genome.wustl.edu.TCGA-A1-A0SD.indel.0e81f9c986154ce89e59240c3f09534f.vep.vcf 329 KB
Newer Older
Pradat Yoann's avatar
Pradat Yoann committed
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162
##fileformat=VCFv4.1
##source=VarscanSomatic-Strelka-Pindel-GatkSomaticIndel
##reference=ftp://ftp.ncbi.nih.gov/genbank/genomes/Eukaryotes/vertebrates_mammals/Homo_sapiens/GRCh37/special_requests/GRCh37-lite.fa.gz
##assembly=ftp://ftp.ncbi.nih.gov/genbank/genomes/Eukaryotes/vertebrates_mammals/Homo_sapiens/GRCh37/special_requests/GRCh37-lite.fa.gz
##phasing=none
##center=genome.wustl.edu
##tcgaversion=1.1
##vcfProcessLog=<InputVCFSource=<VarscanSomatic-Strelka-Pindel-GatkSomaticIndel>>
##FILTER=<ID=PASS,Description="Passed all filters">
##FILTER=<ID=VarscanHighConfidenceIndel,Description="Filter description">
##FILTER=<ID=FalseIndel,Description="Filter description">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read depth at this position in the sample">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Depth of reads supporting alleles 0/1/2/3...">
##FORMAT=<ID=DP4,Number=4,Type=Integer,Description="Number of high-quality ref-forward, ref-reverse, alt-forward and alt-reverse bases">
##FORMAT=<ID=BQ,Number=.,Type=Integer,Description="Average base quality for reads supporting alleles">
##FORMAT=<ID=SS,Number=1,Type=Integer,Description="Variant status relative to non-adjacent Normal,0=wildtype,1=germline,2=somatic,3=LOH,4=post-transcriptional modification,5=unknown">
##SAMPLE=<ID=TCGA-A1-A0SD-01A-11D-A10Y-09,SampleUUID=1847727f-ea57-4e2e-84e5-a10e764c9096,SampleTCGABarcode=TCGA-A1-A0SD-01A-11D-A10Y-09,File=TCGA-A1-A0SD-01A-11D-A10Y-09.bam,Platform=Illumina,Source=dbGap,Accession=phs000178>
##SAMPLE=<ID=TCGA-A1-A0SD-10A-01D-A110-09,SampleUUID=44ee7757-ca5e-4616-a3fc-5e30c8b6088c,SampleTCGABarcode=TCGA-A1-A0SD-10A-01D-A110-09,File=TCGA-A1-A0SD-10A-01D-A110-09.bam,Platform=Illumina,Source=dbGap,Accession=phs000178>
##FORMAT=<ID=FT,Number=1,Type=String,Description="Sample genotype filter">
##SAMPLE=<ID=TCGA-A1-A0SD-10A-01D-A110-09-[VarscanSomatic],SampleUUID=44ee7757-ca5e-4616-a3fc-5e30c8b6088c,SampleTCGABarcode=TCGA-A1-A0SD-10A-01D-A110-09,File=TCGA-A1-A0SD-10A-01D-A110-09.bam,Platform=Illumina,Source=dbGap,Accession=phs000178>
##SAMPLE=<ID=TCGA-A1-A0SD-01A-11D-A10Y-09-[VarscanSomatic],SampleUUID=1847727f-ea57-4e2e-84e5-a10e764c9096,SampleTCGABarcode=TCGA-A1-A0SD-01A-11D-A10Y-09,File=TCGA-A1-A0SD-01A-11D-A10Y-09.bam,Platform=Illumina,Source=dbGap,Accession=phs000178>
##FORMAT=<ID=DP2,Number=1,Type=Integer,Description="Read depth for tier2">
##FORMAT=<ID=TAR,Number=2,Type=Integer,Description="Reads strongly supporting alternate allele for tiers 1,2">
##FORMAT=<ID=TIR,Number=2,Type=Integer,Description="Reads strongly supporting indel allele for tiers 1,2">
##FORMAT=<ID=TOR,Number=2,Type=Integer,Description="Other reads (weak support or insufficient indel breakpoint overlap) for tiers 1,2">
##FORMAT=<ID=DP50,Number=1,Type=Float,Description="Average tier1 read depth within 50 bases">
##FORMAT=<ID=FDP50,Number=1,Type=Float,Description="Average tier1 number of basecalls filtered from original read depth within 50 bases">
##FORMAT=<ID=SUBDP50,Number=1,Type=Float,Description="Average number of reads below tier1 mapping quality threshold aligned across sites within 50 bases">
##INFO=<ID=QSI,Number=1,Type=Integer,Description="Quality score for any somatic variant, ie. for the ALT haplotype to be present at a significantly different frequency in the tumor and normal">
##INFO=<ID=TQSI,Number=1,Type=Integer,Description="Data tier used to compute QSI">
##INFO=<ID=NT,Number=1,Type=String,Description="Genotype of the normal in all data tiers, as used to classify somatic variants. One of {ref,het,hom,conflict}.">
##INFO=<ID=QSI_NT,Number=1,Type=Integer,Description="Quality score reflecting the joint probability of a somatic variant and NT">
##INFO=<ID=TQSI_NT,Number=1,Type=Integer,Description="Data tier used to compute QSI_NT">
##INFO=<ID=SGT,Number=1,Type=String,Description="Most likely somatic genotype excluding normal noise states">
##INFO=<ID=RU,Number=1,Type=String,Description="Smallest repeating sequence unit in inserted or deleted sequence">
##INFO=<ID=RC,Number=1,Type=Integer,Description="Number of times RU repeats in the reference allele">
##INFO=<ID=IC,Number=1,Type=Integer,Description="Number of times RU repeats in the indel allele">
##INFO=<ID=IHP,Number=1,Type=Integer,Description="Largest reference interupted homopolymer length intersecting with the indel">
##INFO=<ID=SVTYPE,Number=1,Type=String,Description="Type of structural variant">
##INFO=<ID=OVERLAP,Number=0,Type=Flag,Description="Somatic indel possibly overlaps a second indel.">
##FILTER=<ID=DP,Description="Greater than 3.0x chromosomal mean depth in Normal sample">
##FILTER=<ID=Repeat,Description="Sequence repeat of more than 8x in the reference sequence">
##FILTER=<ID=iHpol,Description="Indel overlaps an interupted homopolymer longer than 14x in the reference sequence">
##FILTER=<ID=BCNoise,Description="Average fraction of filtered basecalls within 50 bases of the indel exceeds 0.3">
##FILTER=<ID=QSI_ref,Description="Normal sample is not homozygous ref or sindel Q-score < 30, ie calls with NT!=ref or QSI_NT < 30">
##SAMPLE=<ID=TCGA-A1-A0SD-10A-01D-A110-09-[Strelka],SampleUUID=44ee7757-ca5e-4616-a3fc-5e30c8b6088c,SampleTCGABarcode=TCGA-A1-A0SD-10A-01D-A110-09,File=TCGA-A1-A0SD-10A-01D-A110-09.bam,Platform=Illumina,Source=dbGap,Accession=phs000178>
##SAMPLE=<ID=TCGA-A1-A0SD-01A-11D-A10Y-09-[Strelka],SampleUUID=1847727f-ea57-4e2e-84e5-a10e764c9096,SampleTCGABarcode=TCGA-A1-A0SD-01A-11D-A10Y-09,File=TCGA-A1-A0SD-01A-11D-A10Y-09.bam,Platform=Illumina,Source=dbGap,Accession=phs000178>
##FILTER=<ID=PindelSomaticCalls,Description="Filter description">
##FILTER=<ID=PindelVafFilter,Description="Filter description">
##FILTER=<ID=PindelReadSupport,Description="Filter description">
##INFO=<ID=END,Number=1,Type=Integer,Description="End position of the variant described in this record">
##INFO=<ID=HOMLEN,Number=.,Type=Integer,Description="Length of base pair identical micro-homology at event breakpoints">
##INFO=<ID=HOMSEQ,Number=.,Type=String,Description="Sequence of base pair identical micro-homology at event breakpoints">
##INFO=<ID=SVLEN,Number=.,Type=Integer,Description="Difference in length between REF and ALT alleles">
##INFO=<ID=NTLEN,Number=.,Type=Integer,Description="Number of bases inserted in place of deleted code">
##SAMPLE=<ID=TCGA-A1-A0SD-10A-01D-A110-09-[Pindel],SampleUUID=44ee7757-ca5e-4616-a3fc-5e30c8b6088c,SampleTCGABarcode=TCGA-A1-A0SD-10A-01D-A110-09,File=TCGA-A1-A0SD-10A-01D-A110-09.bam,Platform=Illumina,Source=dbGap,Accession=phs000178>
##SAMPLE=<ID=TCGA-A1-A0SD-01A-11D-A10Y-09-[Pindel],SampleUUID=1847727f-ea57-4e2e-84e5-a10e764c9096,SampleTCGABarcode=TCGA-A1-A0SD-01A-11D-A10Y-09,File=TCGA-A1-A0SD-01A-11D-A10Y-09.bam,Platform=Illumina,Source=dbGap,Accession=phs000178>
##SAMPLE=<ID=TCGA-A1-A0SD-10A-01D-A110-09-[GatkSomaticIndel],SampleUUID=44ee7757-ca5e-4616-a3fc-5e30c8b6088c,SampleTCGABarcode=TCGA-A1-A0SD-10A-01D-A110-09,File=TCGA-A1-A0SD-10A-01D-A110-09.bam,Platform=Illumina,Source=dbGap,Accession=phs000178>
##SAMPLE=<ID=TCGA-A1-A0SD-01A-11D-A10Y-09-[GatkSomaticIndel],SampleUUID=1847727f-ea57-4e2e-84e5-a10e764c9096,SampleTCGABarcode=TCGA-A1-A0SD-01A-11D-A10Y-09,File=TCGA-A1-A0SD-01A-11D-A10Y-09.bam,Platform=Illumina,Source=dbGap,Accession=phs000178>
##fileDate=20150530
##VEP="v101" time="2020-08-28 10:18:22" cache="/Users/ypradat/.vep/homo_sapiens/101_GRCh37" ensembl-io=101.943b6c2 ensembl-funcgen=101.b918a49 ensembl-variation=101.50e7372 ensembl=101.856c8e8 1000genomes="phase3" COSMIC="90" ClinVar="201912" ESP="20141103" HGMD-PUBLIC="20194" assembly="GRCh37.p13" dbSNP="153" gencode="GENCODE 19" genebuild="2011-04" gnomAD="r2.1" polyphen="2.2.2" regbuild="1.0" sift="sift5.2.2"
##INFO=<ID=CSQ,Number=.,Type=String,Description="Consequence annotations from Ensembl VEP. Format: Allele|Consequence|IMPACT|SYMBOL|Gene|Feature_type|Feature|BIOTYPE|EXON|INTRON|HGVSc|HGVSp|cDNA_position|CDS_position|Protein_position|Amino_acids|Codons|Existing_variation|ALLELE_NUM|DISTANCE|STRAND|FLAGS|PICK|VARIANT_CLASS|SYMBOL_SOURCE|HGNC_ID|CANONICAL|TSL|CCDS|ENSP|SWISSPROT|TREMBL|UNIPARC|RefSeq|GENE_PHENO|SIFT|PolyPhen|DOMAINS|HGVS_OFFSET|AF|AFR_AF|AMR_AF|EAS_AF|EUR_AF|SAS_AF|AA_AF|EA_AF|gnomAD_AF|gnomAD_AFR_AF|gnomAD_AMR_AF|gnomAD_ASJ_AF|gnomAD_EAS_AF|gnomAD_FIN_AF|gnomAD_NFE_AF|gnomAD_OTH_AF|gnomAD_SAS_AF|CLIN_SIG|SOMATIC|PHENO|PUBMED|MOTIF_NAME|MOTIF_POS|HIGH_INF_POS|MOTIF_SCORE_CHANGE|TRANSCRIPTION_FACTORS">
#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	TCGA-A1-A0SD-10A-01D-A110-09	TCGA-A1-A0SD-01A-11D-A10Y-09	TCGA-A1-A0SD-10A-01D-A110-09-[VarscanSomatic]	TCGA-A1-A0SD-01A-11D-A10Y-09-[VarscanSomatic]	TCGA-A1-A0SD-10A-01D-A110-09-[Strelka]	TCGA-A1-A0SD-01A-11D-A10Y-09-[Strelka]	TCGA-A1-A0SD-10A-01D-A110-09-[Pindel]	TCGA-A1-A0SD-01A-11D-A10Y-09-[Pindel]	TCGA-A1-A0SD-10A-01D-A110-09-[GatkSomaticIndel]	TCGA-A1-A0SD-01A-11D-A10Y-09-[GatkSomaticIndel]
1	24486218	.	T	TTTG	.	.	CSQ=TTG|intron_variant|MODIFIER|IFNLR1|ENSG00000185436|Transcript|ENST00000327535|protein_coding||4/6|ENST00000327535.1:c.511-96_511-95insCAA|||||||rs112101640|1||-1||1|insertion|HGNC|18584|YES||CCDS248.1|ENSP00000327824|Q8IU57|A4QPA4|UPI000004D3FC|NM_170743.3&NM_173064.2|||||||||||||||||||||||||||||||,TTG|intron_variant|MODIFIER|IFNLR1|ENSG00000185436|Transcript|ENST00000327575|protein_coding||4/5|ENST00000327575.2:c.511-96_511-95insCAA|||||||rs112101640|1||-1|||insertion|HGNC|18584|||CCDS250.1|ENSP00000328994|Q8IU57||UPI0000062354|NM_173065.2|||||||||||||||||||||||||||||||,TTG|downstream_gene_variant|MODIFIER|IFNLR1|ENSG00000185436|Transcript|ENST00000374418|protein_coding||||||||||rs112101640|1|1649|-1|||insertion|HGNC|18584||||ENSP00000363539|Q8IU57||UPI000004D3FD||||||||||||||||||||||||||||||||,TTG|intron_variant|MODIFIER|IFNLR1|ENSG00000185436|Transcript|ENST00000374419|protein_coding||4/5|ENST00000374419.1:c.262-96_262-95insCAA|||||||rs112101640|1||-1|||insertion|HGNC|18584||||ENSP00000363540||Q5VTX9|UPI0000458A97||||||||||||||||||||||||||||||||,TTG|intron_variant|MODIFIER|IFNLR1|ENSG00000185436|Transcript|ENST00000374421|protein_coding||4/6|ENST00000374421.3:c.511-96_511-95insCAA|||||||rs112101640|1||-1|||insertion|HGNC|18584|||CCDS249.1|ENSP00000363542|Q8IU57||UPI0000074104||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT	0/0:24:.,.,.,.:.:.:PASS	0/1:22:0,22,0,6:.:2:PASS	0/0:24:.,.,.,.:.:.:PASS	0/1:22:0,22,0,6:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.
1	27107272	.	CGT	C	.	.	CSQ=-|3_prime_UTR_variant|MODIFIER|ARID1A|ENSG00000117713|Transcript|ENST00000324856|protein_coding|20/20||ENST00000324856.7:c.*35_*36del||7255-7256/8577|||||rs1553153821|1||1||1|deletion|HGNC|11110|YES||CCDS285.1|ENSP00000320485|O14497|Q96T01&Q96SY8&Q96SM7&E9PQW6&C1KEN7&A4FU79|UPI0000167B91|NM_006015.4|1|||||||||||||4.576e-05|0|0|0|0|0|9.595e-05|0|0|||||||||,-|downstream_gene_variant|MODIFIER|ARID1A|ENSG00000117713|Transcript|ENST00000374152|protein_coding||||||||||rs1553153821|1|26|1|||deletion|HGNC|11110||||ENSP00000363267|O14497|Q96T01&Q96SY8&Q96SM7&E9PQW6&C1KEN7&A4FU79|UPI00019B21DC||1|||||||||||||4.576e-05|0|0|0|0|0|9.595e-05|0|0|||||||||,-|3_prime_UTR_variant|MODIFIER|ARID1A|ENSG00000117713|Transcript|ENST00000430799|protein_coding|9/9||ENST00000430799.2:c.*35_*36del||3573-3574/3978|||||rs1553153821|1||1|cds_start_NF||deletion|HGNC|11110||||ENSP00000390317||Q96T01&Q96SY8&Q96SM7&C1KEN7&A4FU79|UPI0001F7837D||1|||||||||||||4.576e-05|0|0|0|0|0|9.595e-05|0|0|||||||||,-|3_prime_UTR_variant|MODIFIER|ARID1A|ENSG00000117713|Transcript|ENST00000457599|protein_coding|20/20||ENST00000457599.2:c.*35_*36del||6233-6234/6268|||||rs1553153821|1||1|||deletion|HGNC|11110|||CCDS44091.1|ENSP00000387636|O14497|Q96T01&Q96SY8&Q96SM7&E9PQW6&A4FU79|UPI0000161967|NM_139135.2|1|||||||||||||4.576e-05|0|0|0|0|0|9.595e-05|0|0|||||||||,-|3_prime_UTR_variant&NMD_transcript_variant|MODIFIER|ARID1A|ENSG00000117713|Transcript|ENST00000466382|nonsense_mediated_decay|6/6||ENST00000466382.1:c.*1876_*1877del||2301-2302/2696|||||rs1553153821|1||1|cds_start_NF||deletion|HGNC|11110||||ENSP00000432368|||UPI0001F7837E||1|||||||||||||4.576e-05|0|0|0|0|0|9.595e-05|0|0|||||||||,-|3_prime_UTR_variant&NMD_transcript_variant|MODIFIER|ARID1A|ENSG00000117713|Transcript|ENST00000532781|nonsense_mediated_decay|4/4||ENST00000532781.1:c.*1825_*1826del||2382-2383/2583|||||rs1553153821|1||1|cds_start_NF||deletion|HGNC|11110||||ENSP00000436692|||UPI0001F7837F||1|||||||||||||4.576e-05|0|0|0|0|0|9.595e-05|0|0|||||||||,-|3_prime_UTR_variant|MODIFIER|ARID1A|ENSG00000117713|Transcript|ENST00000540690|protein_coding|6/6||ENST00000540690.1:c.*35_*36del||2301-2302/2678|||||rs1553153821|1||1|||deletion|HGNC|11110||||ENSP00000442437||Q96T01&Q96SY8&Q96SM7&A4FU79|UPI00000712BA||1|||||||||||||4.576e-05|0|0|0|0|0|9.595e-05|0|0|||||||||	GT:AD:BQ:SS:DP:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50:FT:DP4	0/0:0:.:.:26:30:21,21:0,0:9,9:29.5:0:0:PASS:.,.,.,.	0/1:4:.:2:18:23:14,14:3,3:6,6:21.17:0:0:PASS:4,14,2,1	0/0:.:.:.:26:.:.,.:.,.:.,.:.:.:.:FalseIndel:.,.,.,.	0/1:.:.:2:18:.:.,.:.,.:.,.:.:.:.:FalseIndel:4,14,2,1	0/0:21:.:.:30:30:21,21:0,0:9,9:29.5:0:0:QSI_ref:.,.,.,.	0/1:14:.:2:23:23:14,14:3,3:6,6:21.17:0:0:QSI_ref:.,.,.,.	0/0:0:.:.:.:.:.,.:.,.:.,.:.:.:.:PASS:.,.,.,.	0/1:4:.:2:.:.:.,.:.,.:.,.:.:.:.:PASS:.,.,.,.	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.:.,.,.,.
1	117122285	.	G	GTCC	.	.	CSQ=TCC|inframe_insertion|MODERATE|IGSF3|ENSG00000143061|Transcript|ENST00000318837|protein_coding|10/11||ENST00000318837.6:c.3122_3123insGGA|ENSP00000321184.6:p.Asp1040_Asp1041insGlu|3227-3228/3842|3122-3123/3645|1041/1214|D/ED|gac/gaGGAc|rs576658823&COSV59586221|1||-1|||insertion|HGNC|5950|||CCDS30814.1|ENSP00000321184|O75054||UPI0000140437||1|||Gene3D:2.60.40.10&Coiled-coils_(Ncoils):Coil&PROSITE_profiles:PS50835&PANTHER:PTHR12207&PANTHER:PTHR12207:SF21&SMART:SM00409&Low_complexity_(Seg):seg|||0.1528|0.3069|0.1022|0.4284|0.2873|||0.2555|0.122|0.2276|0.2791|0.1089|0.3553|0.2968|0.2783|0.2387||0&1|0&1||||||,TCC|inframe_insertion|MODERATE|IGSF3|ENSG00000143061|Transcript|ENST00000369483|protein_coding|11/12||ENST00000369483.1:c.3122_3123insGGA|ENSP00000358495.1:p.Asp1040_Asp1041insGlu|3827-3828/7253|3122-3123/3645|1041/1214|D/ED|gac/gaGGAc|rs576658823&COSV59586221|1||-1||1|insertion|HGNC|5950|YES||CCDS30814.1|ENSP00000358495|O75054||UPI0000140437|NM_001542.3|1|||Gene3D:2.60.40.10&Coiled-coils_(Ncoils):Coil&PROSITE_profiles:PS50835&PANTHER:PTHR12207&PANTHER:PTHR12207:SF21&SMART:SM00409&Low_complexity_(Seg):seg|||0.1528|0.3069|0.1022|0.4284|0.2873|||0.2555|0.122|0.2276|0.2791|0.1089|0.3553|0.2968|0.2783|0.2387||0&1|0&1||||||,TCC|inframe_insertion|MODERATE|IGSF3|ENSG00000143061|Transcript|ENST00000369486|protein_coding|10/11||ENST00000369486.3:c.3062_3063insGGA|ENSP00000358498.3:p.Asp1020_Asp1021insGlu|3828-3829/7254|3062-3063/3585|1021/1194|D/ED|gac/gaGGAc|rs576658823&COSV59586221|1||-1|||insertion|HGNC|5950|||CCDS30813.1|ENSP00000358498|O75054||UPI00003FEC88|NM_001007237.2|1|||Low_complexity_(Seg):seg&Coiled-coils_(Ncoils):Coil&PROSITE_profiles:PS50835&PANTHER:PTHR12207:SF21&PANTHER:PTHR12207&Gene3D:2.60.40.10&SMART:SM00409|||0.1528|0.3069|0.1022|0.4284|0.2873|||0.2555|0.122|0.2276|0.2791|0.1089|0.3553|0.2968|0.2783|0.2387||0&1|0&1||||||	GT:DP:DP4:BQ:SS:FT	0/0:8:.,.,.,.:.:.:PASS	0/1:16:4,12,1,6:.:2:PASS	0/0:8:.,.,.,.:.:.:PASS	0/1:16:4,12,1,6:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.
