM_152707.3				6/8		0.0288	0.0045	0.036			0.0586	0.0552										MODIFIER	1	deletion														.	ACGT	.	.																					70252643
Unknown	0	.	GRCh37	10	72784203	72784204	+	IGR	INS	-	-	AAG	rs56345708		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	-	-																					3	.	3	0	.	0		AAG				intergenic_variant						rs56345708	1																				0.6785	0.7795		0.8552	0.7763	0.7362										MODIFIER	1	insertion														.	AAA	.	.																					72784203
PSAP	5660	.	GRCh37	10	73585325	73585338	+	Intron	DEL	GGCTGGCCTGAACG	GGCTGGCCTGAACG	-	rs145386313		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GGCTGGCCTGAACG	GGCTGGCCTGAACG																c.777+256_777+269del			ENST00000394936		4	.	4	0	.	0	PSAP,intron_variant,,ENST00000394934,NM_001042466.1,NM_001042465.1,NM_002778.2;PSAP,intron_variant,,ENST00000394936,;PSAP,upstream_gene_variant,,ENST00000493143,;,regulatory_region_variant,,ENSR00001523578,;	-	ENSG00000197746	ENST00000394936	Transcript	intron_variant						rs145386313	1		-1	PSAP	HGNC	9498	protein_coding	YES	CCDS7311.1	ENSP00000378394	P07602		UPI0000000DBF					7/13			0.0053	0.0159			0.0527	0.002										MODIFIER	1	deletion													1	.	ATGGCTGGCCTGAACGG	.	.																					73585324
ADK	132	.	GRCh37	10	76425495	76425504	+	Intron	DEL	GAGAGAGAGA	GAGAGAGAGA	-	rs59620474		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2LE-10A-01D-A17W-09	GAGAGAGAGA	GAGAGAGAGA																c.878-4410_878-4401del			ENST00000286621		3	.	3	0	.	0	ADK,intron_variant,,ENST00000286621,NM_006721.3;ADK,intron_variant,,ENST00000372734,NM_001123.3,NM_001202449.1;ADK,intron_variant,,ENST00000539909,NM_001202450.1;ADK,intron_variant,,ENST00000541550,;	-	ENSG00000156110	ENST00000286621	Transcript	intron_variant						rs59620474	1		1	ADK	HGNC	257	protein_coding	YES	CCDS7343.1	ENSP00000286621	P55263	Q9HB33	UPI00001255EA	NM_006721.3				9/10			0.6543	0.7176		0.9058	0.5596	0.8384										MODIFIER	1	deletion													1	.	TTGAGAGAGAGAG	.	.																					76425494
Unknown	0	.	GRCh37	10	78570867	78570868	+	IGR	INS	-	-	GT	rs56773029		TCGA-AR-A2LE-01A-11D-A17W-09	TCGA-AR-A2L