1	171607569	.	CAG	C	.	.	CSQ=-|intron_variant|MODIFIER|MYOC|ENSG00000034971|Transcript|ENST00000037502|protein_coding||2/2|ENST00000037502.6:c.730+166_730+167del|||||||rs144871239|1||-1||1|deletion|HGNC|7610|YES||CCDS1297.1|ENSP00000037502|Q99972|B4DV60|UPI00000012D6|NM_000261.1|1||||||0.0272|0.0043|0.0079|0.0099|0.0307||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50	0/0:15:.,.,.,.:0:.:PASS:12:15:12,12:0,0:3,3:15.17:0:0	0/1:11:10,1,3,1:39:2:PASS:7:11:7,7:4,4:0,0:9.99:0:0	0/0:15:.,.,.,.:.:.:PASS:.:.:.,.:.,.:.,.:.:.:.	0/1:11:10,1,3,1:.:2:PASS:.:.:.,.:.,.:.,.:.:.:.	0/0:15:.,.,.,.:.:.:QSI_ref:12:15:12,12:0,0:3,3:15.17:0:0	0/1:11:.,.,.,.:.:2:QSI_ref:7:11:7,7:4,4:0,0:9.99:0:0	./.:.:.,.,.,.:.:.:.:.:.:.,.:.,.:.,.:.:.:.	./.:.:.,.,.,.:.:.:.:.:.:.,.:.,.:.,.:.:.:.	0/0:15:12,3,0,0:0:.:PASS:.:.:.,.:.,.:.,.:.:.:.	0/1:11:7,0,3,1:39:2:PASS:.:.:.,.:.,.:.,.:.:.:.
1	175116046	.	C	CT,CTT	.	.	CSQ=T|intron_variant|MODIFIER|TNN|ENSG00000120332|Transcript|ENST00000239462|protein_coding||18/18|ENST00000239462.4:c.3760-6dup|||||||rs11450833|1||1||1|insertion|HGNC|22942|YES||CCDS30943.1|ENSP00000239462|Q9UQP3||UPI00001D7DA9|NM_022093.1|||||||0.4705|0.5014|0.4524|0.4751|0.4427|||0.4111|0.3869|0.4114|0.4089|0.3741|0.4684|0.4161|0.4104|0.362|||||||||,TT|intron_variant|MODIFIER|TNN|ENSG00000120332|Transcript|ENST00000239462|protein_coding||18/18|ENST00000239462.4:c.3760-7_3760-6dup|||||||rs11450833|2||1||1|insertion|HGNC|22942|YES||CCDS30943.1|ENSP00000239462|Q9UQP3||UPI00001D7DA9|NM_022093.1||||||||||||||0.04389|0.04394|0.04295|0.03114|0.04116|0.04203|0.04591|0.03989|0.04163|||||||||,T|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000255419|||||||||||rs11450833|1|||||insertion|||||||||||||||||0.4705|0.5014|0.4524|0.4751|0.4427|||0.4111|0.3869|0.4114|0.4089|0.3741|0.4684|0.4161|0.4104|0.362|||||||||,TT|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000255419|||||||||||rs11450833|2|||||insertion||||||||||||||||||||||||0.04389|0.04394|0.04295|0.03114|0.04116|0.04203|0.04591|0.03989|0.04163|||||||||,T|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001508420|||||||||||rs11450833|1|||||insertion|||||||||||||||||0.4705|0.5014|0.4524|0.4751|0.4427|||0.4111|0.3869|0.4114|0.4089|0.3741|0.4684|0.4161|0.4104|0.362|||||||||,TT|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001508420|||||||||||rs11450833|2|||||insertion||||||||||||||||||||||||0.04389|0.04394|0.04295|0.03114|0.04116|0.04203|0.04591|0.03989|0.04163|||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:38:.,.,.,.:.:.:PASS:0	0/2:56:57,2,11,1:.:2:PASS:7	0/1:38:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:56:57,2,11,1:.:1:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/2:.:.,.,.,.:.:2:PASS:7	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
1	201981005	.	C	CA	.	.	END=201981006;HOMLEN=17;HOMSEQ=AAAAAAAAAAAAAAAAA;SVLEN=1;CSQ=A|intron_variant|MODIFIER|ELF3|ENSG00000163435|Transcript|ENST00000359651|protein_coding||1/7|ENST00000359651.3:c.164-63dup|||||||rs1169377361|1||1||1|insertion|HGNC|3318|YES||CCDS1419.1|ENSP00000352673|P78545||UPI0000034E32||1||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|ELF3|ENSG00000163435|Transcript|ENST00000367283|protein_coding||2/8|ENST00000367283.3:c.164-63dup|||||||rs1169377361|1||1|||insertion|HGNC|3318|||CCDS1419.1|ENSP00000356252|P78545||UPI0000034E32||1||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|ELF3|ENSG00000163435|Transcript|ENST00000367284|protein_coding||2/8|ENST00000367284.5:c.164-63dup|||||||rs1169377361|1||1|||insertion|HGNC|3318|||CCDS1419.1|ENSP00000356253|P78545||UPI0000034E32|NM_004433.4&NM_001114309.1|1||||||||||||||||||||||||||||||,A|upstream_gene_variant|MODIFIER|RP11-465N4.4|ENSG00000234678|Transcript|ENST00000419190|antisense||||||||||rs1169377361|1|1524|-1|||insertion|Clone_based_vega_gene||YES||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|ELF3|ENSG00000163435|Transcript|ENST00000446188|protein_coding||2/6|ENST00000446188.1:c.158-63dup|||||||rs1169377361|1||1|cds_end_NF||insertion|HGNC|3318||||ENSP00000405162||Q5SR36|UPI0000470334||1||||||||||||||||||||||||||||||,A|upstream_gene_variant|MODIFIER|ELF3|ENSG00000163435|Transcript|ENST00000470384|processed_transcript||||||||||rs1169377361|1|567|1|||insertion|HGNC|3318|||||||||1||||||||||||||||||||||||||||||,A|upstream_gene_variant|MODIFIER|ELF3|ENSG00000163435|Transcript|ENST00000475698|processed_transcript||||||||||rs1169377361|1|1900|1|||insertion|HGNC|3318|||||||||1||||||||||||||||||||||||||||||,A|upstream_gene_variant|MODIFIER|ELF3|ENSG00000163435|Transcript|ENST00000479874|processed_transcript||||||||||rs1169377361|1|691|1|||insertion|HGNC|3318|||||||||1||||||||||||||||||||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|ELF3|ENSG00000163435|Transcript|ENST00000490203|processed_transcript||1/4|ENST00000490203.1:n.109-63dup|||||||rs1169377361|1||1|||insertion|HGNC|3318|||||||||1||||||||||||||||||||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|ELF3|ENSG00000163435|Transcript|ENST00000495848|processed_transcript||2/2|ENST00000495848.1:n.285-63dup|||||||rs1169377361|1||1|||insertion|HGNC|3318|||||||||1||||||||||||||||||||||||||||||,A|downstream_gene_variant|MODIFIER|ELF3|ENSG00000163435|Transcript|ENST00000498017|processed_transcript||||||||||rs1169377361|1|69|1|||insertion|HGNC|3318|||||||||1||||||||||||||||||||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|RP11-510N19.5|ENSG00000249007|Transcript|ENST00000504773|sense_intronic||1/1|ENST00000504773.1:n.215+310dup|||||||rs1169377361|1||1|||insertion|Clone_based_vega_gene||YES||||||||||||||||||||||||||||||||||||||,A|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000956492|||||||||||rs1169377361|1|||||insertion|||||||||||||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
1	223284687	.	G	GA	.	.	CSQ=A|frameshift_variant|HIGH|TLR5|ENSG00000187554|Transcript|ENST00000342210|protein_coding|4/4||ENST00000342210.6:c.1686dup|ENSP00000340089.6:p.Pro563SerfsTer2|2024-2025/3005|1686-1687/2577|562-563/858|-/X|-/T||1||-1|||insertion|HGNC|11851|||CCDS31033.1|ENSP00000340089|O60602|B1AZ06|UPI0000205D14||1|||Gene3D:3.80.10.10&PROSITE_profiles:PS51450&PANTHER:PTHR24365&PANTHER:PTHR24365:SF221&Superfamily:SSF52058|||||||||||||||||||||||||||,A|frameshift_variant|HIGH|TLR5|ENSG00000187554|Transcript|ENST00000366881|protein_coding|6/6||ENST00000366881.1:c.1686dup|ENSP00000355846.1:p.Pro563SerfsTer2|2327-2328/3368|1686-1687/2577|562-563/858|-/X|-/T||1||-1|||insertion|HGNC|11851|||CCDS31033.1|ENSP00000355846|O60602|B1AZ06|UPI0000205D14|NM_003268.5|1|||Gene3D:3.80.10.10&PROSITE_profiles:PS51450&PANTHER:PTHR24365&PANTHER:PTHR24365:SF221&Superfamily:SSF52058|||||||||||||||||||||||||||,A|downstream_gene_variant|MODIFIER|TLR5|ENSG00000187554|Transcript|ENST00000407096|protein_coding|||||||||||1|1622|-1|cds_end_NF||insertion|HGNC|11851||||ENSP00000385458||B1AZ06|UPI000046FFCB||1||||||||||||||||||||||||||||||,A|frameshift_variant|HIGH|TLR5|ENSG00000187554|Transcript|ENST00000540964|protein_coding|4/4||ENST00000540964.1:c.1686dup|ENSP00000440643.1:p.Pro563SerfsTer2|2148-2149/4088|1686-1687/2577|562-563/858|-/X|-/T||1||-1||1|insertion|HGNC|11851|YES||CCDS31033.1|ENSP00000440643|O60602|B1AZ06|UPI0000205D14||1|||Gene3D:3.80.10.10&PROSITE_profiles:PS51450&PANTHER:PTHR24365&PANTHER:PTHR24365:SF221&Superfamily:SSF52058|||||||||||||||||||||||||||,A|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001513547||||||||||||1|||||insertion|||||||||||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50	0/0:93:.,.,.,.:0:.:PASS:91:94:91,91:0,0:2,2:94.15:0.29:0	0/1:78:32,46,18,19:38:2:PASS:35:79:35,36:37,37:8,8:94.7:0:0	0/0:93:.,.,.,.:.:.:PASS:.:.:.,.:.,.:.,.:.:.:.	0/1:78:32,46,18,19:.:2:PASS:.:.:.,.:.,.:.,.:.:.:.	0/0:94:.,.,.,.:.:.:PASS:91:94:91,91:0,0:2,2:94.15:0.29:0	0/1:79:.,.,.,.:.:2:PASS:35:79:35,36:37,37:8,8:94.7:0:0	0/0:.:.,.,.,.:.:.:PASS:0:.:.,.:.,.:.,.:.:.:.	0/1:.:.,.,.,.:.:2:PASS:34:.:.,.:.,.:.,.:.:.:.	0/0:94:44,50,0,0:0:.:PASS:.:.:.,.:.,.:.,.:.:.:.	0/1:81:15,29,18,19:38:2:PASS:.:.:.,.:.,.:.,.:.:.:.
1	226553491	.	AAAC	A,AAACA	.	.	CSQ=-|intron_variant|MODIFIER|PARP1|ENSG00000143799|Transcript|ENST00000366794|protein_coding||18/22|ENST00000366794.5:c.2505+161_2505+163del|||||||rs200302262|1||-1||1|sequence_alteration|HGNC|270|YES||CCDS1554.1|ENSP00000355759|P09874|Q96P95|UPI000013D92D|NM_001618.3|1||||||||||||||||||||||||||||||,AACA|intron_variant|MODIFIER|PARP1|ENSG00000143799|Transcript|ENST00000366794|protein_coding||18/22|ENST00000366794.5:c.2505+160_2505+161insT|||||||rs11378196|2||-1||1|sequence_alteration|HGNC|270|YES||CCDS1554.1|ENSP00000355759|P09874|Q96P95|UPI000013D92D|NM_001618.3|1||||||0.907|0.647|0.5476|0.8459|0.8937||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|PARP1|ENSG00000143799|Transcript|ENST00000463968|processed_transcript||||||||||rs200302262|1|1419|-1|||sequence_alteration|HGNC|270|||||||||1||||||||||||||||||||||||||||||,AACA|upstream_gene_variant|MODIFIER|PARP1|ENSG00000143799|Transcript|ENST00000463968|processed_transcript||||||||||rs11378196|2|1419|-1|||sequence_alteration|HGNC|270|||||||||1||||||0.907|0.647|0.5476|0.8459|0.8937||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|PARP1|ENSG00000143799|Transcript|ENST00000468608|processed_transcript||||||||||rs200302262|1|2631|-1|||sequence_alteration|HGNC|270|||||||||1||||||||||||||||||||||||||||||,AACA|upstream_gene_variant|MODIFIER|PARP1|ENSG00000143799|Transcript|ENST00000468608|processed_transcript||||||||||rs11378196|2|2631|-1|||sequence_alteration|HGNC|270|||||||||1||||||0.907|0.647|0.5476|0.8459|0.8937||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|PARP1|ENSG00000143799|Transcript|ENST00000490921|processed_transcript||3/7|ENST00000490921.1:n.2460+161_2460+163del|||||||rs200302262|1||-1|||sequence_alteration|HGNC|270|||||||||1||||||||||||||||||||||||||||||,AACA|intron_variant&non_coding_transcript_variant|MODIFIER|PARP1|ENSG00000143799|Transcript|ENST00000490921|processed_transcript||3/7|ENST00000490921.1:n.2460+160_2460+161insT|||||||rs11378196|2||-1|||sequence_alteration|HGNC|270|||||||||1||||||0.907|0.647|0.5476|0.8459|0.8937||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|PARP1|ENSG00000143799|Transcript|ENST00000491816|processed_transcript||||||||||rs200302262|1|3539|-1|||sequence_alteration|HGNC|270|||||||||1||||||||||||||||||||||||||||||,AACA|upstream_gene_variant|MODIFIER|PARP1|ENSG00000143799|Transcript|ENST00000491816|processed_transcript||||||||||rs11378196|2|3539|-1|||sequence_alteration|HGNC|270|||||||||1||||||0.907|0.647|0.5476|0.8459|0.8937||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|PARP1|ENSG00000143799|Transcript|ENST00000498787|processed_transcript||4/4|ENST00000498787.1:n.561+161_561+163del|||||||rs200302262|1||-1|||sequence_alteration|HGNC|270|||||||||1||||||||||||||||||||||||||||||,AACA|intron_variant&non_coding_transcript_variant|MODIFIER|PARP1|ENSG00000143799|Transcript|ENST00000498787|processed_transcript||4/4|ENST00000498787.1:n.561+160_561+161insT|||||||rs11378196|2||-1|||sequence_alteration|HGNC|270|||||||||1||||||0.907|0.647|0.5476|0.8459|0.8937||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT	0/0:12:12,0,0,0:0:.:PASS	0/1:9:4,0,5,0:39:2:PASS	2/2:12:.,.,.,.:.:.:VarscanHighConfidenceIndel	0/2:3:2,0,2,0:.:1:VarscanHighConfidenceIndel	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	0/0:12:12,0,0,0:0:.:PASS	0/1:9:4,0,5,0:39:2:PASS
2	11273407	.	GTC	G,GTCTC	.	.	CSQ=-|5_prime_UTR_variant|MODIFIER|C2orf50|ENSG00000150873|Transcript|ENST00000381585|protein_coding|1/3||ENST00000381585.3:c.-53_-52del||230-231/2684|||||rs57490327|1||1||1|sequence_alteration|HGNC|26324|YES||CCDS1678.1|ENSP00000370997|Q96LR7||UPI000006ECF0||||||||||||||||||||||||||||||||,TCTC|5_prime_UTR_variant|MODIFIER|C2orf50|ENSG00000150873|Transcript|ENST00000381585|protein_coding|1/3||ENST00000381585.3:c.-53_-52dup||230-231/2684|||||rs57490327|2||1||1|sequence_alteration|HGNC|26324|YES||CCDS1678.1|ENSP00000370997|Q96LR7||UPI000006ECF0||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000396164|lincRNA||||||||||rs57490327|1|1106|-1|||sequence_alteration|Clone_based_vega_gene||YES||||||||||||||||||||||||||||||||||||||,TCTC|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000396164|lincRNA||||||||||rs57490327|2|1106|-1|||sequence_alteration|Clone_based_vega_gene||YES||||||||||||||||||||||||||||||||||||||,-|5_prime_UTR_variant|MODIFIER|C2orf50|ENSG00000150873|Transcript|ENST00000405022|protein_coding|1/4||ENST00000405022.3:c.-53_-52del||154-155/980|||||rs57490327|1||1|||sequence_alteration|HGNC|26324|||CCDS1678.1|ENSP00000384186|Q96LR7||UPI000006ECF0|NM_182500.2|||||||||||||||||||||||||||||||,TCTC|5_prime_UTR_variant|MODIFIER|C2orf50|ENSG00000150873|Transcript|ENST00000405022|protein_coding|1/4||ENST00000405022.3:c.-53_-52dup||154-155/980|||||rs57490327|2||1|||sequence_alteration|HGNC|26324|||CCDS1678.1|ENSP00000384186|Q96LR7||UPI000006ECF0|NM_182500.2|||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000417697|lincRNA||||||||||rs57490327|1|1106|-1|||sequence_alteration|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,TCTC|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000417697|lincRNA||||||||||rs57490327|2|1106|-1|||sequence_alteration|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000447433|lincRNA||||||||||rs57490327|1|512|-1|||sequence_alteration|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,TCTC|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000447433|lincRNA||||||||||rs57490327|2|512|-1|||sequence_alteration|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000536743|lincRNA||||||||||rs57490327|1|1106|-1|||sequence_alteration|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,TCTC|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000536743|lincRNA||||||||||rs57490327|2|1106|-1|||sequence_alteration|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000544306|lincRNA||||||||||rs57490327|1|1061|-1|||sequence_alteration|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,TCTC|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000544306|lincRNA||||||||||rs57490327|2|1061|-1|||sequence_alteration|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000590207|lincRNA||||||||||rs57490327|1|1174|-1|||sequence_alteration|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,TCTC|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000590207|lincRNA||||||||||rs57490327|2|1174|-1|||sequence_alteration|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000590373|lincRNA||||||||||rs57490327|1|461|-1|||sequence_alteration|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,TCTC|upstream_gene_variant|MODIFIER|AC062028.1|ENSG00000145063|Transcript|ENST00000590373|lincRNA||||||||||rs57490327|2|461|-1|||sequence_alteration|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000112861|||||||||||rs57490327|1|||||sequence_alteration|||||||||||||||||||||||||||||||||||||||||,TCTC|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000112861|||||||||||rs57490327|2|||||sequence_alteration|||||||||||||||||||||||||||||||||||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001168258|||||||||||rs57490327|1|||||sequence_alteration|||||||||||||||||||||||||||||||||||||||||,TCTC|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001168258|||||||||||rs57490327|2|||||sequence_alteration|||||||||||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:9:.,.,.,.:.:.:PASS:0	0/2:23:24,2,7,1:.:2:PASS:4	0/1:9:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/2:23:24,2,7,1:.:5:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/2:.:.,.,.,.:.:2:PASS:4	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
2	42996759	.	AAGAG	A	.	.	CSQ=-|intron_variant|MODIFIER|HAAO|ENSG00000162882|Transcript|ENST00000294973|protein_coding||7/9|ENST00000294973.6:c.630+90_630+93del|||||||rs10535571|1||-1||1|deletion|HGNC|4796|YES||CCDS33187.1|ENSP00000294973|P46952|C9IY88|UPI000007068E|NM_012205.2|1||||||0.857|0.8617|0.6815|0.7137|0.8855||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|HAAO|ENSG00000162882|Transcript|ENST00000402698|retained_intron||6/8|ENST00000402698.2:n.974+90_974+93del|||||||rs10535571|1||-1|||deletion|HGNC|4796|||||||||1||||||0.857|0.8617|0.6815|0.7137|0.8855||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|HAAO|ENSG00000162882|Transcript|ENST00000404451|retained_intron||5/5|ENST00000404451.3:n.389+520_389+523del|||||||rs10535571|1||-1|||deletion|HGNC|4796|||||||||1||||||0.857|0.8617|0.6815|0.7137|0.8855||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|HAAO|ENSG00000162882|Transcript|ENST00000406007|retained_intron||1/3|ENST00000406007.2:n.181+90_181+93del|||||||rs10535571|1||-1|||deletion|HGNC|4796|||||||||1||||||0.857|0.8617|0.6815|0.7137|0.8855||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|HAAO|ENSG00000162882|Transcript|ENST00000406924|retained_intron||||||||||rs10535571|1|264|-1|||deletion|HGNC|4796|||||||||1||||||0.857|0.8617|0.6815|0.7137|0.8855||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|HAAO|ENSG00000162882|Transcript|ENST00000431905|protein_coding||||||||||rs10535571|1|88|-1|cds_end_NF||deletion|HGNC|4796||||ENSP00000412601||C9IY88|UPI000188158B||1||||||0.857|0.8617|0.6815|0.7137|0.8855||||||||||||||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001618902|||||||||||rs10535571|1|||||deletion|||||||||||||||||0.857|0.8617|0.6815|0.7137|0.8855||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT	0/0:5:.,.,.,.:.:.:PASS	0/1:11:11,0,7,0:.:2:PASS	0/0:5:.,.,.,.:.:.:PASS	0/1:11:11,0,7,0:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.
2	55181022	.	TA	TAA,T	.	.	CSQ=AA|intron_variant|MODIFIER|EML6|ENSG00000214595|Transcript|ENST00000356458|protein_coding||30/40|ENST00000356458.6:c.4313-97dup|||||||rs34371058|1||1||1|sequence_alteration|HGNC|35412|YES||CCDS46286.1|ENSP00000348842|Q6ZMW3||UPI00006C0432|NM_001039753.2|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|EML6|ENSG00000214595|Transcript|ENST00000356458|protein_coding||30/40|ENST00000356458.6:c.4313-97del|||||||rs34371058|2||1||1|sequence_alteration|HGNC|35412|YES||CCDS46286.1|ENSP00000348842|Q6ZMW3||UPI00006C0432|NM_001039753.2|||||||||||||||||||||||||||||||,AA|intron_variant&non_coding_transcript_variant|MODIFIER|EML6|ENSG00000214595|Transcript|ENST00000481376|processed_transcript||3/6|ENST00000481376.3:n.309-97dup|||||||rs34371058|1||1|||sequence_alteration|HGNC|35412|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|EML6|ENSG00000214595|Transcript|ENST00000481376|processed_transcript||3/6|ENST00000481376.3:n.309-97del|||||||rs34371058|2||1|||sequence_alteration|HGNC|35412|||||||||||||||||||||||||||||||||||||||,AA|upstream_gene_variant|MODIFIER|EML6|ENSG00000214595|Transcript|ENST00000490828|processed_transcript||||||||||rs34371058|1|148|1|||sequence_alteration|HGNC|35412|||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|EML6|ENSG00000214595|Transcript|ENST00000490828|processed_transcript||||||||||rs34371058|2|148|1|||sequence_alteration|HGNC|35412|||||||||||||||||||||||||||||||||||||||,AA|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001177453|||||||||||rs34371058|1|||||sequence_alteration|||||||||||||||||||||||||||||||||||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001177453|||||||||||rs34371058|2|||||sequence_alteration|||||||||||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:20:.,.,.,.:.:.:PASS:0	0/2:20:25,0,4,0:.:2:PASS:3	0/1:20:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/2:20:25,0,4,0:.:5:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/2:.:.,.,.,.:.:2:PASS:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
2	153471255	.	T	TCAAAA,TCAAAACAAAACAAAACAAAA	.	.	CSQ=CAAAA|intron_variant|MODIFIER|FMNL2|ENSG00000157827|Transcript|ENST00000288670|protein_coding||11/25|ENST00000288670.9:c.1063-89_1063-85dup|||||||rs70974877|1||1||1|insertion|HGNC|18267|YES||CCDS46429.1|ENSP00000288670|Q96PY5|B3KT32|UPI0000441EF9|NM_052905.3|||||||0.3495|0.1369|0.2302|0.166|0.2045||||||||||||||||||||,CAAAACAAAACAAAACAAAA|intron_variant|MODIFIER|FMNL2|ENSG00000157827|Transcript|ENST00000288670|protein_coding||11/25|ENST00000288670.9:c.1063-104_1063-85dup|||||||rs70974877|2||1||1|insertion|HGNC|18267|YES||CCDS46429.1|ENSP00000288670|Q96PY5|B3KT32|UPI0000441EF9|NM_052905.3|||||||0.0915|0.2378|0.0288|0.16|0.2127||||||||||||||||||||,CAAAA|upstream_gene_variant|MODIFIER|FMNL2|ENSG00000157827|Transcript|ENST00000475377|protein_coding||||||||||rs70974877|1|4836|1|||insertion|HGNC|18267||||ENSP00000418959||C9IZY8|UPI0000E07AC2||||||||0.3495|0.1369|0.2302|0.166|0.2045||||||||||||||||||||,CAAAACAAAACAAAACAAAA|upstream_gene_variant|MODIFIER|FMNL2|ENSG00000157827|Transcript|ENST00000475377|protein_coding||||||||||rs70974877|2|4836|1|||insertion|HGNC|18267||||ENSP00000418959||C9IZY8|UPI0000E07AC2||||||||0.0915|0.2378|0.0288|0.16|0.2127||||||||||||||||||||,CAAAA|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001628977|||||||||||rs70974877|1|||||insertion|||||||||||||||||0.3495|0.1369|0.2302|0.166|0.2045||||||||||||||||||||,CAAAACAAAACAAAACAAAA|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001628977|||||||||||rs70974877|2|||||insertion|||||||||||||||||0.0915|0.2378|0.0288|0.16|0.2127||||||||||||||||||||	GT:AD:DP:BQ:SS:FT:DP4	0/0:0:8:.:.:PASS:.,.,.,.	0/2:4:8:.:2:PASS:8,0,3,0	0/1:.:8:.:.:VarscanHighConfidenceIndel:.,.,.,.	0/1:.:8:.:1:VarscanHighConfidenceIndel:8,0,3,0	./.:.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.,.,.	0/0:0:.:.:.:PASS:.,.,.,.	0/2:4:.:.:2:PASS:.,.,.,.	./.:.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.,.,.
2	176988290	.	C	CGCA	.	.	END=176988291;HOMLEN=12;HOMSEQ=GCAGCAGCAGCA;SVLEN=3;CSQ=GCA|inframe_insertion|MODERATE|HOXD9|ENSG00000128709|Transcript|ENST00000249499|protein_coding|1/2||ENST00000249499.6:c.804_806dup|ENSP00000249499.6:p.Gln269dup|1203-1204/2418|794-795/1059|265/352|P/PQ|ccg/ccGCAg|rs56007470&COSV50893605|1||1||1|insertion|HGNC|5140|YES||CCDS2267.2|ENSP00000249499|P28356||UPI000004A10E|NM_014213.3||||PIRSF:PIRSF037109&PANTHER:PTHR24326&PANTHER:PTHR24326:SF113&Low_complexity_(Seg):seg|12||0.0514|0.5331|0.3919|0.4046|0.4642|0.1061|0.3821|0.3932|0.08464|0.6124|0.273|0.3863|0.4835|0.3688|0.3912|0.4562||0&1|0&1||||||,GCA|downstream_gene_variant|MODIFIER|HOXD10|ENSG00000128710|Transcript|ENST00000249501|protein_coding||||||||||rs56007470&COSV50893605|1|3620|1|||insertion|HGNC|5133|YES||CCDS2266.1|ENSP00000249501|P28358||UPI000013CC87|NM_002148.3|1||||||0.0514|0.5331|0.3919|0.4046|0.4642|0.1061|0.3821|0.3932|0.08464|0.6124|0.273|0.3863|0.4835|0.3688|0.3912|0.4562||0&1|0&1||||||,GCA|intron_variant&non_coding_transcript_variant|MODIFIER|HOXD-AS2|ENSG00000237380|Transcript|ENST00000440016|antisense||2/3|ENST00000440016.2:n.498-1121_498-1119dup|||||||rs56007470&COSV50893605|1||-1|||insertion|HGNC|43756|YES||||||||||||||0.0514|0.5331|0.3919|0.4046|0.4642|0.1061|0.3821|0.3932|0.08464|0.6124|0.273|0.3863|0.4835|0.3688|0.3912|0.4562||0&1|0&1||||||,GCA|downstream_gene_variant|MODIFIER|HOXD10|ENSG00000128710|Transcript|ENST00000490088|processed_transcript||||||||||rs56007470&COSV50893605|1|4168|1|||insertion|HGNC|5133|||||||||1||||||0.0514|0.5331|0.3919|0.4046|0.4642|0.1061|0.3821|0.3932|0.08464|0.6124|0.273|0.3863|0.4835|0.3688|0.3912|0.4562||0&1|0&1||||||,GCA|downstream_gene_variant|MODIFIER|HOXD10|ENSG00000128710|Transcript|ENST00000549469|processed_transcript||||||||||rs56007470&COSV50893605|1|4319|1|||insertion|HGNC|5133|||||||||1||||||0.0514|0.5331|0.3919|0.4046|0.4642|0.1061|0.3821|0.3932|0.08464|0.6124|0.273|0.3863|0.4835|0.3688|0.3912|0.4562||0&1|0&1||||||,GCA|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001200315|||||||||||rs56007470&COSV50893605|1|||||insertion|||||||||||||||||0.0514|0.5331|0.3919|0.4046|0.4642|0.1061|0.3821|0.3932|0.08464|0.6124|0.273|0.3863|0.4835|0.3688|0.3912|0.4562||0&1|0&1||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:12:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:12:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
3	38355176	.	T	TGCGCGCGCGCGC,TGCGCGCGTGTGTGTGTGTGTGTGCGCGC	.	.	CSQ=GCGCGCGCGCGC|intron_variant|MODIFIER|SLC22A14|ENSG00000144671|Transcript|ENST00000273173|protein_coding||6/9|ENST00000273173.4:c.1164-35_1164-34insCGCGCGCGCGCG|||||||rs1553644857|1||1||1|insertion|HGNC|8495|YES||CCDS2677.1|ENSP00000273173|Q9Y267|F5H7H1|UPI00001AE9A8|NM_004803.3|||||||||||||||||||||||||||||||,GCGCGCGTGTGTGTGTGTGTGTGCGCGC|intron_variant|MODIFIER|SLC22A14|ENSG00000144671|Transcript|ENST00000273173|protein_coding||6/9|ENST00000273173.4:c.1164-31_1164-30insTGTGTGTGTGTGCGCGCGCGCGCGTGTG||||||||2||1||1|insertion|HGNC|8495|YES||CCDS2677.1|ENSP00000273173|Q9Y267|F5H7H1|UPI00001AE9A8|NM_004803.3|||||||||||||||||||||||||||||||,GCGCGCGCGCGC|intron_variant|MODIFIER|SLC22A14|ENSG00000144671|Transcript|ENST00000448498|protein_coding||7/10|ENST00000448498.1:c.1164-35_1164-34insCGCGCGCGCGCG|||||||rs1553644857|1||1|||insertion|HGNC|8495|||CCDS2677.1|ENSP00000396283|Q9Y267|F5H7H1|UPI00001AE9A8||||||||||||||||||||||||||||||||,GCGCGCGTGTGTGTGTGTGTGTGCGCGC|intron_variant|MODIFIER|SLC22A14|ENSG00000144671|Transcript|ENST00000448498|protein_coding||7/10|ENST00000448498.1:c.1164-31_1164-30insTGTGTGTGTGTGCGCGCGCGCGCGTGTG||||||||2||1|||insertion|HGNC|8495|||CCDS2677.1|ENSP00000396283|Q9Y267|F5H7H1|UPI00001AE9A8||||||||||||||||||||||||||||||||,GCGCGCGCGCGC|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001657319|||||||||||rs1553644857|1|||||insertion|||||||||||||||||||||||||||||||||||||||||,GCGCGCGTGTGTGTGTGTGTGTGCGCGC|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001657319||||||||||||2|||||insertion|||||||||||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:20:.,.,.,.:.:.:PASS:1	0/1:18:18,2,5,0:.:2:PASS:8	0/0:20:.,.,.,.:.:.:PASS:.	0/1:18:18,2,5,0:.:2:PASS:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/1:.:.,.,.,.:.:.:PindelSomaticCalls:1	0/1:.:.,.,.,.:.:2:PindelSomaticCalls:8	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
3	148711906	.	G	GT	.	.	CSQ=T|intron_variant|MODIFIER|GYG1|ENSG00000163754|Transcript|ENST00000296048|protein_coding||1/6|ENST00000296048.6:c.8-13dup|||||||rs368468774|1||1|||insertion|HGNC|4699|||CCDS54654.1|ENSP00000296048|P46976|Q8N5Y3&C9J8R8&C9J7C7|UPI0000035D46|NM_001184720.1|1|||||||||||0.07009|0.03901|0.01383|0.05858|0.01353|0.008938|0.01076|0.003844|0.01108|0.01578|0.01096|||||||||,T|intron_variant|MODIFIER|GYG1|ENSG00000163754|Transcript|ENST00000345003|protein_coding||1/7|ENST00000345003.4:c.8-13dup|||||||rs368468774|1||1||1|insertion|HGNC|4699|YES||CCDS3139.1|ENSP00000340736|P46976|C9J8R8&C9J7C7|UPI000014176C|NM_004130.3|1|||||||||||0.07009|0.03901|0.01383|0.05858|0.01353|0.008938|0.01076|0.003844|0.01108|0.01578|0.01096|||||||||,T|intron_variant|MODIFIER|GYG1|ENSG00000163754|Transcript|ENST00000461191|protein_coding||1/5|ENST00000461191.1:c.8-13dup|||||||rs368468774|1||1|cds_end_NF||insertion|HGNC|4699||||ENSP00000420247||C9JQ42&C9J8R8&C9J7C7|UPI0001B796BA||1|||||||||||0.07009|0.03901|0.01383|0.05858|0.01353|0.008938|0.01076|0.003844|0.01108|0.01578|0.01096|||||||||,T|upstream_gene_variant|MODIFIER|GYG1|ENSG00000163754|Transcript|ENST00000465547|processed_transcript||||||||||rs368468774|1|92|1|||insertion|HGNC|4699|||||||||1|||||||||||0.07009|0.03901|0.01383|0.05858|0.01353|0.008938|0.01076|0.003844|0.01108|0.01578|0.01096|||||||||,T|intron_variant|MODIFIER|GYG1|ENSG00000163754|Transcript|ENST00000473005|protein_coding||1/2|ENST00000473005.1:c.-131-13dup|||||||rs368468774|1||1|cds_end_NF||insertion|HGNC|4699||||ENSP00000417671||C9J8R8|UPI0001B796BB||1|||||||||||0.07009|0.03901|0.01383|0.05858|0.01353|0.008938|0.01076|0.003844|0.01108|0.01578|0.01096|||||||||,T|intron_variant&non_coding_transcript_variant|MODIFIER|GYG1|ENSG00000163754|Transcript|ENST00000478067|processed_transcript||1/3|ENST00000478067.1:n.109-13dup|||||||rs368468774|1||1|||insertion|HGNC|4699|||||||||1|||||||||||0.07009|0.03901|0.01383|0.05858|0.01353|0.008938|0.01076|0.003844|0.01108|0.01578|0.01096|||||||||,T|intron_variant|MODIFIER|GYG1|ENSG00000163754|Transcript|ENST00000483267|protein_coding||1/4|ENST00000483267.1:c.8-13dup|||||||rs368468774|1||1|||insertion|HGNC|4699||||ENSP00000419499||G5E9W8&C9J8R8&C9J7C7|UPI0000412BE9||1|||||||||||0.07009|0.03901|0.01383|0.05858|0.01353|0.008938|0.01076|0.003844|0.01108|0.01578|0.01096|||||||||,T|intron_variant|MODIFIER|GYG1|ENSG00000163754|Transcript|ENST00000484197|protein_coding||1/5|ENST00000484197.1:c.8-13dup|||||||rs368468774|1||1|||insertion|HGNC|4699|||CCDS54655.1|ENSP00000420683|P46976|C9J8R8&C9J7C7|UPI000016A9BF|NM_001184721.1|1|||||||||||0.07009|0.03901|0.01383|0.05858|0.01353|0.008938|0.01076|0.003844|0.01108|0.01578|0.01096|||||||||,T|intron_variant|MODIFIER|GYG1|ENSG00000163754|Transcript|ENST00000492285|protein_coding||2/4|ENST00000492285.2:c.-131-13dup|||||||rs368468774|1||1|cds_end_NF||insertion|HGNC|4699||||ENSP00000418297||C9J8R8&C9J7C7|UPI0001D3BD2E||1|||||||||||0.07009|0.03901|0.01383|0.05858|0.01353|0.008938|0.01076|0.003844|0.01108|0.01578|0.01096|||||||||,T|upstream_gene_variant|MODIFIER|GYG1|ENSG00000163754|Transcript|ENST00000497528|processed_transcript||||||||||rs368468774|1|2711|1|||insertion|HGNC|4699|||||||||1|||||||||||0.07009|0.03901|0.01383|0.05858|0.01353|0.008938|0.01076|0.003844|0.01108|0.01578|0.01096|||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:26:.,.,.,.:.:.:PASS:0	0/1:22:21,2,1,1:.:2:PASS:4	0/0:26:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:22:21,2,1,1:.:2:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:4	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
3	164776647	.	T	TACACAC,TACAC,TACACACAC	.	.	CSQ=ACACAC|intron_variant|MODIFIER|SI|ENSG00000090402|Transcript|ENST00000264382|protein_coding||12/47|ENST00000264382.3:c.1398+98_1398+103dup|||||||rs138742044|1||-1||1|insertion|HGNC|10856|YES||CCDS3196.1|ENSP00000264382|P14410||UPI000022C287|NM_001041.3|1||||||||||||||||||||||||||||||,ACAC|intron_variant|MODIFIER|SI|ENSG00000090402|Transcript|ENST00000264382|protein_coding||12/47|ENST00000264382.3:c.1398+100_1398+103dup|||||||rs138742044|2||-1||1|insertion|HGNC|10856|YES||CCDS3196.1|ENSP00000264382|P14410||UPI000022C287|NM_001041.3|1||||||||||||||||||||||||||||||,ACACACAC|intron_variant|MODIFIER|SI|ENSG00000090402|Transcript|ENST00000264382|protein_coding||12/47|ENST00000264382.3:c.1398+96_1398+103dup|||||||rs138742044|3||-1||1|insertion|HGNC|10856|YES||CCDS3196.1|ENSP00000264382|P14410||UPI000022C287|NM_001041.3|1||||||0.8275|0.7997|0.9345|0.8708|0.8384||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:44:.,.,.,.:.:.:PASS:0	0/2:19:25,0,9,0:.:2:PASS:3	0/1:44:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:19:25,0,9,0:.:1:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/2:.:.,.,.,.:.:2:PASS:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
3	195792288	.	CGGGG	C	.	.	CSQ=-|intron_variant|MODIFIER|TFRC|ENSG00000072274|Transcript|ENST00000360110|protein_coding||10/18|ENST00000360110.4:c.1198+22_1198+25del|||||||rs55639089|1||-1||1|deletion|HGNC|11763|YES||CCDS3312.1|ENSP00000353224|P02786|G3V0E5&F5H6B1|UPI0000049ADE|NM_001128148.1|1|||||||||||||0.3446|0.2148|0.3712|0.3885|0.4495|0.3592|0.3386|0.3909|0.3095|||||||||,-|intron_variant|MODIFIER|TFRC|ENSG00000072274|Transcript|ENST00000392396|protein_coding||10/18|ENST00000392396.3:c.1198+22_1198+25del|||||||rs55639089|1||-1|||deletion|HGNC|11763|||CCDS3312.1|ENSP00000376197|P02786|G3V0E5&F5H6B1|UPI0000049ADE|NM_003234.2|1|||||||||||||0.3446|0.2148|0.3712|0.3885|0.4495|0.3592|0.3386|0.3909|0.3095|||||||||,-|intron_variant|MODIFIER|TFRC|ENSG00000072274|Transcript|ENST00000420415|protein_coding||9/17|ENST00000420415.1:c.955+22_955+25del|||||||rs55639089|1||-1|||deletion|HGNC|11763||||ENSP00000390133||G3V0E5&F5H6B1|UPI000048C366||1|||||||||||||0.3446|0.2148|0.3712|0.3885|0.4495|0.3592|0.3386|0.3909|0.3095|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|TFRC|ENSG00000072274|Transcript|ENST00000464368|retained_intron||1/3|ENST00000464368.1:n.108+22_108+25del|||||||rs55639089|1||-1|||deletion|HGNC|11763|||||||||1|||||||||||||0.3446|0.2148|0.3712|0.3885|0.4495|0.3592|0.3386|0.3909|0.3095|||||||||,-|upstream_gene_variant|MODIFIER|TFRC|ENSG00000072274|Transcript|ENST00000465288|processed_transcript||||||||||rs55639089|1|1994|-1|||deletion|HGNC|11763|||||||||1|||||||||||||0.3446|0.2148|0.3712|0.3885|0.4495|0.3592|0.3386|0.3909|0.3095|||||||||,-|upstream_gene_variant|MODIFIER|TFRC|ENSG00000072274|Transcript|ENST00000475593|retained_intron||||||||||rs55639089|1|2443|-1|||deletion|HGNC|11763|||||||||1|||||||||||||0.3446|0.2148|0.3712|0.3885|0.4495|0.3592|0.3386|0.3909|0.3095|||||||||,-|upstream_gene_variant|MODIFIER|TFRC|ENSG00000072274|Transcript|ENST00000477148|retained_intron||||||||||rs55639089|1|2226|-1|||deletion|HGNC|11763|||||||||1|||||||||||||0.3446|0.2148|0.3712|0.3885|0.4495|0.3592|0.3386|0.3909|0.3095|||||||||,-|upstream_gene_variant|MODIFIER|TFRC|ENSG00000072274|Transcript|ENST00000483983|retained_intron||||||||||rs55639089|1|4814|-1|||deletion|HGNC|11763|||||||||1|||||||||||||0.3446|0.2148|0.3712|0.3885|0.4495|0.3592|0.3386|0.3909|0.3095|||||||||,-|downstream_gene_variant|MODIFIER|TFRC|ENSG00000072274|Transcript|ENST00000491658|retained_intron||||||||||rs55639089|1|2186|-1|||deletion|HGNC|11763|||||||||1|||||||||||||0.3446|0.2148|0.3712|0.3885|0.4495|0.3592|0.3386|0.3909|0.3095|||||||||,-|intron_variant|MODIFIER|TFRC|ENSG00000072274|Transcript|ENST00000535031|protein_coding||8/16|ENST00000535031.1:c.352+22_352+25del|||||||rs55639089|1||-1|||deletion|HGNC|11763||||ENSP00000437753||F5H6B1|UPI0002064E88||1|||||||||||||0.3446|0.2148|0.3712|0.3885|0.4495|0.3592|0.3386|0.3909|0.3095|||||||||,-|intron_variant|MODIFIER|TFRC|ENSG00000072274|Transcript|ENST00000540528|protein_coding||9/17|ENST00000540528.1:c.*951+22_*951+25del|||||||rs55639089|1||-1|||deletion|HGNC|11763||||ENSP00000443913|||UPI00001A9D3E||1|||||||||||||0.3446|0.2148|0.3712|0.3885|0.4495|0.3592|0.3386|0.3909|0.3095|||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:7:.,.,.,.:0:.:PASS:0	0/1:11:11,0,5,0:39:2:PASS:5	0/0:7:.,.,.,.:.:.:PASS:.	0/1:11:11,0,5,0:.:2:PASS:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:5	0/0:19:19,0,0,0:0:.:PASS:.	0/1:14:9,0,5,0:39:2:PASS:.
3	195956726	.	AAG	A	.	.	CSQ=-|downstream_gene_variant|MODIFIER|PCYT1A|ENSG00000161217|Transcript|ENST00000292823|protein_coding||||||||||rs144375332|1|4511|-1|||deletion|HGNC|8754|YES||CCDS3315.1|ENSP00000292823|P49585|C9JVS0&C9JPY0&C9J050|UPI000000DB72|NM_005017.2|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|SLC51A|ENSG00000163959|Transcript|ENST00000296327|protein_coding||6/8|ENST00000296327.5:c.634-39_634-38del|||||||rs144375332|1||1||1|deletion|HGNC|29955|YES||CCDS3314.1|ENSP00000296327|Q86UW1||UPI000019219E|NM_152672.5|||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|SLC51A|ENSG00000163959|Transcript|ENST00000415111|protein_coding||||||||||rs144375332|1|148|1|cds_start_NF||deletion|HGNC|29955||||ENSP00000409560||H7C351|UPI000198CC44||||||||||||||||||||||||||||||||,-|3_prime_UTR_variant|MODIFIER|PCYT1A|ENSG00000161217|Transcript|ENST00000419333|protein_coding|9/9||ENST00000419333.1:c.*157_*158del||1310-1311/1325|||||rs144375332|1||-1|||deletion|HGNC|8754||||ENSP00000390968||C9JVS0&C9JPY0&C9JEJ2&C9J050|UPI000198CC45||1||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SLC51A|ENSG00000163959|Transcript|ENST00000428985|protein_coding||||||||||rs144375332|1|971|1|cds_start_NF&cds_end_NF||deletion|HGNC|29955||||ENSP00000413951|||UPI000198CC43||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|PCYT1A|ENSG00000161217|Transcript|ENST00000441879|protein_coding||5/5|ENST00000441879.1:c.487-15484_487-15483del|||||||rs144375332|1||-1|cds_end_NF||deletion|HGNC|8754||||ENSP00000392397||C9JVS0&C9JPY0&C9J2E1|UPI000020AEFC||1||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SLC51A|ENSG00000163959|Transcript|ENST00000442203|nonsense_mediated_decay||||||||||rs144375332|1|2825|1|||deletion|HGNC|29955||||ENSP00000391172||F8WBV2|UPI000198CC42||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|SLC51A|ENSG00000163959|Transcript|ENST00000471430|retained_intron||1/1|ENST00000471430.1:n.301-39_301-38del|||||||rs144375332|1||1|||deletion|HGNC|29955|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SLC51A|ENSG00000163959|Transcript|ENST00000472653|retained_intron||||||||||rs144375332|1|2291|1|||deletion|HGNC|29955|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|SLC51A|ENSG00000163959|Transcript|ENST00000475271|retained_intron||1/3|ENST00000475271.1:n.196-39_196-38del|||||||rs144375332|1||1|||deletion|HGNC|29955|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|SLC51A|ENSG00000163959|Transcript|ENST00000475672|retained_intron||3/4|ENST00000475672.1:n.486-39_486-38del|||||||rs144375332|1||1|||deletion|HGNC|29955|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SLC51A|ENSG00000163959|Transcript|ENST00000476129|retained_intron||||||||||rs144375332|1|2373|1|||deletion|HGNC|29955|||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|SLC51A|ENSG00000163959|Transcript|ENST00000479732|processed_transcript||||||||||rs144375332|1|3593|1|||deletion|HGNC|29955|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|SLC51A|ENSG00000163959|Transcript|ENST00000484407|retained_intron||2/4|ENST00000484407.1:n.446-39_446-38del|||||||rs144375332|1||1|||deletion|HGNC|29955|||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|SLC51A|ENSG00000163959|Transcript|ENST00000492794|retained_intron||||||||||rs144375332|1|2547|1|||deletion|HGNC|29955|||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|SLC51A|ENSG00000163959|Transcript|ENST00000496737|processed_transcript||||||||||rs144375332|1|3290|1|||deletion|HGNC|29955|||||||||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:50:.,.,.,.:.:.:PASS:0	0/1:75:70,5,9,1:.:2:PASS:8	0/0:50:.,.,.,.:.:.:PASS:.	0/1:75:70,5,9,1:.:2:PASS:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:8	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
4	100472247	.	T	TA	.	.	CSQ=A|intron_variant|MODIFIER|TRMT10A|ENSG00000145331|Transcript|ENST00000273962|protein_coding||6/7|ENST00000273962.3:c.646-101_646-100insT|||||||rs370608163|1||-1||1|insertion|HGNC|28403|YES||CCDS3650.1|ENSP00000273962|Q8TBZ6|D6R954|UPI000006D359|NM_152292.4|1||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|TRMT10A|ENSG00000145331|Transcript|ENST00000394876|protein_coding||6/7|ENST00000394876.2:c.646-101_646-100insT|||||||rs370608163|1||-1|||insertion|HGNC|28403|||CCDS3650.1|ENSP00000378342|Q8TBZ6|D6R954|UPI000006D359||1||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|TRMT10A|ENSG00000145331|Transcript|ENST00000394877|protein_coding||6/7|ENST00000394877.3:c.646-101_646-100insT|||||||rs370608163|1||-1|||insertion|HGNC|28403|||CCDS3650.1|ENSP00000378343|Q8TBZ6|D6R954|UPI000006D359|NM_001134665.1&NM_001134666.1|1||||||||||||||||||||||||||||||,A|downstream_gene_variant|MODIFIER|TRMT10A|ENSG00000145331|Transcript|ENST00000455368|protein_coding||||||||||rs370608163|1|2722|-1|cds_end_NF||insertion|HGNC|28403||||ENSP00000397551||D6R954|UPI0001D3B6E5||1||||||||||||||||||||||||||||||,A|downstream_gene_variant|MODIFIER|TRMT10A|ENSG00000145331|Transcript|ENST00000514547|protein_coding||||||||||rs370608163|1|2740|-1|cds_end_NF||insertion|HGNC|28403||||ENSP00000423628||D6R954|UPI0001D3B6E6||1||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT	0/0:10:0,10,0,0:0:.:PASS	0/1:16:0,11,0,5:39:2:PASS	0/0:4:.,.,.,.:.:.:VarscanHighConfidenceIndel	0/1:15:0,14,0,5:.:2:VarscanHighConfidenceIndel	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	0/0:10:0,10,0,0:0:.:PASS	0/1:16:0,11,0,5:39:2:PASS
4	108608100	.	CTCTAACACT	C	.	.	CSQ=-|intron_variant|MODIFIER|PAPSS1|ENSG00000138801|Transcript|ENST00000265174|protein_coding||4/11|ENST00000265174.4:c.550+86_550+94del|||||||rs35832252|1||-1||1|deletion|HGNC|8603|YES||CCDS3676.1|ENSP00000265174|O43252|Q6IAX6&Q4W5H3&Q4W5F0|UPI0000132102|NM_005443.4|||||||0.3684|0.879|0.881|0.9245|0.9581||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|PAPSS1|ENSG00000138801|Transcript|ENST00000502431|processed_transcript||4/5|ENST00000502431.1:n.671+86_671+94del|||||||rs35832252|1||-1|||deletion|HGNC|8603|||||||||||||||0.3684|0.879|0.881|0.9245|0.9581||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|PAPSS1|ENSG00000138801|Transcript|ENST00000506544|retained_intron||||||||||rs35832252|1|176|-1|||deletion|HGNC|8603|||||||||||||||0.3684|0.879|0.881|0.9245|0.9581||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|PAPSS1|ENSG00000138801|Transcript|ENST00000511304|processed_transcript||2/6|ENST00000511304.1:n.242+86_242+94del|||||||rs35832252|1||-1|||deletion|HGNC|8603|||||||||||||||0.3684|0.879|0.881|0.9245|0.9581||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|PAPSS1|ENSG00000138801|Transcript|ENST00000514489|processed_transcript||||||||||rs35832252|1|159|-1|||deletion|HGNC|8603|||||||||||||||0.3684|0.879|0.881|0.9245|0.9581||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:8:.,.,.,.:.:.:PASS:34	1/1:48:48,0,39,0:.:2:PASS:42	0/0:8:.,.,.,.:.:.:PASS:.	1/1:48:48,0,39,0:.:2:PASS:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/1:.:.,.,.,.:.:.:PindelSomaticCalls:34	0/1:.:.,.,.,.:.:2:PindelSomaticCalls:42	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
4	121739411	.	GCACA	G	.	.	END=121739416;HOMLEN=12;HOMSEQ=CACACACACACA;SVLEN=-4;CSQ=-|intron_variant|MODIFIER|PRDM5|ENSG00000138738|Transcript|ENST00000264808|protein_coding||5/15|ENST00000264808.3:c.650+93_650+96del||||||||1||-1||1|deletion|HGNC|9349|YES||CCDS3716.1|ENSP00000264808|Q9NQX1||UPI000013D572|NM_018699.2|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|PRDM5|ENSG00000138738|Transcript|ENST00000428209|protein_coding||5/14|ENST00000428209.2:c.650+93_650+96del||||||||1||-1|||deletion|HGNC|9349||||ENSP00000404832|Q9NQX1||UPI0000DBDD84||1||||||||||||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|PRDM5|ENSG00000138738|Transcript|ENST00000502409|nonsense_mediated_decay||2/8|ENST00000502409.1:c.181+93_181+96del||||||||1||-1|cds_start_NF||deletion|HGNC|9349||||ENSP00000424861|||UPI0001D3B80D||1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|PRDM5|ENSG00000138738|Transcript|ENST00000505484|retained_intron||5/15|ENST00000505484.1:n.723+93_723+96del||||||||1||-1|||deletion|HGNC|9349|||||||||1||||||||||||||||||||||||||||||,-|non_coding_transcript_exon_variant|MODIFIER|PRDM5|ENSG00000138738|Transcript|ENST00000507611|retained_intron|2/2||ENST00000507611.1:n.446_449del||446-449/535||||||1||-1|||deletion|HGNC|9349|||||||||1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|PRDM5|ENSG00000138738|Transcript|ENST00000512845|retained_intron||5/5|ENST00000512845.1:n.737+93_737+96del||||||||1||-1|||deletion|HGNC|9349|||||||||1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|PRDM5|ENSG00000138738|Transcript|ENST00000515109|protein_coding||5/13|ENST00000515109.1:c.650+93_650+96del||||||||1||-1|||deletion|HGNC|9349||||ENSP00000422309||Q0VAI9|UPI0000DBDD85||1||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:4:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:4:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
5	1093609	.	G	GGGGCGGGGACT	.	.	END=1093610;HOMLEN=18;HOMSEQ=GGGCGGGGACTGGGCGGG;SVLEN=11;CSQ=GGGCGGGGACT|intron_variant|MODIFIER|SLC12A7|ENSG00000113504|Transcript|ENST00000264930|protein_coding||3/23|ENST00000264930.5:c.342+28_342+38dup|||||||rs56276350|1||-1||1|insertion|HGNC|10915|YES||CCDS34129.1|ENSP00000264930|Q9Y666||UPI0000141815|NM_006598.2|||||||0.5234|0.9078|0.9871|0.9334|0.9867|0.5905|0.9242||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:18:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:18:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
5	174940299	.	TAAAAAAAAAAAAA	T	.	.	END=174940313;HOMLEN=15;HOMSEQ=AAAAAAAAAAAAAAA;SVLEN=-13;CSQ=-|intron_variant|MODIFIER|SFXN1|ENSG00000164466|Transcript|ENST00000321442|protein_coding||6/10|ENST00000321442.5:c.597-151_597-139del|||||||rs55761424|1||1||1|deletion|HGNC|16085|YES||CCDS4394.1|ENSP00000316905|Q9H9B4|D6RFI0&D6RDG7|UPI0000044799|NM_022754.5|||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SFXN1|ENSG00000164466|Transcript|ENST00000502393|protein_coding||||||||||rs55761424|1|1718|1|||deletion|HGNC|16085||||ENSP00000473710||S4R2X2&D6RDG7|UPI0003335051||||||||||||||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|SFXN1|ENSG00000164466|Transcript|ENST00000502865|nonsense_mediated_decay||5/6|ENST00000502865.1:c.*397-151_*397-139del|||||||rs55761424|1||1|cds_start_NF||deletion|HGNC|16085||||ENSP00000424270|||UPI0001D3BAAC||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SFXN1|ENSG00000164466|Transcript|ENST00000506963|protein_coding||||||||||rs55761424|1|1116|1|cds_end_NF||deletion|HGNC|16085||||ENSP00000421467||D6RFI0&D6RDG7|UPI0001D3BAAB||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SFXN1|ENSG00000164466|Transcript|ENST00000507017|protein_coding||||||||||rs55761424|1|3090|1|cds_end_NF||deletion|HGNC|16085||||ENSP00000420961||D6RDG7|UPI00004699D8||||||||||||||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|SFXN1|ENSG00000164466|Transcript|ENST00000507823|nonsense_mediated_decay||6/9|ENST00000507823.1:c.*397-151_*397-139del|||||||rs55761424|1||1|||deletion|HGNC|16085||||ENSP00000421982||D6RAE9|UPI0000E09B85||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SFXN1|ENSG00000164466|Transcript|ENST00000508290|retained_intron||||||||||rs55761424|1|3894|1|||deletion|HGNC|16085|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SFXN1|ENSG00000164466|Transcript|ENST00000513725|retained_intron||||||||||rs55761424|1|2985|1|||deletion|HGNC|16085|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|SFXN1|ENSG00000164466|Transcript|ENST00000515736|retained_intron||2/2|ENST00000515736.2:n.178-151_178-139del|||||||rs55761424|1||1|||deletion|HGNC|16085|||||||||||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
6	32487441	.	A	AC	.	.	CSQ=C|intron_variant|MODIFIER|HLA-DRB5|ENSG00000198502|Transcript|ENST00000374975|protein_coding||2/5|ENST00000374975.3:c.371-14_371-13insG|||||||rs747493738|1||-1||1|insertion|HGNC|4953|YES||CCDS4751.1|ENSP00000364114|Q30154|Q95385&Q5TJ21&Q30141&Q30138&Q30009&Q2YHL2&Q06663&Q06654&A1A424|UPI000008AF56|NM_002125.3||||||||||||0.04726|0.09124|0.000582|0|0.0005299|0.001032|0.0007758|0.0005037|0.0007093|0|0.0004311|||||||||	GT:DP:DP4:BQ:SS:FT	0/0:4:.,.,.,.:.:.:PASS	1/1:20:2,18,2,18:.:2:PASS	0/0:4:.,.,.,.:.:.:PASS	1/1:20:2,18,2,18:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.
6	32548732	.	C	CT	.	.	CSQ=T|intron_variant|MODIFIER|HLA-DRB1|ENSG00000196126|Transcript|ENST00000360004|protein_coding||3/5|ENST00000360004.5:c.653-100_653-99insA|||||||rs373779708|1||-1||1|insertion|HGNC|4948|YES||CCDS47409.1|ENSP00000353099|Q9GIY3&P04229&Q29974&P01911|M9PAL6&M9PAH4&M9PAH2&M9PA34&M9P9N9&M9P9N6&M9P978&M9P8M8&M9P8M7&Q9TQ40&Q9MYD9&Q95HN3&Q8WMA1&Q8MGY6&Q8HWN3&Q860S9&Q5Y7C5&Q3LTJ8&Q1G100&Q1G0Z8&Q06653&I6NVX3&I6M556&H8WV95&H6A2E5&H2BDR9&G9I2P4&G9HW13&G1EMX6&G1EMX4&G1CD91&G0ZMM9&G0ZMM8&G0ZDX1&F8R8N1&F8R8N0&F4YZX5&F4YZX4&F4YZX3&F4YZX2&F4YZX1&F4YZW3&F4YUA8&F2X654&F2VNW9&F2VNV6&F2VNV5&F2QL89&F1CCP7&F1CCN5&F1CCN2&F1CCL9&F0V6B9&E7BYD5&E3SWP0&E3SWN9&E3SWN8&E0X9M7&D9IFQ2&D7RIH8&D7NR21&D6MJL2&D6MJC0&D6BPR2&D5M8A0&D5M899&D5G2K8&D5FZP5&D5FZP4&D5FIF2&D5FIE9&D5FIE8&D5FIE7&D5FIE6&D5FIE4&D5FID9&D5FID8&D5FID7&D5FID6&D5FID2&D5FID0&D5FIC9&D5FIC8&D3U4F4&C8CJD1&B7VU65&A1Z0K9&A0N0W0|UPI000008A1F7|NM_002124.3|1||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT	0/0:31:.,.,.,.:.:.:PASS	0/1:106:1,87,0,18:.:2:PASS	0/0:31:.,.,.,.:.:.:PASS	0/1:106:1,87,0,18:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.
6	32557600	.	T	TC	.	.	CSQ=C|5_prime_UTR_variant|MODIFIER|HLA-DRB1|ENSG00000196126|Transcript|ENST00000360004|protein_coding|1/6||ENST00000360004.5:c.-82_-81insG||25-26/1229|||||rs1343244742|1||-1||1|insertion|HGNC|4948|YES||CCDS47409.1|ENSP00000353099|Q9GIY3&P04229&Q29974&P01911|M9PAL6&M9PAH4&M9PAH2&M9PA34&M9P9N9&M9P9N6&M9P978&M9P8M8&M9P8M7&Q9TQ40&Q9MYD9&Q95HN3&Q8WMA1&Q8MGY6&Q8HWN3&Q860S9&Q5Y7C5&Q3LTJ8&Q1G100&Q1G0Z8&Q06653&I6NVX3&I6M556&H8WV95&H6A2E5&H2BDR9&G9I2P4&G9HW13&G1EMX6&G1EMX4&G1CD91&G0ZMM9&G0ZMM8&G0ZDX1&F8R8N1&F8R8N0&F4YZX5&F4YZX4&F4YZX3&F4YZX2&F4YZX1&F4YZW3&F4YUA8&F2X654&F2VNW9&F2VNV6&F2VNV5&F2QL89&F1CCP7&F1CCN5&F1CCN2&F1CCL9&F0V6B9&E7BYD5&E3SWP0&E3SWN9&E3SWN8&E0X9M7&D9IFQ2&D7RIH8&D7NR21&D6MJL2&D6MJC0&D6BPR2&D5M8A0&D5M899&D5G2K8&D5FZP5&D5FZP4&D5FIF2&D5FIE9&D5FIE8&D5FIE7&D5FIE6&D5FIE4&D5FID9&D5FID8&D5FID7&D5FID6&D5FID2&D5FID0&D5FIC9&D5FIC8&D3U4F4&C8CJD1&B7VU65&A1Z0K9&A0N0W0|UPI000008A1F7|NM_002124.3|1||||||||||||||||||||||||||||||,C|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000195691|||||||||||rs1343244742|1|||||insertion|||||||||||||||||||||||||||||||||||||||||,C|TF_binding_site_variant|MODIFIER|||MotifFeature|ENSM00910732557|||||||||||rs1343244742|1||1|||insertion|||||||||||||||||||||||||||||||||||||ENSPFM0086|12|N||EGR1&EGR2&EGR4&EGR3,C|TF_binding_site_variant|MODIFIER|||MotifFeature|ENSM00523470620|||||||||||rs1343244742|1||-1|||insertion|||||||||||||||||||||||||||||||||||||ENSPFM0506|3|N||TEAD4::SPIB&TEAD4::ELF1&TEAD4::ELK1,C|TF_binding_site_variant|MODIFIER|||MotifFeature|ENSM00523157931|||||||||||rs1343244742|1||-1|||insertion|||||||||||||||||||||||||||||||||||||ENSPFM0069|2|N||E2F1::EOMES	GT:DP:DP4:BQ:SS:FT	0/0:42:.,.,.,.:.:.:PASS	0/1:68:1,57,0,10:.:2:PASS	0/0:42:.,.,.,.:.:.:PASS	0/1:68:1,57,0,10:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.
6	64289938	.	ATT	AT,ATTT,A	.	.	CSQ=T|intron_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000370650|protein_coding||4/4|ENST00000370650.2:c.330-22del|||||||rs56188808|1||1|||sequence_alteration|HGNC|9634||||ENSP00000359684||Q5TCM7|UPI0000470B0E|||||||||||||||0.4399|0.4494|0.4351|0.4252|0.4444|0.4151|0.4455|0.4352|0.4347|||||||||,TTT|intron_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000370650|protein_coding||4/4|ENST00000370650.2:c.330-22_330-21insT|||||||rs56188808|2||1|||sequence_alteration|HGNC|9634||||ENSP00000359684||Q5TCM7|UPI0000470B0E|||||||||||||||0.03232|0.0272|0.03285|0.04164|0.03113|0.04043|0.03046|0.03944|0.03354|||||||||,-|intron_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000370650|protein_coding||4/4|ENST00000370650.2:c.330-23_330-22del|||||||rs56188808|3||1|||sequence_alteration|HGNC|9634||||ENSP00000359684||Q5TCM7|UPI0000470B0E|||||||||||||||0.0228|0.01967|0.02582|0.02965|0.0204|0.03172|0.02001|0.02141|0.02653|||||||||,T|intron_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000370651|protein_coding||5/5|ENST00000370651.3:c.405-22del|||||||rs56188808|1||1||1|sequence_alteration|HGNC|9634|YES||CCDS4965.1|ENSP00000359685|Q93096||UPI00000227B8|NM_003463.4||||||||||||||0.4399|0.4494|0.4351|0.4252|0.4444|0.4151|0.4455|0.4352|0.4347|||||||||,TTT|intron_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000370651|protein_coding||5/5|ENST00000370651.3:c.405-22_405-21insT|||||||rs56188808|2||1||1|sequence_alteration|HGNC|9634|YES||CCDS4965.1|ENSP00000359685|Q93096||UPI00000227B8|NM_003463.4||||||||||||||0.03232|0.0272|0.03285|0.04164|0.03113|0.04043|0.03046|0.03944|0.03354|||||||||,-|intron_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000370651|protein_coding||5/5|ENST00000370651.3:c.405-23_405-22del|||||||rs56188808|3||1||1|sequence_alteration|HGNC|9634|YES||CCDS4965.1|ENSP00000359685|Q93096||UPI00000227B8|NM_003463.4||||||||||||||0.0228|0.01967|0.02582|0.02965|0.0204|0.03172|0.02001|0.02141|0.02653|||||||||,T|downstream_gene_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000470661|processed_transcript||||||||||rs56188808|1|3452|1|||sequence_alteration|HGNC|9634||||||||||||||||||||||0.4399|0.4494|0.4351|0.4252|0.4444|0.4151|0.4455|0.4352|0.4347|||||||||,TTT|downstream_gene_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000470661|processed_transcript||||||||||rs56188808|2|3452|1|||sequence_alteration|HGNC|9634||||||||||||||||||||||0.03232|0.0272|0.03285|0.04164|0.03113|0.04043|0.03046|0.03944|0.03354|||||||||,-|downstream_gene_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000470661|processed_transcript||||||||||rs56188808|3|3452|1|||sequence_alteration|HGNC|9634||||||||||||||||||||||0.0228|0.01967|0.02582|0.02965|0.0204|0.03172|0.02001|0.02141|0.02653|||||||||,T|downstream_gene_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000473334|processed_transcript||||||||||rs56188808|1|3337|1|||sequence_alteration|HGNC|9634||||||||||||||||||||||0.4399|0.4494|0.4351|0.4252|0.4444|0.4151|0.4455|0.4352|0.4347|||||||||,TTT|downstream_gene_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000473334|processed_transcript||||||||||rs56188808|2|3337|1|||sequence_alteration|HGNC|9634||||||||||||||||||||||0.03232|0.0272|0.03285|0.04164|0.03113|0.04043|0.03046|0.03944|0.03354|||||||||,-|downstream_gene_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000473334|processed_transcript||||||||||rs56188808|3|3337|1|||sequence_alteration|HGNC|9634||||||||||||||||||||||0.0228|0.01967|0.02582|0.02965|0.0204|0.03172|0.02001|0.02141|0.02653|||||||||,T|downstream_gene_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000578299|protein_coding||||||||||rs56188808|1|3503|1|||sequence_alteration|HGNC|9634||||ENSP00000462406||J3KSB4|UPI000268B497|||||||||||||||0.4399|0.4494|0.4351|0.4252|0.4444|0.4151|0.4455|0.4352|0.4347|||||||||,TTT|downstream_gene_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000578299|protein_coding||||||||||rs56188808|2|3503|1|||sequence_alteration|HGNC|9634||||ENSP00000462406||J3KSB4|UPI000268B497|||||||||||||||0.03232|0.0272|0.03285|0.04164|0.03113|0.04043|0.03046|0.03944|0.03354|||||||||,-|downstream_gene_variant|MODIFIER|PTP4A1|ENSG00000112245|Transcript|ENST00000578299|protein_coding||||||||||rs56188808|3|3503|1|||sequence_alteration|HGNC|9634||||ENSP00000462406||J3KSB4|UPI000268B497|||||||||||||||0.0228|0.01967|0.02582|0.02965|0.0204|0.03172|0.02001|0.02141|0.02653|||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:36:.,.,.,.:.:.:PASS:0	0/3:22:29,2,4,1:.:2:PASS:3	0/1:36:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:22:29,2,4,1:.:1:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/3:.:.,.,.,.:.:2:PASS:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
6	75950109	.	TA	TAA,T,TAAA	.	.	CSQ=AA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000230459|protein_coding||2/3|ENST00000230459.4:c.109-9dup|||||||rs56897555|1||-1|||sequence_alteration|HGNC|2288||||ENSP00000230459|P14406||UPI0000128157|NM_001865.3|||||||0.1256|0.1744|0.1339|0.2038|0.0777|||0.4179|0.3635|0.4151|0.4151|0.4235|0.4475|0.4294|0.4159|0.3835|||||||||,-|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000230459|protein_coding||2/3|ENST00000230459.4:c.109-9del|||||||rs56897555|2||-1|||sequence_alteration|HGNC|2288||||ENSP00000230459|P14406||UPI0000128157|NM_001865.3||||||||||||||0.1015|0.1462|0.1154|0.1063|0.1032|0.06696|0.08834|0.1038|0.136|||||||||,AAA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000230459|protein_coding||2/3|ENST00000230459.4:c.109-9_109-8insTT|||||||rs56897555|3||-1|||sequence_alteration|HGNC|2288||||ENSP00000230459|P14406||UPI0000128157|NM_001865.3||||||||||||||0.01387|0.01883|0.01562|0.01684|0.01494|0.009334|0.01339|0.01856|0.01145|||||||||,AA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000370081|protein_coding||3/4|ENST00000370081.2:c.205-9dup|||||||rs56897555|1||-1||1|sequence_alteration|HGNC|2288|YES||CCDS34486.2|ENSP00000359098||H0UI06|UPI000015A446||||||||0.1256|0.1744|0.1339|0.2038|0.0777|||0.4179|0.3635|0.4151|0.4151|0.4235|0.4475|0.4294|0.4159|0.3835|||||||||,-|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000370081|protein_coding||3/4|ENST00000370081.2:c.205-9del|||||||rs56897555|2||-1||1|sequence_alteration|HGNC|2288|YES||CCDS34486.2|ENSP00000359098||H0UI06|UPI000015A446|||||||||||||||0.1015|0.1462|0.1154|0.1063|0.1032|0.06696|0.08834|0.1038|0.136|||||||||,AAA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000370081|protein_coding||3/4|ENST00000370081.2:c.205-9_205-8insTT|||||||rs56897555|3||-1||1|sequence_alteration|HGNC|2288|YES||CCDS34486.2|ENSP00000359098||H0UI06|UPI000015A446|||||||||||||||0.01387|0.01883|0.01562|0.01684|0.01494|0.009334|0.01339|0.01856|0.01145|||||||||,AA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000370089|protein_coding||2/3|ENST00000370089.2:c.205-9dup|||||||rs56897555|1||-1|||sequence_alteration|HGNC|2288|||CCDS34486.2|ENSP00000359106||H0UI06|UPI000015A446||||||||0.1256|0.1744|0.1339|0.2038|0.0777|||0.4179|0.3635|0.4151|0.4151|0.4235|0.4475|0.4294|0.4159|0.3835|||||||||,-|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000370089|protein_coding||2/3|ENST00000370089.2:c.205-9del|||||||rs56897555|2||-1|||sequence_alteration|HGNC|2288|||CCDS34486.2|ENSP00000359106||H0UI06|UPI000015A446|||||||||||||||0.1015|0.1462|0.1154|0.1063|0.1032|0.06696|0.08834|0.1038|0.136|||||||||,AAA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000370089|protein_coding||2/3|ENST00000370089.2:c.205-9_205-8insTT|||||||rs56897555|3||-1|||sequence_alteration|HGNC|2288|||CCDS34486.2|ENSP00000359106||H0UI06|UPI000015A446|||||||||||||||0.01387|0.01883|0.01562|0.01684|0.01494|0.009334|0.01339|0.01856|0.01145|||||||||,AA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000377978|protein_coding||3/3|ENST00000377978.3:c.226-9dup|||||||rs56897555|1||-1|cds_end_NF||sequence_alteration|HGNC|2288||||ENSP00000421193||D6RGV5|UPI0001D3BC01||||||||0.1256|0.1744|0.1339|0.2038|0.0777|||0.4179|0.3635|0.4151|0.4151|0.4235|0.4475|0.4294|0.4159|0.3835|||||||||,-|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000377978|protein_coding||3/3|ENST00000377978.3:c.226-9del|||||||rs56897555|2||-1|cds_end_NF||sequence_alteration|HGNC|2288||||ENSP00000421193||D6RGV5|UPI0001D3BC01|||||||||||||||0.1015|0.1462|0.1154|0.1063|0.1032|0.06696|0.08834|0.1038|0.136|||||||||,AAA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000377978|protein_coding||3/3|ENST00000377978.3:c.226-9_226-8insTT|||||||rs56897555|3||-1|cds_end_NF||sequence_alteration|HGNC|2288||||ENSP00000421193||D6RGV5|UPI0001D3BC01|||||||||||||||0.01387|0.01883|0.01562|0.01684|0.01494|0.009334|0.01339|0.01856|0.01145|||||||||,AA|intron_variant&NMD_transcript_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000459637|nonsense_mediated_decay||2/3|ENST00000459637.2:c.*12-9dup|||||||rs56897555|1||-1|cds_start_NF||sequence_alteration|HGNC|2288||||ENSP00000421969|||UPI0001D3BBFF||||||||0.1256|0.1744|0.1339|0.2038|0.0777|||0.4179|0.3635|0.4151|0.4151|0.4235|0.4475|0.4294|0.4159|0.3835|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000459637|nonsense_mediated_decay||2/3|ENST00000459637.2:c.*12-9del|||||||rs56897555|2||-1|cds_start_NF||sequence_alteration|HGNC|2288||||ENSP00000421969|||UPI0001D3BBFF|||||||||||||||0.1015|0.1462|0.1154|0.1063|0.1032|0.06696|0.08834|0.1038|0.136|||||||||,AAA|intron_variant&NMD_transcript_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000459637|nonsense_mediated_decay||2/3|ENST00000459637.2:c.*12-8_*12-9insTT|||||||rs56897555|3||-1|cds_start_NF||sequence_alteration|HGNC|2288||||ENSP00000421969|||UPI0001D3BBFF|||||||||||||||0.01387|0.01883|0.01562|0.01684|0.01494|0.009334|0.01339|0.01856|0.01145|||||||||,AA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000460985|protein_coding||1/2|ENST00000460985.1:c.19-9dup|||||||rs56897555|1||-1|||sequence_alteration|HGNC|2288||||ENSP00000422979||D6R9C3|UPI0001D3BC00||||||||0.1256|0.1744|0.1339|0.2038|0.0777|||0.4179|0.3635|0.4151|0.4151|0.4235|0.4475|0.4294|0.4159|0.3835|||||||||,-|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000460985|protein_coding||1/2|ENST00000460985.1:c.19-9del|||||||rs56897555|2||-1|||sequence_alteration|HGNC|2288||||ENSP00000422979||D6R9C3|UPI0001D3BC00|||||||||||||||0.1015|0.1462|0.1154|0.1063|0.1032|0.06696|0.08834|0.1038|0.136|||||||||,AAA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000460985|protein_coding||1/2|ENST00000460985.1:c.19-9_19-8insTT|||||||rs56897555|3||-1|||sequence_alteration|HGNC|2288||||ENSP00000422979||D6R9C3|UPI0001D3BC00|||||||||||||||0.01387|0.01883|0.01562|0.01684|0.01494|0.009334|0.01339|0.01856|0.01145|||||||||,AA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000472311|protein_coding||2/2|ENST00000472311.2:c.108+782dup|||||||rs56897555|1||-1|||sequence_alteration|HGNC|2288||||ENSP00000423432||D6RA35|UPI000020D21D||||||||0.1256|0.1744|0.1339|0.2038|0.0777|||0.4179|0.3635|0.4151|0.4151|0.4235|0.4475|0.4294|0.4159|0.3835|||||||||,-|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000472311|protein_coding||2/2|ENST00000472311.2:c.108+782del|||||||rs56897555|2||-1|||sequence_alteration|HGNC|2288||||ENSP00000423432||D6RA35|UPI000020D21D|||||||||||||||0.1015|0.1462|0.1154|0.1063|0.1032|0.06696|0.08834|0.1038|0.136|||||||||,AAA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000472311|protein_coding||2/2|ENST00000472311.2:c.108+782_108+783insTT|||||||rs56897555|3||-1|||sequence_alteration|HGNC|2288||||ENSP00000423432||D6RA35|UPI000020D21D|||||||||||||||0.01387|0.01883|0.01562|0.01684|0.01494|0.009334|0.01339|0.01856|0.01145|||||||||,AA|downstream_gene_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000481061|retained_intron||||||||||rs56897555|1|51|-1|||sequence_alteration|HGNC|2288|||||||||||||||0.1256|0.1744|0.1339|0.2038|0.0777|||0.4179|0.3635|0.4151|0.4151|0.4235|0.4475|0.4294|0.4159|0.3835|||||||||,-|downstream_gene_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000481061|retained_intron||||||||||rs56897555|2|51|-1|||sequence_alteration|HGNC|2288||||||||||||||||||||||0.1015|0.1462|0.1154|0.1063|0.1032|0.06696|0.08834|0.1038|0.136|||||||||,AAA|downstream_gene_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000481061|retained_intron||||||||||rs56897555|3|51|-1|||sequence_alteration|HGNC|2288||||||||||||||||||||||0.01387|0.01883|0.01562|0.01684|0.01494|0.009334|0.01339|0.01856|0.01145|||||||||,AA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000509698|protein_coding||2/3|ENST00000509698.1:c.109-9dup|||||||rs56897555|1||-1|||sequence_alteration|HGNC|2288||||ENSP00000425951||D6RIE3|UPI000041484D||||||||0.1256|0.1744|0.1339|0.2038|0.0777|||0.4179|0.3635|0.4151|0.4151|0.4235|0.4475|0.4294|0.4159|0.3835|||||||||,-|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000509698|protein_coding||2/3|ENST00000509698.1:c.109-9del|||||||rs56897555|2||-1|||sequence_alteration|HGNC|2288||||ENSP00000425951||D6RIE3|UPI000041484D|||||||||||||||0.1015|0.1462|0.1154|0.1063|0.1032|0.06696|0.08834|0.1038|0.136|||||||||,AAA|intron_variant|MODIFIER|COX7A2|ENSG00000112695|Transcript|ENST00000509698|protein_coding||2/3|ENST00000509698.1:c.109-9_109-8insTT|||||||rs56897555|3||-1|||sequence_alteration|HGNC|2288||||ENSP00000425951||D6RIE3|UPI000041484D|||||||||||||||0.01387|0.01883|0.01562|0.01684|0.01494|0.009334|0.01339|0.01856|0.01145|||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:45:.,.,.,.:.:.:PASS:0	0/2:27:6,32,1,6:.:2:PASS:5	0/1:45:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/2:27:6,32,1,6:.:5:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/2:.:.,.,.,.:.:2:PASS:5	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
6	90577711	.	TCTTTGCCCAGACATGGA	T	.	.	CSQ=-|non_coding_transcript_exon_variant|MODIFIER|CASP8AP2|ENSG00000118412|Transcript|ENST00000237177|processed_transcript|8/10||ENST00000237177.6:n.4899_4915del||4899-4915/6719|||||rs537929246|1||1|||deletion|HGNC|1510||||||||||||||0.0809|0.0061|0.0908|0.0437|0.1471|0.1452|0.01062|0.06093|0.06008|0.006838|0.04643|0.09033|0.0226|0.06336|0.06516|0.07212|0.09395|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|CASP8AP2|ENSG00000118412|Transcript|ENST00000548224|processed_transcript||6/7|ENST00000548224.1:n.572-3296_572-3280del|||||||rs537929246|1||1|||deletion|HGNC|1510||||||||||||||0.0809|0.0061|0.0908|0.0437|0.1471|0.1452|0.01062|0.06093|0.06008|0.006838|0.04643|0.09033|0.0226|0.06336|0.06516|0.07212|0.09395|||||||||,-|non_coding_transcript_exon_variant|MODIFIER|CASP8AP2|ENSG00000118412|Transcript|ENST00000551025|processed_transcript|8/9||ENST00000551025.1:n.6140_6156del||6140-6156/7344|||||rs537929246|1||1||1|deletion|HGNC|1510|YES|||||||||||||0.0809|0.0061|0.0908|0.0437|0.1471|0.1452|0.01062|0.06093|0.06008|0.006838|0.04643|0.09033|0.0226|0.06336|0.06516|0.07212|0.09395|||||||||	GT:DP:DP4:BQ:SS:FT	0/0:36:.,.,.,.:.:.:PASS	0/1:71:18,37,3,13:.:2:PASS	0/0:36:.,.,.,.:.:.:PASS	0/1:71:18,37,3,13:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.
6	105300084	.	G	GTT	.	.	CSQ=TT|intron_variant|MODIFIER|HACE1|ENSG00000085382|Transcript|ENST00000262903|protein_coding||2/23|ENST00000262903.4:c.131+107_131+108insAA|||||||rs67205678|1||-1||1|insertion|HGNC|21033|YES||CCDS5050.1|ENSP00000262903|Q8IYU2|E5RFX0&E3W983|UPI00001602DC|NM_020771.3|1||||||0.0227|0.0548|0|0.0924|0.0368||||||||||||||||||||,TT|intron_variant|MODIFIER|HACE1|ENSG00000085382|Transcript|ENST00000369125|protein_coding||2/18|ENST00000369125.2:c.131+107_131+108insAA|||||||rs67205678|1||-1|||insertion|HGNC|21033||||ENSP00000358121|Q8IYU2|E5RFX0&E3W983|UPI0001AE7328||1||||||0.0227|0.0548|0|0.0924|0.0368||||||||||||||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|HACE1|ENSG00000085382|Transcript|ENST00000416605|nonsense_mediated_decay||2/25|ENST00000416605.2:c.131+107_131+108insAA|||||||rs67205678|1||-1|||insertion|HGNC|21033||||ENSP00000392425||E5RFX0&E3W983|UPI0001E8F629||1||||||0.0227|0.0548|0|0.0924|0.0368||||||||||||||||||||,TT|intron_variant|MODIFIER|HACE1|ENSG00000085382|Transcript|ENST00000519645|protein_coding||2/7|ENST00000519645.1:c.131+107_131+108insAA|||||||rs67205678|1||-1|cds_end_NF||insertion|HGNC|21033||||ENSP00000429765||E5RHI1|UPI0001E8F62D||1||||||0.0227|0.0548|0|0.0924|0.0368||||||||||||||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|HACE1|ENSG00000085382|Transcript|ENST00000521962|nonsense_mediated_decay||4/6|ENST00000521962.1:c.*157+107_*157+108insAA|||||||rs67205678|1||-1|cds_start_NF||insertion|HGNC|21033||||ENSP00000430669|||UPI0001E8F62F||1||||||0.0227|0.0548|0|0.0924|0.0368||||||||||||||||||||,TT|intron_variant|MODIFIER|HACE1|ENSG00000085382|Transcript|ENST00000524020|protein_coding||2/5|ENST00000524020.1:c.29+107_29+108insAA|||||||rs67205678|1||-1|cds_end_NF||insertion|HGNC|21033||||ENSP00000427901||E5RFX0|UPI0001E8F62E||1||||||0.0227|0.0548|0|0.0924|0.0368||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:6:.,.,.,.:.:.:PASS:9	1/1:30:26,3,20,3:.:2:PASS:8	0/0:6:.,.,.,.:.:.:PASS:.	1/1:30:26,3,20,3:.:2:PASS:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/1:.:.,.,.,.:.:.:PindelSomaticCalls:9	0/1:.:.,.,.,.:.:2:PindelSomaticCalls:8	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
6	117631463	.	T	TTAA	.	.	CSQ=TAA|intron_variant|MODIFIER|ROS1|ENSG00000047936|Transcript|ENST00000368507|protein_coding||40/43|ENST00000368507.3:c.6216-22_6216-20dup|||||||rs2243387|1||-1|||insertion|HGNC|10261||||ENSP00000357493||Q5H8Y1|UPI0000470AE6||1||||||0.0091|0.0288|0.0774|0.0109|0.0215|0.152|0.1452|0.1896|0.1454|0.2941|0.1945|0.2975|0.2391|0.1434|0.1848|0.191|||||||||,TAA|intron_variant|MODIFIER|ROS1|ENSG00000047936|Transcript|ENST00000368508|protein_coding||39/42|ENST00000368508.3:c.6234-22_6234-20dup|||||||rs2243387|1||-1||1|insertion|HGNC|10261|YES||CCDS5116.1|ENSP00000357494|P08922||UPI000013D467|NM_002944.2|1||||||0.0091|0.0288|0.0774|0.0109|0.0215|0.152|0.1452|0.1896|0.1454|0.2941|0.1945|0.2975|0.2391|0.1434|0.1848|0.191|||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:21:.,.,.,.:.:.:PASS:1	0/1:25:5,20,2,5:.:2:PASS:5	0/0:21:.,.,.,.:.:.:PASS:.	0/1:25:5,20,2,5:.:2:PASS:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/1:.:.,.,.,.:.:.:PindelSomaticCalls:1	0/1:.:.,.,.,.:.:2:PindelSomaticCalls:5	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
6	152765726	.	GA	GAA,G	.	.	CSQ=AA|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000265368|protein_coding||29/145|ENST00000265368.4:c.3670-14dup|||||||rs111322292|1||-1|||sequence_alteration|HGNC|17089||||ENSP00000265368|||UPI0000457909||1|||||||||||0.09769|0.07297|0.08854|0.133|0.1117|0.08963|0.1053|0.09|0.0739|0.08981|0.08905|uncertain_significance||1||||||,-|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000265368|protein_coding||29/145|ENST00000265368.4:c.3670-14del|||||||rs111322292|2||-1|||sequence_alteration|HGNC|17089||||ENSP00000265368|||UPI0000457909||1|||||||||||0.1452|0.1587|0.147|0.1089|0.1278|0.1268|0.07806|0.1181|0.1783|0.1393|0.1231|uncertain_significance||1||||||,AA|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000341594|protein_coding||32/146|ENST00000341594.5:c.3868-14dup|||||||rs111322292|1||-1|||sequence_alteration|HGNC|17089||||ENSP00000341887||E7ENN3|UPI0001AE79CF||1|||||||||||0.09769|0.07297|0.08854|0.133|0.1117|0.08963|0.1053|0.09|0.0739|0.08981|0.08905|uncertain_significance||1||||||,-|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000341594|protein_coding||32/146|ENST00000341594.5:c.3868-14del|||||||rs111322292|2||-1|||sequence_alteration|HGNC|17089||||ENSP00000341887||E7ENN3|UPI0001AE79CF||1|||||||||||0.1452|0.1587|0.147|0.1089|0.1278|0.1268|0.07806|0.1181|0.1783|0.1393|0.1231|uncertain_significance||1||||||,AA|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000367248|protein_coding||28/31|ENST00000367248.3:c.3640-14dup|||||||rs111322292|1||-1|||sequence_alteration|HGNC|17089||||ENSP00000356217||F5GXQ8|UPI000204A78A||1|||||||||||0.09769|0.07297|0.08854|0.133|0.1117|0.08963|0.1053|0.09|0.0739|0.08981|0.08905|uncertain_significance||1||||||,-|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000367248|protein_coding||28/31|ENST00000367248.3:c.3640-14del|||||||rs111322292|2||-1|||sequence_alteration|HGNC|17089||||ENSP00000356217||F5GXQ8|UPI000204A78A||1|||||||||||0.1452|0.1587|0.147|0.1089|0.1278|0.1268|0.07806|0.1181|0.1783|0.1393|0.1231|uncertain_significance||1||||||,AA|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000367253|protein_coding||27/35|ENST00000367253.4:c.3670-14dup|||||||rs111322292|1||-1|||sequence_alteration|HGNC|17089||||ENSP00000356222|Q8NF91||UPI000013C4D2||1|||||||||||0.09769|0.07297|0.08854|0.133|0.1117|0.08963|0.1053|0.09|0.0739|0.08981|0.08905|uncertain_significance||1||||||,-|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000367253|protein_coding||27/35|ENST00000367253.4:c.3670-14del|||||||rs111322292|2||-1|||sequence_alteration|HGNC|17089||||ENSP00000356222|Q8NF91||UPI000013C4D2||1|||||||||||0.1452|0.1587|0.147|0.1089|0.1278|0.1268|0.07806|0.1181|0.1783|0.1393|0.1231|uncertain_significance||1||||||,AA|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000367255|protein_coding||29/145|ENST00000367255.5:c.3670-14dup|||||||rs111322292|1||-1||1|sequence_alteration|HGNC|17089|YES||CCDS5236.2|ENSP00000356224|Q8NF91||UPI000204AF58|NM_182961.3|1|||||||||||0.09769|0.07297|0.08854|0.133|0.1117|0.08963|0.1053|0.09|0.0739|0.08981|0.08905|uncertain_significance||1||||||,-|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000367255|protein_coding||29/145|ENST00000367255.5:c.3670-14del|||||||rs111322292|2||-1||1|sequence_alteration|HGNC|17089|YES||CCDS5236.2|ENSP00000356224|Q8NF91||UPI000204AF58|NM_182961.3|1|||||||||||0.1452|0.1587|0.147|0.1089|0.1278|0.1268|0.07806|0.1181|0.1783|0.1393|0.1231|uncertain_significance||1||||||,AA|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000413186|protein_coding||27/30|ENST00000413186.2:c.3670-14dup|||||||rs111322292|1||-1|||sequence_alteration|HGNC|17089||||ENSP00000414510|Q8NF91||UPI000018DB94||1|||||||||||0.09769|0.07297|0.08854|0.133|0.1117|0.08963|0.1053|0.09|0.0739|0.08981|0.08905|uncertain_significance||1||||||,-|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000413186|protein_coding||27/30|ENST00000413186.2:c.3670-14del|||||||rs111322292|2||-1|||sequence_alteration|HGNC|17089||||ENSP00000414510|Q8NF91||UPI000018DB94||1|||||||||||0.1452|0.1587|0.147|0.1089|0.1278|0.1268|0.07806|0.1181|0.1783|0.1393|0.1231|uncertain_significance||1||||||,AA|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000423061|protein_coding||29/145|ENST00000423061.1:c.3691-14dup|||||||rs111322292|1||-1|||sequence_alteration|HGNC|17089|||CCDS5235.1|ENSP00000396024|Q8NF91||UPI0000110103|NM_033071.3|1|||||||||||0.09769|0.07297|0.08854|0.133|0.1117|0.08963|0.1053|0.09|0.0739|0.08981|0.08905|uncertain_significance||1||||||,-|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000423061|protein_coding||29/145|ENST00000423061.1:c.3691-14del|||||||rs111322292|2||-1|||sequence_alteration|HGNC|17089|||CCDS5235.1|ENSP00000396024|Q8NF91||UPI0000110103|NM_033071.3|1|||||||||||0.1452|0.1587|0.147|0.1089|0.1278|0.1268|0.07806|0.1181|0.1783|0.1393|0.1231|uncertain_significance||1||||||,AA|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000448038|protein_coding||30/146|ENST00000448038.1:c.3691-14dup|||||||rs111322292|1||-1|||sequence_alteration|HGNC|17089||||ENSP00000390975||E9PEL9|UPI0000D626B8||1|||||||||||0.09769|0.07297|0.08854|0.133|0.1117|0.08963|0.1053|0.09|0.0739|0.08981|0.08905|uncertain_significance||1||||||,-|intron_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000448038|protein_coding||30/146|ENST00000448038.1:c.3691-14del|||||||rs111322292|2||-1|||sequence_alteration|HGNC|17089||||ENSP00000390975||E9PEL9|UPI0000D626B8||1|||||||||||0.1452|0.1587|0.147|0.1089|0.1278|0.1268|0.07806|0.1181|0.1783|0.1393|0.1231|uncertain_significance||1||||||,AA|intron_variant&non_coding_transcript_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000461872|retained_intron||27/54|ENST00000461872.2:n.3888-14dup|||||||rs111322292|1||-1|||sequence_alteration|HGNC|17089|||||||||1|||||||||||0.09769|0.07297|0.08854|0.133|0.1117|0.08963|0.1053|0.09|0.0739|0.08981|0.08905|uncertain_significance||1||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|SYNE1|ENSG00000131018|Transcript|ENST00000461872|retained_intron||27/54|ENST00000461872.2:n.3888-14del|||||||rs111322292|2||-1|||sequence_alteration|HGNC|17089|||||||||1|||||||||||0.1452|0.1587|0.147|0.1089|0.1278|0.1268|0.07806|0.1181|0.1783|0.1393|0.1231|uncertain_significance||1||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:5:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:5:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
6	158484691	.	CAAAAAAAAAAA	C	.	.	END=158484703;HOMLEN=17;HOMSEQ=AAAAAAAAAAAAAAAAA;SVLEN=-11;CSQ=-|intron_variant|MODIFIER|SYNJ2|ENSG00000078269|Transcript|ENST00000355585|protein_coding||8/26|ENST00000355585.4:c.1128-114_1128-104del|||||||rs71298907|1||1||1|deletion|HGNC|11504|YES||CCDS5254.1|ENSP00000347792|O15056|B4DLC4|UPI000006E2F8|NM_001178088.1&NM_003898.3|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|SYNJ2|ENSG00000078269|Transcript|ENST00000367121|protein_coding||8/26|ENST00000367121.3:c.1128-114_1128-104del|||||||rs71298907|1||1|||deletion|HGNC|11504||||ENSP00000356088|O15056||UPI0000074149||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|SYNJ2|ENSG00000078269|Transcript|ENST00000367122|protein_coding||8/25|ENST00000367122.2:c.1128-114_1128-104del|||||||rs71298907|1||1|||deletion|HGNC|11504||||ENSP00000356089||E7ER60|UPI0000D61505||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|SYNJ2|ENSG00000078269|Transcript|ENST00000449859|protein_coding||7/10|ENST00000449859.2:c.912-114_912-104del|||||||rs71298907|1||1|||deletion|HGNC|11504||||ENSP00000388371||Q5TA15&B4DJU8|UPI00017A709A||||||||||||||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|SYNJ2|ENSG00000078269|Transcript|ENST00000485863|nonsense_mediated_decay||5/5|ENST00000485863.1:c.*232-114_*232-104del|||||||rs71298907|1||1|cds_start_NF||deletion|HGNC|11504||||ENSP00000436657|||UPI000059D943||||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
6	163899794	.	CT	CTT,C	.	.	CSQ=TT|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000275262|protein_coding||2/6|ENST00000275262.7:c.286-17dup|||||||rs761851020|1||1|||sequence_alteration|HGNC|21100|||CCDS5287.1|ENSP00000275262|Q96PU8|F5H8C8&F5H5U6&F5GYM3&B4DHR6|UPI0000027E31||1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000275262|protein_coding||2/6|ENST00000275262.7:c.286-17del|||||||rs761851020|2||1|||sequence_alteration|HGNC|21100|||CCDS5287.1|ENSP00000275262|Q96PU8|F5H8C8&F5H5U6&F5GYM3&B4DHR6|UPI0000027E31||1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||,TT|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000361195|protein_coding||2/7|ENST00000361195.2:c.286-17dup|||||||rs761851020|1||1|||sequence_alteration|HGNC|21100||||ENSP00000354867|Q96PU8|F5H8C8&F5H5U6&F5GXS8|UPI0000D7E61B||1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000361195|protein_coding||2/7|ENST00000361195.2:c.286-17del|||||||rs761851020|2||1|||sequence_alteration|HGNC|21100||||ENSP00000354867|Q96PU8|F5H8C8&F5H5U6&F5GXS8|UPI0000D7E61B||1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||,TT|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000361752|protein_coding||2/7|ENST00000361752.3:c.286-17dup|||||||rs761851020|1||1||1|sequence_alteration|HGNC|21100|YES||CCDS5285.1|ENSP00000355094|Q96PU8|F5H8C8&F5H5U6&F5GYM3|UPI0000029EBD|NM_006775.2&NM_206855.2&NM_206854.2&NM_206853.2|1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000361752|protein_coding||2/7|ENST00000361752.3:c.286-17del|||||||rs761851020|2||1||1|sequence_alteration|HGNC|21100|YES||CCDS5285.1|ENSP00000355094|Q96PU8|F5H8C8&F5H5U6&F5GYM3|UPI0000029EBD|NM_006775.2&NM_206855.2&NM_206854.2&NM_206853.2|1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000361758|nonsense_mediated_decay||2/7|ENST00000361758.4:c.286-17dup|||||||rs761851020|1||1|||sequence_alteration|HGNC|21100|||CCDS5286.1|ENSP00000354951|Q96PU8|F5H8C8&F5H5U6&F5GYM3|UPI0000071672||1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000361758|nonsense_mediated_decay||2/7|ENST00000361758.4:c.286-17del|||||||rs761851020|2||1|||sequence_alteration|HGNC|21100|||CCDS5286.1|ENSP00000354951|Q96PU8|F5H8C8&F5H5U6&F5GYM3|UPI0000071672||1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||,TT|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000392127|protein_coding||2/5|ENST00000392127.2:c.286-17dup|||||||rs761851020|1||1|||sequence_alteration|HGNC|21100|||CCDS43525.1|ENSP00000375973|Q96PU8|F5H8C8&F5H5U6&F5GYM3|UPI000006F328||1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000392127|protein_coding||2/5|ENST00000392127.2:c.286-17del|||||||rs761851020|2||1|||sequence_alteration|HGNC|21100|||CCDS43525.1|ENSP00000375973|Q96PU8|F5H8C8&F5H5U6&F5GYM3|UPI000006F328||1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||,TT|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000424802|protein_coding||2/6|ENST00000424802.3:c.286-17dup|||||||rs761851020|1||1|||sequence_alteration|HGNC|21100||||ENSP00000408382|Q96PU8|F5H8C8&F5H5U6&F5GXS8|UPI0000D7E61C||1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000424802|protein_coding||2/6|ENST00000424802.3:c.286-17del|||||||rs761851020|2||1|||sequence_alteration|HGNC|21100||||ENSP00000408382|Q96PU8|F5H8C8&F5H5U6&F5GXS8|UPI0000D7E61C||1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||,TT|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000453779|protein_coding||2/6|ENST00000453779.2:c.286-17dup|||||||rs761851020|1||1|||sequence_alteration|HGNC|21100|||CCDS5286.1|ENSP00000408775|Q96PU8|F5H8C8&F5H5U6&F5GYM3|UPI0000071672||1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000453779|protein_coding||2/6|ENST00000453779.2:c.286-17del|||||||rs761851020|2||1|||sequence_alteration|HGNC|21100|||CCDS5286.1|ENSP00000408775|Q96PU8|F5H8C8&F5H5U6&F5GYM3|UPI0000071672||1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||,TT|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000537041|protein_coding||2/5|ENST00000537041.1:c.121-17dup|||||||rs761851020|1||1|cds_end_NF||sequence_alteration|HGNC|21100||||ENSP00000440991||F5H8C8&F5H5U6&F5GXS8|UPI000204A7B3||1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000537041|protein_coding||2/5|ENST00000537041.1:c.121-17del|||||||rs761851020|2||1|cds_end_NF||sequence_alteration|HGNC|21100||||ENSP00000440991||F5H8C8&F5H5U6&F5GXS8|UPI000204A7B3||1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||,TT|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000537124|protein_coding||2/2|ENST00000537124.1:c.121-17dup|||||||rs761851020|1||1|cds_end_NF||sequence_alteration|HGNC|21100||||ENSP00000443106||F5H5U6|UPI000204A7B4||1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000537124|protein_coding||2/2|ENST00000537124.1:c.121-17del|||||||rs761851020|2||1|cds_end_NF||sequence_alteration|HGNC|21100||||ENSP00000443106||F5H5U6|UPI000204A7B4||1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||,TT|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000537883|protein_coding||1/5|ENST00000537883.1:c.91+23342dup|||||||rs761851020|1||1|cds_start_NF||sequence_alteration|HGNC|21100||||ENSP00000441773|||UPI000204A7B7||1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000537883|protein_coding||1/5|ENST00000537883.1:c.91+23342del|||||||rs761851020|2||1|cds_start_NF||sequence_alteration|HGNC|21100||||ENSP00000441773|||UPI000204A7B7||1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||,TT|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000544436|protein_coding||2/3|ENST00000544436.1:c.121-17dup|||||||rs761851020|1||1|cds_end_NF||sequence_alteration|HGNC|21100||||ENSP00000443690||F5H8C8&F5H5U6|UPI000204A7B2||1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000544436|protein_coding||2/3|ENST00000544436.1:c.121-17del|||||||rs761851020|2||1|cds_end_NF||sequence_alteration|HGNC|21100||||ENSP00000443690||F5H8C8&F5H5U6|UPI000204A7B2||1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||,TT|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000544823|protein_coding||1/4|ENST00000544823.1:c.121-17dup|||||||rs761851020|1||1|cds_end_NF||sequence_alteration|HGNC|21100||||ENSP00000440599||F5H8C8&F5H5U6&F5GYM3|UPI000204A7B6||1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000544823|protein_coding||1/4|ENST00000544823.1:c.121-17del|||||||rs761851020|2||1|cds_end_NF||sequence_alteration|HGNC|21100||||ENSP00000440599||F5H8C8&F5H5U6&F5GYM3|UPI000204A7B6||1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000545346|nonsense_mediated_decay||3/4|ENST00000545346.1:c.*166-17dup|||||||rs761851020|1||1|||sequence_alteration|HGNC|21100||||ENSP00000441252||F5GYT7|UPI000204A7B5||1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000545346|nonsense_mediated_decay||3/4|ENST00000545346.1:c.*166-17del|||||||rs761851020|2||1|||sequence_alteration|HGNC|21100||||ENSP00000441252||F5GYT7|UPI000204A7B5||1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000545607|nonsense_mediated_decay||1/6|ENST00000545607.1:c.99-17dup|||||||rs761851020|1||1|cds_start_NF||sequence_alteration|HGNC|21100||||ENSP00000437867|||UPI000204A7B1||1|||||||||||0.1432|0.06338|0.1541|0.2523|0.1824|0.2164|0.1506|0.07812|0.1258|0.1831|0.2007|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|QKI|ENSG00000112531|Transcript|ENST00000545607|nonsense_mediated_decay||1/6|ENST00000545607.1:c.99-17del|||||||rs761851020|2||1|cds_start_NF||sequence_alteration|HGNC|21100||||ENSP00000437867|||UPI000204A7B1||1|||||||||||0.1279|0.1478|0.1365|0.09755|0.1539|0.1666|0.1478|0.07404|0.1415|0.1448|0.1583|||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:36:.,.,.,.:.:.:PASS:0	0/2:22:24,2,3,0:.:2:PASS:3	0/1:36:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/2:22:24,2,3,0:.:5:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/2:.:.,.,.,.:.:2:PASS:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
7	122269207	.	CT	C	.	.	END=122269209;HOMLEN=9;HOMSEQ=TTTTTTTTT;SVLEN=-1;CSQ=-|intron_variant|MODIFIER|CADPS2|ENSG00000081803|Transcript|ENST00000313070|protein_coding||4/27|ENST00000313070.7:c.867+94del|||||||rs796823921|1||-1|||deletion|HGNC|16018||||ENSP00000325581||F8W8P5|UPI00015E052E||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CADPS2|ENSG00000081803|Transcript|ENST00000334010|protein_coding||4/27|ENST00000334010.7:c.867+94del|||||||rs796823921|1||-1|||deletion|HGNC|16018||||ENSP00000333940||C9IYE1|UPI0001AE70C0|NM_001167940.1|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CADPS2|ENSG00000081803|Transcript|ENST00000412584|protein_coding||4/27|ENST00000412584.2:c.867+94del|||||||rs796823921|1||-1|||deletion|HGNC|16018|||CCDS47691.1|ENSP00000400401|Q86UW7||UPI000013F445|NM_001009571.3|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CADPS2|ENSG00000081803|Transcript|ENST00000449022|protein_coding||4/29|ENST00000449022.2:c.867+94del|||||||rs796823921|1||-1||1|deletion|HGNC|16018|YES||CCDS55158.1|ENSP00000398481|Q86UW7|B3KNS2|UPI0000668808|NM_017954.10|||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:4:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:4:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
7	135099044	.	TA	T,TAA	.	.	CSQ=-|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000315544|protein_coding||5/10|ENST00000315544.5:c.561+35del|||||||rs567428044|1||-1|||sequence_alteration|HGNC|7880|||CCDS55166.1|ENSP00000326731|O95628||UPI000020FB5C|NM_001190848.1||||||||||||||0.3464|0.3028|0.3735|0.3747|0.352|0.2811|0.3444|0.3483|0.3852|||||||||,AA|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000315544|protein_coding||5/10|ENST00000315544.5:c.561+35dup|||||||rs567428044|2||-1|||sequence_alteration|HGNC|7880|||CCDS55166.1|ENSP00000326731|O95628||UPI000020FB5C|NM_001190848.1||||||||||||||0.05777|0.05591|0.0714|0.07313|0.06636|0.05845|0.0501|0.06431|0.06726|||||||||,-|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000356162|protein_coding||5/10|ENST00000356162.4:c.561+35del|||||||rs567428044|1||-1|||sequence_alteration|HGNC|7880||||ENSP00000348485|O95628||UPI00000736D7|||||||||||||||0.3464|0.3028|0.3735|0.3747|0.352|0.2811|0.3444|0.3483|0.3852|||||||||,AA|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000356162|protein_coding||5/10|ENST00000356162.4:c.561+35dup|||||||rs567428044|2||-1|||sequence_alteration|HGNC|7880||||ENSP00000348485|O95628||UPI00000736D7|||||||||||||||0.05777|0.05591|0.0714|0.07313|0.06636|0.05845|0.0501|0.06431|0.06726|||||||||,-|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000361528|protein_coding||5/10|ENST00000361528.4:c.561+35del|||||||rs567428044|1||-1|||sequence_alteration|HGNC|7880|||CCDS43650.1|ENSP00000354673|O95628||UPI000049A62D|||||||||||||||0.3464|0.3028|0.3735|0.3747|0.352|0.2811|0.3444|0.3483|0.3852|||||||||,AA|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000361528|protein_coding||5/10|ENST00000361528.4:c.561+35dup|||||||rs567428044|2||-1|||sequence_alteration|HGNC|7880|||CCDS43650.1|ENSP00000354673|O95628||UPI000049A62D|||||||||||||||0.05777|0.05591|0.0714|0.07313|0.06636|0.05845|0.0501|0.06431|0.06726|||||||||,-|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000414802|protein_coding||4/9|ENST00000414802.1:c.561+35del|||||||rs567428044|1||-1|||sequence_alteration|HGNC|7880||||ENSP00000416532|O95628||UPI00000736D7|||||||||||||||0.3464|0.3028|0.3735|0.3747|0.352|0.2811|0.3444|0.3483|0.3852|||||||||,AA|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000414802|protein_coding||4/9|ENST00000414802.1:c.561+35dup|||||||rs567428044|2||-1|||sequence_alteration|HGNC|7880||||ENSP00000416532|O95628||UPI00000736D7|||||||||||||||0.05777|0.05591|0.0714|0.07313|0.06636|0.05845|0.0501|0.06431|0.06726|||||||||,-|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000423368|protein_coding||5/10|ENST00000423368.2:c.561+35del|||||||rs567428044|1||-1|||sequence_alteration|HGNC|7880|||CCDS55164.1|ENSP00000406777|O95628||UPI00003519C7|NM_001190847.1&NM_013316.3||||||||||||||0.3464|0.3028|0.3735|0.3747|0.352|0.2811|0.3444|0.3483|0.3852|||||||||,AA|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000423368|protein_coding||5/10|ENST00000423368.2:c.561+35dup|||||||rs567428044|2||-1|||sequence_alteration|HGNC|7880|||CCDS55164.1|ENSP00000406777|O95628||UPI00003519C7|NM_001190847.1&NM_013316.3||||||||||||||0.05777|0.05591|0.0714|0.07313|0.06636|0.05845|0.0501|0.06431|0.06726|||||||||,-|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000428680|protein_coding||5/10|ENST00000428680.2:c.561+35del|||||||rs567428044|1||-1|||sequence_alteration|HGNC|7880|||CCDS47719.1|ENSP00000399108|O95628||UPI000013E860|NM_001008225.2||||||||||||||0.3464|0.3028|0.3735|0.3747|0.352|0.2811|0.3444|0.3483|0.3852|||||||||,AA|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000428680|protein_coding||5/10|ENST00000428680.2:c.561+35dup|||||||rs567428044|2||-1|||sequence_alteration|HGNC|7880|||CCDS47719.1|ENSP00000399108|O95628||UPI000013E860|NM_001008225.2||||||||||||||0.05777|0.05591|0.0714|0.07313|0.06636|0.05845|0.0501|0.06431|0.06726|||||||||,-|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000451834|protein_coding||5/11|ENST00000451834.1:c.561+35del|||||||rs567428044|1||-1|||sequence_alteration|HGNC|7880|||CCDS55167.1|ENSP00000388491|O95628||UPI0000D9A96A|||||||||||||||0.3464|0.3028|0.3735|0.3747|0.352|0.2811|0.3444|0.3483|0.3852|||||||||,AA|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000451834|protein_coding||5/11|ENST00000451834.1:c.561+35dup|||||||rs567428044|2||-1|||sequence_alteration|HGNC|7880|||CCDS55167.1|ENSP00000388491|O95628||UPI0000D9A96A|||||||||||||||0.05777|0.05591|0.0714|0.07313|0.06636|0.05845|0.0501|0.06431|0.06726|||||||||,-|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000541284|protein_coding||5/11|ENST00000541284.1:c.561+35del|||||||rs567428044|1||-1||1|sequence_alteration|HGNC|7880|YES||CCDS55165.1|ENSP00000445508|O95628||UPI00004166A8|NM_001190849.1&NM_001190850.1||||||||||||||0.3464|0.3028|0.3735|0.3747|0.352|0.2811|0.3444|0.3483|0.3852|||||||||,AA|intron_variant|MODIFIER|CNOT4|ENSG00000080802|Transcript|ENST00000541284|protein_coding||5/11|ENST00000541284.1:c.561+35dup|||||||rs567428044|2||-1||1|sequence_alteration|HGNC|7880|YES||CCDS55165.1|ENSP00000445508|O95628||UPI00004166A8|NM_001190849.1&NM_001190850.1||||||||||||||0.05777|0.05591|0.0714|0.07313|0.06636|0.05845|0.0501|0.06431|0.06726|||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001733471|||||||||||rs567428044|1|||||sequence_alteration||||||||||||||||||||||||0.3464|0.3028|0.3735|0.3747|0.352|0.2811|0.3444|0.3483|0.3852|||||||||,AA|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001733471|||||||||||rs567428044|2|||||sequence_alteration||||||||||||||||||||||||0.05777|0.05591|0.0714|0.07313|0.06636|0.05845|0.0501|0.06431|0.06726|||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:9:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:9:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
7	144532829	.	A	AG	.	.	END=144532830;HOMLEN=2;HOMSEQ=GG;SVLEN=1;CSQ=G|intron_variant|MODIFIER|TPK1|ENSG00000196511|Transcript|ENST00000360057|protein_coding||1/8|ENST00000360057.3:c.-16-119dup|||||||rs111798915|1||-1||1|insertion|HGNC|17358|YES||CCDS5888.1|ENSP00000353165|Q9H3S4|Q75MX1&F8VRJ6|UPI000004FD50|NM_022445.3|1||||||0.4569|0.3184|0.0486|0.3757|0.1442||||||||||||||||||||,G|intron_variant&NMD_transcript_variant|MODIFIER|TPK1|ENSG00000196511|Transcript|ENST00000378098|nonsense_mediated_decay||1/9|ENST00000378098.4:c.-16-119dup|||||||rs111798915|1||-1|||insertion|HGNC|17358||||ENSP00000367338||F8WCM7|UPI00018814B8||1||||||0.4569|0.3184|0.0486|0.3757|0.1442||||||||||||||||||||,G|intron_variant|MODIFIER|TPK1|ENSG00000196511|Transcript|ENST00000378099|protein_coding||1/7|ENST00000378099.3:c.-16-119dup|||||||rs111798915|1||-1|||insertion|HGNC|17358|||CCDS55178.1|ENSP00000367339||F5GZG6|UPI00001AEE82|NM_001042482.1|1||||||0.4569|0.3184|0.0486|0.3757|0.1442||||||||||||||||||||,G|intron_variant&non_coding_transcript_variant|MODIFIER|TPK1|ENSG00000196511|Transcript|ENST00000548460|processed_transcript||1/1|ENST00000548460.1:n.34-119dup|||||||rs111798915|1||-1|||insertion|HGNC|17358|||||||||1||||||0.4569|0.3184|0.0486|0.3757|0.1442||||||||||||||||||||,G|intron_variant|MODIFIER|TPK1|ENSG00000196511|Transcript|ENST00000552881|protein_coding||1/6|ENST00000552881.1:c.-16-119dup|||||||rs111798915|1||-1|cds_end_NF||insertion|HGNC|17358||||ENSP00000448655||F8VRJ6|UPI00020CDF2D||1||||||0.4569|0.3184|0.0486|0.3757|0.1442||||||||||||||||||||,G|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000219489|||||||||||rs111798915|1|||||insertion|||||||||||||||||0.4569|0.3184|0.0486|0.3757|0.1442||||||||||||||||||||,G|TF_binding_site_variant|MODIFIER|||MotifFeature|ENSM00907117766|||||||||||rs111798915|1||-1|||insertion|||||||||||||||||0.4569|0.3184|0.0486|0.3757|0.1442||||||||||||||||ENSPFM0568|10|N||TEAD4::PAX5	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
7	150937074	.	CT	C	.	.	END=150937076;HOMLEN=17;HOMSEQ=TTTTTTTTTTTTTTTTT;SVLEN=-1;CSQ=-|downstream_gene_variant|MODIFIER|CHPF2|ENSG00000033100|Transcript|ENST00000035307|protein_coding||||||||||rs552440384|1|1167|1|||deletion|HGNC|29270|YES||CCDS34779.1|ENSP00000035307|Q9P2E5||UPI000003F537|NM_019015.1|||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|intron_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000262188|protein_coding||10/12|ENST00000262188.8:c.1173+123del|||||||rs552440384|1||-1||1|deletion|HGNC|11108|YES||CCDS34780.1|ENSP00000262188|Q6STE5||UPI000022D4B4|NM_001003801.1|||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|intron_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000356800|protein_coding||11/13|ENST00000356800.2:c.1134+123del|||||||rs552440384|1||-1|||deletion|HGNC|11108|||CCDS5924.1|ENSP00000349254|Q6STE5|C9JYI7|UPI000006E551|NM_001003802.1|||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|MIR671|ENSG00000211517|Transcript|ENST00000390183|miRNA||||||||||rs552440384|1|1451|1|||deletion|HGNC|33134|YES||||||||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|intron_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000392811|protein_coding||11/13|ENST00000392811.2:c.1134+123del|||||||rs552440384|1||-1|||deletion|HGNC|11108|||CCDS5924.1|ENSP00000376558|Q6STE5|C9JYI7|UPI000006E551|NM_003078.3|||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000460431|processed_transcript||||||||||rs552440384|1|2492|-1|||deletion|HGNC|11108|||||||||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|CHPF2|ENSG00000033100|Transcript|ENST00000465601|nonsense_mediated_decay||||||||||rs552440384|1|2396|1|cds_start_NF||deletion|HGNC|29270||||ENSP00000420204||H7C5L5|UPI0001B792A5||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000469154|nonsense_mediated_decay||8/10|ENST00000469154.1:c.*1716+123del|||||||rs552440384|1||-1|||deletion|HGNC|11108||||ENSP00000417908||F8WBJ3|UPI0001B792A6||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000470588|retained_intron||1/3|ENST00000470588.1:n.1381+123del|||||||rs552440384|1||-1|||deletion|HGNC|11108|||||||||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000472103|retained_intron||||||||||rs552440384|1|1810|-1|||deletion|HGNC|11108|||||||||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000472789|retained_intron||1/1|ENST00000472789.1:n.97+123del|||||||rs552440384|1||-1|||deletion|HGNC|11108|||||||||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000472988|retained_intron||||||||||rs552440384|1|911|-1|||deletion|HGNC|11108|||||||||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000477169|processed_transcript||||||||||rs552440384|1|1969|-1|||deletion|HGNC|11108|||||||||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|CHPF2|ENSG00000033100|Transcript|ENST00000482173|protein_coding||||||||||rs552440384|1|4720|1|cds_end_NF||deletion|HGNC|29270||||ENSP00000419769||C9JZF7|UPI0001B792A4||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000485592|nonsense_mediated_decay||||||||||rs552440384|1|433|-1|cds_start_NF||deletion|HGNC|11108||||ENSP00000417145|||UPI0001B792A7||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000485610|retained_intron||||||||||rs552440384|1|1269|-1|||deletion|HGNC|11108|||||||||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000489503|processed_transcript||||||||||rs552440384|1|1919|-1|||deletion|HGNC|11108|||||||||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000491651|protein_coding||||||||||rs552440384|1|2732|-1|cds_end_NF||deletion|HGNC|11108||||ENSP00000419886||C9JYI7|UPI0001B792A9||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|CHPF2|ENSG00000033100|Transcript|ENST00000495645|protein_coding||||||||||rs552440384|1|1170|1|||deletion|HGNC|29270|||CCDS64803.1|ENSP00000418914||G5E9W2|UPI00001C1E65|NM_001284295.1|||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|SMARCD3|ENSG00000082014|Transcript|ENST00000496530|processed_transcript||||||||||rs552440384|1|519|-1|||deletion|HGNC|11108|||||||||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|RP4-548D19.3|ENSG00000272661|Transcript|ENST00000607902|antisense||||||||||rs552440384|1|410|1|||deletion|Clone_based_vega_gene||YES||||||||||||||0.3548|0.33|0.3869|0.3608|0.3538||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
8	55542730	.	CTTTGAAATGCTTGGTCAA	C	.	.	CSQ=-|inframe_deletion|MODERATE|RP1|ENSG00000104237|Transcript|ENST00000220676|protein_coding|4/4||ENST00000220676.1:c.6289_6306del|ENSP00000220676.1:p.Phe2097_Gln2102del|6437-6454/7100|6289-6306/6471|2097-2102/2156|FEMLGQ/-|TTTGAAATGCTTGGTCAA/-||1||1||1|deletion|HGNC|10263|YES||CCDS6160.1|ENSP00000220676|P56715|A0FDN2|UPI000013455B|NM_006269.1|1|||PANTHER:PTHR23005&PANTHER:PTHR23005:SF4|||||||||||||||||||||||||||	GT:AD:BQ:SS:DP:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50:FT:DP4	0/0:73:.:.:58:58:73,73:0,0:0,0:56.95:0.07:0:PASS:.,.,.,.	0/1:27:.:2:30:33:27,27:7,7:4,4:32.82:0:0:PASS:21,9,3,4	0/0:.:.:.:58:.:.,.:.,.:.,.:.:.:.:PASS:.,.,.,.	0/1:.:.:2:30:.:.,.:.,.:.,.:.:.:.:PASS:21,9,3,4	0/0:73:.:.:58:58:73,73:0,0:0,0:56.95:0.07:0:PASS:.,.,.,.	0/1:27:.:2:33:33:27,27:7,7:4,4:32.82:0:0:PASS:.,.,.,.	0/0:0:.:.:.:.:.,.:.,.:.,.:.:.:.:PASS:.,.,.,.	0/1:7:.:2:.:.:.,.:.,.:.,.:.:.:.:PASS:.,.,.,.	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.:.,.,.,.
8	124382376	.	TA	T	.	.	END=124382378;HOMLEN=12;HOMSEQ=AAAAAAAAAAAA;SVLEN=-1;CSQ=-|intron_variant|MODIFIER|ATAD2|ENSG00000156802|Transcript|ENST00000287394|protein_coding||6/27|ENST00000287394.5:c.728-113del|||||||rs563477611|1||-1||1|deletion|HGNC|30123|YES||CCDS6343.1|ENSP00000287394|Q6PL18||UPI0000052A8C|NM_014109.3|||||||||||||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATAD2|ENSG00000156802|Transcript|ENST00000517666|nonsense_mediated_decay||5/25|ENST00000517666.1:c.*384-113del|||||||rs563477611|1||-1|||deletion|HGNC|30123||||ENSP00000429331||E5RIP2|UPI00020CDF27||||||||||||||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATAD2|ENSG00000156802|Transcript|ENST00000519124|nonsense_mediated_decay||6/27|ENST00000519124.1:c.*540-115del|||||||rs563477611|1||-1|||deletion|HGNC|30123||||ENSP00000429617||E5RHW7|UPI0001E8F202||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATAD2|ENSG00000156802|Transcript|ENST00000521496|retained_intron||6/18|ENST00000521496.1:n.772-113del|||||||rs563477611|1||-1|||deletion|HGNC|30123|||||||||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|ATAD2|ENSG00000156802|Transcript|ENST00000521903|protein_coding||7/28|ENST00000521903.1:c.-1292-113del|||||||rs563477611|1||-1|||deletion|HGNC|30123||||ENSP00000429213|||UPI00005DC4BE||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ATAD2|ENSG00000156802|Transcript|ENST00000530065|retained_intron||||||||||rs563477611|1|2525|-1|||deletion|HGNC|30123|||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|ATAD2|ENSG00000156802|Transcript|ENST00000534257|processed_transcript||||||||||rs563477611|1|749|-1|||deletion|HGNC|30123|||||||||||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
9	37305829	.	GAT	G	.	.	CSQ=-|intron_variant|MODIFIER|ZCCHC7|ENSG00000147905|Transcript|ENST00000336755|protein_coding||5/8|ENST00000336755.5:c.951+136_951+137del|||||||rs3837244|1||1||1|deletion|HGNC|26209|YES||CCDS6608.2|ENSP00000337839|Q8N3Z6|B4E024|UPI0000036027|NM_032226.2|||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ZCCHC7|ENSG00000147905|Transcript|ENST00000461038|processed_transcript||5/8|ENST00000461038.1:n.1231+136_1231+137del|||||||rs3837244|1||1|||deletion|HGNC|26209|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ZCCHC7|ENSG00000147905|Transcript|ENST00000463625|processed_transcript||4/6|ENST00000463625.2:n.507+136_507+137del|||||||rs3837244|1||1|||deletion|HGNC|26209|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ZCCHC7|ENSG00000147905|Transcript|ENST00000488607|processed_transcript||5/8|ENST00000488607.1:n.491+136_491+137del|||||||rs3837244|1||1|||deletion|HGNC|26209|||||||||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|ZCCHC7|ENSG00000147905|Transcript|ENST00000534928|protein_coding||4/7|ENST00000534928.1:c.81+136_81+137del|||||||rs3837244|1||1|||deletion|HGNC|26209||||ENSP00000443113||B4E024|UPI0000417C1C||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:7:.,.,.,.:.:.:PASS:0	0/1:12:0,12,0,2:.:2:PASS:3	0/0:7:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:12:0,12,0,2:.:2:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
9	95039956	.	TA	T	.	.	CSQ=-|intron_variant|MODIFIER|IARS|ENSG00000196305|Transcript|ENST00000375629|protein_coding||9/34|ENST00000375629.3:c.-1948+188del|||||||rs34636470|1||-1|||deletion|HGNC|5330||||ENSP00000364780||Q5TCC6|UPI000046FD0E||1||||||0.4667|0.3646|0.3214|0.3837|0.3252||||||||||||||||||||,-|intron_variant|MODIFIER|IARS|ENSG00000196305|Transcript|ENST00000375643|protein_coding||9/33|ENST00000375643.3:c.894+188del|||||||rs34636470|1||-1||1|deletion|HGNC|5330|YES||CCDS6694.1|ENSP00000364794|P41252|Q9P1N9&Q7L4K8&Q5TCD1&Q5TCC4&Q59G75&J3KR24|UPI0000141335|NM_013417.3|1||||||0.4667|0.3646|0.3214|0.3837|0.3252||||||||||||||||||||,-|intron_variant|MODIFIER|IARS|ENSG00000196305|Transcript|ENST00000395554|protein_coding||9/9|ENST00000395554.3:c.894+188del|||||||rs34636470|1||-1|cds_end_NF||deletion|HGNC|5330||||ENSP00000378922||Q5TCD1|UPI000046FD12||1||||||0.4667|0.3646|0.3214|0.3837|0.3252||||||||||||||||||||,-|intron_variant|MODIFIER|IARS|ENSG00000196305|Transcript|ENST00000443024|protein_coding||9/33|ENST00000443024.2:c.894+188del|||||||rs34636470|1||-1|||deletion|HGNC|5330|||CCDS6694.1|ENSP00000406448|P41252|Q9P1N9&Q7L4K8&Q5TCD1&Q5TCC4&Q59G75&J3KR24|UPI0000141335|NM_002161.5|1||||||0.4667|0.3646|0.3214|0.3837|0.3252||||||||||||||||||||,-|intron_variant|MODIFIER|IARS|ENSG00000196305|Transcript|ENST00000447699|protein_coding||8/32|ENST00000447699.2:c.564+188del|||||||rs34636470|1||-1|||deletion|HGNC|5330||||ENSP00000415020||Q9P1N9&Q7L4K8&Q5TCC4&J3KR24|UPI0000D618B6||1||||||0.4667|0.3646|0.3214|0.3837|0.3252||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|IARS|ENSG00000196305|Transcript|ENST00000498025|processed_transcript||||||||||rs34636470|1|188|-1|||deletion|HGNC|5330|||||||||1||||||0.4667|0.3646|0.3214|0.3837|0.3252||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:6:.,.,.,.:.:.:PASS:0	0/1:6:6,0,2,0:.:2:PASS:3	0/1:6:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:6:6,0,2,0:.:1:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
9	130950344	.	ACCC	A	.	.	CSQ=-|intron_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000277465|protein_coding||2/16|ENST00000277465.4:c.287-134_287-132del|||||||rs370607901|1||-1|||deletion|HGNC|16744||||ENSP00000277465||Q9Y3F8&Q5SYW2&F6WSM2&F6VD24|UPI00004701A9||1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000324544|protein_coding||3/6|ENST00000324544.2:c.287-134_287-132del|||||||rs370607901|1||-1|cds_end_NF||deletion|HGNC|16744||||ENSP00000321780||F6WSM2&F6VD24|UPI00004701AA||1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000325721|protein_coding||3/15|ENST00000325721.8:c.286+2261_286+2263del|||||||rs370607901|1||-1|||deletion|HGNC|16744||||ENSP00000320374|Q9ULV3|Q9Y3F8&H0Y5D5&B0EXJ7|UPI0000367687||1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000357558|protein_coding||3/17|ENST00000357558.5:c.287-134_287-132del|||||||rs370607901|1||-1|||deletion|HGNC|16744||||ENSP00000350169||Q9Y3F8&Q5SYW2&F6WSM2&F6VD24|UPI00004701A9|NM_001131017.1|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000372938|protein_coding||3/16|ENST00000372938.5:c.287-134_287-132del|||||||rs370607901|1||-1|||deletion|HGNC|16744|||CCDS6894.1|ENSP00000362029|Q9ULV3|Q9Y3F8&F6WSM2&F6VD24&B0EXJ7|UPI0000141722|NM_001131016.1|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000372948|protein_coding||3/17|ENST00000372948.3:c.287-134_287-132del|||||||rs370607901|1||-1|||deletion|HGNC|16744|||CCDS48034.1|ENSP00000362039|Q9ULV3|Q9Y3F8&F6WSM2&F6VD24|UPI0000141718|NM_001131015.1|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000372954|protein_coding||3/16|ENST00000372954.1:c.286+2261_286+2263del|||||||rs370607901|1||-1|||deletion|HGNC|16744|||CCDS48033.1|ENSP00000362045|Q9ULV3|Q9Y3F8|UPI0000071554|NM_001131018.1|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000393608|protein_coding||3/16|ENST00000393608.1:c.287-134_287-132del|||||||rs370607901|1||-1||1|deletion|HGNC|16744|YES||CCDS6894.1|ENSP00000377232|Q9ULV3|Q9Y3F8&F6WSM2&F6VD24&B0EXJ7|UPI0000141722|NM_012127.2|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000415526|protein_coding||2/14|ENST00000415526.1:c.139+2261_139+2263del|||||||rs370607901|1||-1|cds_start_NF||deletion|HGNC|16744||||ENSP00000398011||Q9Y3F8&H0Y5D5&B0EXJ7|UPI00004701A8||1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000420484|protein_coding||3/4|ENST00000420484.1:c.287-134_287-132del|||||||rs370607901|1||-1|cds_end_NF||deletion|HGNC|16744||||ENSP00000407265||F6WSM2|UPI00004701AB||1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000467178|processed_transcript||3/5|ENST00000467178.1:n.417+2261_417+2263del|||||||rs370607901|1||-1|||deletion|HGNC|16744|||||||||1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000474442|processed_transcript||1/3|ENST00000474442.1:n.140-134_140-132del|||||||rs370607901|1||-1|||deletion|HGNC|16744|||||||||1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000476727|processed_transcript||3/12|ENST00000476727.2:n.186-134_186-132del|||||||rs370607901|1||-1|||deletion|HGNC|16744|||||||||1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000488559|processed_transcript||2/5|ENST00000488559.2:n.197-2334_197-2332del|||||||rs370607901|1||-1|||deletion|HGNC|16744|||||||||1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000491954|processed_transcript||2/6|ENST00000491954.1:n.264-134_264-132del|||||||rs370607901|1||-1|||deletion|HGNC|16744|||||||||1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000498156|processed_transcript||1/4|ENST00000498156.1:n.172-2292_172-2290del|||||||rs370607901|1||-1|||deletion|HGNC|16744|||||||||1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000538431|protein_coding||3/17|ENST00000538431.1:c.287-134_287-132del|||||||rs370607901|1||-1|||deletion|HGNC|16744||||ENSP00000439244||Q9Y3F8&F6WSM2&F6VD24&F5H2X7|UPI0002065108|NM_001257975.1|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|CIZ1|ENSG00000148337|Transcript|ENST00000541172|protein_coding||2/15|ENST00000541172.1:c.-17-134_-17-132del|||||||rs370607901|1||-1|||deletion|HGNC|16744|||CCDS59147.1|ENSP00000445057|Q9ULV3|Q9Y3F8&B0EXJ7|UPI000191544E|NM_001257976.1|1||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT	0/0:7:0,7,0,0:0:.:PASS	0/1:7:0,4,0,3:39:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	0/0:7:0,7,0,0:0:.:PASS	0/1:7:0,4,0,3:39:2:PASS
9	136249406	.	GATAATG	GATG,GATATATG,GATA	.	.	CSQ=ATG|intron_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000371955|protein_coding||2/15|ENST00000371955.1:c.-951-231_-951-229del|||||||rs375935698|1||1|||indel|HGNC|28669||||ENSP00000361023|Q8NE28||UPI000035E82F||||||||||||||||||||||||||||||||,ATATATG|intron_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000371955|protein_coding||2/15|ENST00000371955.1:c.-951-231_-951-230insT||||||||2||1|||indel|HGNC|28669||||ENSP00000361023|Q8NE28||UPI000035E82F||||||||||||||||||||||||||||||||,ATA|intron_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000371955|protein_coding||2/15|ENST00000371955.1:c.-951-230_-951-228del|||||||rs370501667|3||1|||indel|HGNC|28669||||ENSP00000361023|Q8NE28||UPI000035E82F||||||||||||||||||||||||||||||||,ATG|intron_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000371957|protein_coding||2/17|ENST00000371957.3:c.175-231_175-229del|||||||rs375935698|1||1||1|indel|HGNC|28669|YES||CCDS35169.1|ENSP00000361025|Q8NE28||UPI00001D763E|NM_153710.4|||||||||||||||||||||||||||||||,ATATATG|intron_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000371957|protein_coding||2/17|ENST00000371957.3:c.175-231_175-230insT||||||||2||1||1|indel|HGNC|28669|YES||CCDS35169.1|ENSP00000361025|Q8NE28||UPI00001D763E|NM_153710.4|||||||||||||||||||||||||||||||,ATA|intron_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000371957|protein_coding||2/17|ENST00000371957.3:c.175-230_175-228del|||||||rs370501667|3||1||1|indel|HGNC|28669|YES||CCDS35169.1|ENSP00000361025|Q8NE28||UPI00001D763E|NM_153710.4|||||||||||||||||||||||||||||||,ATG|intron_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000426926|protein_coding||2/5|ENST00000426926.2:c.175-231_175-229del|||||||rs375935698|1||1|||indel|HGNC|28669||||ENSP00000398807||B4DH61|UPI00017A7039||||||||||||||||||||||||||||||||,ATATATG|intron_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000426926|protein_coding||2/5|ENST00000426926.2:c.175-231_175-230insT||||||||2||1|||indel|HGNC|28669||||ENSP00000398807||B4DH61|UPI00017A7039||||||||||||||||||||||||||||||||,ATA|intron_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000426926|protein_coding||2/5|ENST00000426926.2:c.175-230_175-228del|||||||rs370501667|3||1|||indel|HGNC|28669||||ENSP00000398807||B4DH61|UPI00017A7039||||||||||||||||||||||||||||||||,ATG|intron_variant&non_coding_transcript_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000468046|processed_transcript||1/1|ENST00000468046.1:n.86-231_86-229del|||||||rs375935698|1||1|||indel|HGNC|28669|||||||||||||||||||||||||||||||||||||||,ATATATG|intron_variant&non_coding_transcript_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000468046|processed_transcript||1/1|ENST00000468046.1:n.86-231_86-230insT||||||||2||1|||indel|HGNC|28669|||||||||||||||||||||||||||||||||||||||,ATA|intron_variant&non_coding_transcript_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000468046|processed_transcript||1/1|ENST00000468046.1:n.86-230_86-228del|||||||rs370501667|3||1|||indel|HGNC|28669|||||||||||||||||||||||||||||||||||||||,ATG|intron_variant&non_coding_transcript_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000475232|processed_transcript||1/2|ENST00000475232.1:n.67-231_67-229del|||||||rs375935698|1||1|||indel|HGNC|28669|||||||||||||||||||||||||||||||||||||||,ATATATG|intron_variant&non_coding_transcript_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000475232|processed_transcript||1/2|ENST00000475232.1:n.67-231_67-230insT||||||||2||1|||indel|HGNC|28669|||||||||||||||||||||||||||||||||||||||,ATA|intron_variant&non_coding_transcript_variant|MODIFIER|C9orf96|ENSG00000198870|Transcript|ENST00000475232|processed_transcript||1/2|ENST00000475232.1:n.67-230_67-228del|||||||rs370501667|3||1|||indel|HGNC|28669|||||||||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT	0/0:21:.,.,.,.:0:.:PASS	0/1:14:12,0,8,0:34:2:PASS	0/0:21:.,.,.,.:.:.:PASS	0/1:14:12,0,8,0:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	0/0:24:23,1,0,0:0:.:PASS	0/1:23:15,0,8,0:34:2:PASS
9	140161631	.	TGTGGGGCTGAG	T,TGTGGAG	.	.	CSQ=-|intron_variant|MODIFIER|NELFB|ENSG00000188986|Transcript|ENST00000343053|protein_coding||9/12|ENST00000343053.4:c.1239-60_1239-50del|||||||rs33923321|1||1||1|sequence_alteration|HGNC|24324|YES||CCDS7040.1|ENSP00000339495|Q8WX92||UPI0000070699|NM_015456.3|||||||0.0514|0.0014|0.0218|0|0.0215||||||||||||||||||||,GTGGAG|intron_variant|MODIFIER|NELFB|ENSG00000188986|Transcript|ENST00000343053|protein_coding||9/12|ENST00000343053.4:c.1239-56_1239-52del|||||||rs544060553|2||1||1|sequence_alteration|HGNC|24324|YES||CCDS7040.1|ENSP00000339495|Q8WX92||UPI0000070699|NM_015456.3|||||||0.5113|0.7421|0.4772|0.7097|0.6708||||||||||||||||||||	GT:AD:DP:BQ:SS:FT:DP4	0/0:0:15:.:.:PASS:.,.,.,.	0/2:4:20:.:2:PASS:7,11,1,4	0/0:.:15:.:.:PASS:.,.,.,.	0/2:.:20:.:2:PASS:7,11,1,4	./.:.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.,.,.	0/0:0:.:.:.:PindelReadSupport:.,.,.,.	0/1:4:.:.:2:PindelReadSupport:.,.,.,.	./.:.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.,.,.
10	8115955	.	A	ACC	.	.	CSQ=CC|frameshift_variant|HIGH|GATA3|ENSG00000107485|Transcript|ENST00000346208|protein_coding|6/6||ENST00000346208.3:c.1304_1305dup|ENSP00000341619.3:p.Ser436ProfsTer40|1756-1757/2654|1301-1302/1332|434/443|H/HX|cac/caCCc||1||1|||insertion|HGNC|4172|||CCDS7083.1|ENSP00000341619|P23771||UPI000004904B||1|||PIRSF:PIRSF003027&PANTHER:PTHR10071&PANTHER:PTHR10071:SF106|4||||||||||||||||||||||||||,CC|frameshift_variant|HIGH|GATA3|ENSG00000107485|Transcript|ENST00000379328|protein_coding|6/6||ENST00000379328.3:c.1307_1308dup|ENSP00000368632.3:p.Ser437ProfsTer40|1872-1873/3078|1304-1305/1335|435/444|H/HX|cac/caCCc||1||1||1|insertion|HGNC|4172|YES||CCDS31143.1|ENSP00000368632|P23771||UPI000002AA34|NM_001002295.1&NM_002051.2|1|||PANTHER:PTHR10071:SF106&PANTHER:PTHR10071&PIRSF:PIRSF003027|4||||||||||||||||||||||||||,CC|non_coding_transcript_exon_variant|MODIFIER|GATA3|ENSG00000107485|Transcript|ENST00000461472|processed_transcript|3/3||ENST00000461472.1:n.826_827dup||823-824/895||||||1||1|||insertion|HGNC|4172|||||||||1||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50:DP4	0/0:58:69:.:.:PASS:69:58,58:0,0:10,10:73.74:0.06:0:.,.,.,.	0/1:65:107:.:2:PASS:107:65,66:30,30:10,10:108.52:0.02:0:24,72,8,20	0/0:.:58:.:.:FalseIndel:.:.,.:.,.:.,.:.:.:.:.,.,.,.	0/1:.:99:.:2:FalseIndel:.:.,.:.,.:.,.:.:.:.:24,72,8,20	0/0:58:69:.:.:PASS:69:58,58:0,0:10,10:73.74:0.06:0:.,.,.,.	0/1:65:107:.:2:PASS:107:65,66:30,30:10,10:108.52:0.02:0:.,.,.,.	0/0:0:.:.:.:PASS:.:.,.:.,.:.,.:.:.:.:.,.,.,.	0/1:24:.:.:2:PASS:.:.,.:.,.:.,.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.,.,.,.
10	36811687	.	G	GGT	.	.	CSQ=GT|3_prime_UTR_variant|MODIFIER|NAMPTL|ENSG00000229644|Transcript|ENST00000440465|protein_coding|1/1||ENST00000440465.1:c.*55_*56dup||1475-1476/2514|||||rs143754208|1||-1|cds_start_NF|1|insertion|HGNC|17633|YES|||ENSP00000407952||Q658Z1&Q5SYT8&F5H246|UPI00004701B5||||||||0.1876|0.1571|0.1458|0.1869|0.1728||||||||||||||||||||,GT|splice_region_variant&intron_variant|LOW|NAMPTL|ENSG00000229644|Transcript|ENST00000543053|protein_coding||1/1|ENST00000543053.1:c.*25-7_*25-6dup|||||||rs143754208|1||-1|||insertion|HGNC|17633||||ENSP00000439553||Q658Z1&F5H246|UPI0002065A0C||||||||0.1876|0.1571|0.1458|0.1869|0.1728||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:77:.,.,.,.:.:.:PASS:0	0/1:95:97,3,24,0:.:2:PASS:11	0/0:77:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:95:97,3,24,0:.:2:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:11	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
10	75672607	.	C	CA,CAA	.	.	CSQ=A|intron_variant|MODIFIER|PLAU|ENSG00000122861|Transcript|ENST00000372762|protein_coding||3/9|ENST00000372762.4:c.86-63dup|||||||rs61567551|1||1|||insertion|HGNC|9052||||ENSP00000361848||Q9UEJ5&E7ESM2|UPI0000470216||1||||||0.1831|0.3991|0.2103|0.5586|0.3221||||||||||||||||||||,AA|intron_variant|MODIFIER|PLAU|ENSG00000122861|Transcript|ENST00000372762|protein_coding||3/9|ENST00000372762.4:c.86-64_86-63dup|||||||rs61567551|2||1|||insertion|HGNC|9052||||ENSP00000361848||Q9UEJ5&E7ESM2|UPI0000470216||1||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|PLAU|ENSG00000122861|Transcript|ENST00000372764|protein_coding||4/10|ENST00000372764.3:c.194-63dup|||||||rs61567551|1||1||1|insertion|HGNC|9052|YES||CCDS7339.1|ENSP00000361850|P00749|S4R3G7&Q9UEJ5&Q96SE8|UPI000013CB02|NM_002658.3|1||||||0.1831|0.3991|0.2103|0.5586|0.3221||||||||||||||||||||,AA|intron_variant|MODIFIER|PLAU|ENSG00000122861|Transcript|ENST00000372764|protein_coding||4/10|ENST00000372764.3:c.194-64_194-63dup|||||||rs61567551|2||1||1|insertion|HGNC|9052|YES||CCDS7339.1|ENSP00000361850|P00749|S4R3G7&Q9UEJ5&Q96SE8|UPI000013CB02|NM_002658.3|1||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|C10orf55|ENSG00000222047|Transcript|ENST00000409178|protein_coding||3/4|ENST00000409178.1:c.-41+193dup|||||||rs61567551|1||-1|||insertion|HGNC|31008|YES||CCDS53541.1|ENSP00000386960|Q5SWW7||UPI0000470217|NM_001001791.2|||||||0.1831|0.3991|0.2103|0.5586|0.3221||||||||||||||||||||,AA|intron_variant|MODIFIER|C10orf55|ENSG00000222047|Transcript|ENST00000409178|protein_coding||3/4|ENST00000409178.1:c.-41+192_-41+193dup|||||||rs61567551|2||-1|||insertion|HGNC|31008|YES||CCDS53541.1|ENSP00000386960|Q5SWW7||UPI0000470217|NM_001001791.2|||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|C10orf55|ENSG00000222047|Transcript|ENST00000412307|protein_coding||2/3|ENST00000412307.2:c.-41+193dup|||||||rs61567551|1||-1|||insertion|HGNC|31008|||CCDS53541.1|ENSP00000409225|Q5SWW7||UPI0000470217||||||||0.1831|0.3991|0.2103|0.5586|0.3221||||||||||||||||||||,AA|intron_variant|MODIFIER|C10orf55|ENSG00000222047|Transcript|ENST00000412307|protein_coding||2/3|ENST00000412307.2:c.-41+192_-41+193dup|||||||rs61567551|2||-1|||insertion|HGNC|31008|||CCDS53541.1|ENSP00000409225|Q5SWW7||UPI0000470217||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|PLAU|ENSG00000122861|Transcript|ENST00000446342|protein_coding||3/9|ENST00000446342.1:c.143-63dup|||||||rs61567551|1||1|||insertion|HGNC|9052|||CCDS44442.1|ENSP00000388474||Q9UEJ5&E7ET40|UPI0001AE6D3B|NM_001145031.1|1||||||0.1831|0.3991|0.2103|0.5586|0.3221||||||||||||||||||||,AA|intron_variant|MODIFIER|PLAU|ENSG00000122861|Transcript|ENST00000446342|protein_coding||3/9|ENST00000446342.1:c.143-64_143-63dup|||||||rs61567551|2||1|||insertion|HGNC|9052|||CCDS44442.1|ENSP00000388474||Q9UEJ5&E7ET40|UPI0001AE6D3B|NM_001145031.1|1||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|PLAU|ENSG00000122861|Transcript|ENST00000481390|protein_coding||4/4|ENST00000481390.1:c.194-63dup|||||||rs61567551|1||1|cds_end_NF||insertion|HGNC|9052||||ENSP00000474318||S4R3G7|UPI00033351E7||1||||||0.1831|0.3991|0.2103|0.5586|0.3221||||||||||||||||||||,AA|intron_variant|MODIFIER|PLAU|ENSG00000122861|Transcript|ENST00000481390|protein_coding||4/4|ENST00000481390.1:c.194-64_194-63dup|||||||rs61567551|2||1|cds_end_NF||insertion|HGNC|9052||||ENSP00000474318||S4R3G7|UPI00033351E7||1||||||||||||||||||||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|PLAU|ENSG00000122861|Transcript|ENST00000494287|processed_transcript||3/5|ENST00000494287.1:n.269-63dup|||||||rs61567551|1||1|||insertion|HGNC|9052|||||||||1||||||0.1831|0.3991|0.2103|0.5586|0.3221||||||||||||||||||||,AA|intron_variant&non_coding_transcript_variant|MODIFIER|PLAU|ENSG00000122861|Transcript|ENST00000494287|processed_transcript||3/5|ENST00000494287.1:n.269-64_269-63dup|||||||rs61567551|2||1|||insertion|HGNC|9052|||||||||1||||||||||||||||||||||||||||||,A|downstream_gene_variant|MODIFIER|PLAU|ENSG00000122861|Transcript|ENST00000496926|processed_transcript||||||||||rs61567551|1|1310|1|||insertion|HGNC|9052|||||||||1||||||0.1831|0.3991|0.2103|0.5586|0.3221||||||||||||||||||||,AA|downstream_gene_variant|MODIFIER|PLAU|ENSG00000122861|Transcript|ENST00000496926|processed_transcript||||||||||rs61567551|2|1310|1|||insertion|HGNC|9052|||||||||1||||||||||||||||||||||||||||||,A|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000029888|||||||||||rs61567551|1|||||insertion|||||||||||||||||0.1831|0.3991|0.2103|0.5586|0.3221||||||||||||||||||||,AA|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000029888|||||||||||rs61567551|2|||||insertion|||||||||||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:16:.,.,.,.:.:.:PASS:0	0/2:13:14,2,9,2:.:2:PASS:4	1/1:16:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	1/1:13:14,2,9,2:.:1:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/2:.:.,.,.,.:.:2:PASS:4	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
10	78839127	.	A	AGT,AGTGT	.	.	CSQ=GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000286627|protein_coding||13/26|ENST00000286627.5:c.1593+110_1593+111dup|||||||rs68133946|1||-1|||insertion|HGNC|6284|||CCDS7352.1|ENSP00000286627|Q12791||UPI00000724F1|NM_002247.3&NM_001271519.1|1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000286627|protein_coding||13/26|ENST00000286627.5:c.1593+108_1593+111dup|||||||rs68133946|2||-1|||insertion|HGNC|6284|||CCDS7352.1|ENSP00000286627|Q12791||UPI00000724F1|NM_002247.3&NM_001271519.1|1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000286628|protein_coding||13/27|ENST00000286628.8:c.1593+110_1593+111dup|||||||rs68133946|1||-1|||insertion|HGNC|6284|||CCDS60569.1|ENSP00000286628|Q12791|Q5SVK3|UPI00003519E7|NM_001161352.1|1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000286628|protein_coding||13/27|ENST00000286628.8:c.1593+108_1593+111dup|||||||rs68133946|2||-1|||insertion|HGNC|6284|||CCDS60569.1|ENSP00000286628|Q12791|Q5SVK3|UPI00003519E7|NM_001161352.1|1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000354353|protein_coding||13/28|ENST00000354353.5:c.1593+110_1593+111dup|||||||rs68133946|1||-1|||insertion|HGNC|6284||||ENSP00000346321||F8WA96|UPI00004563D4||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000354353|protein_coding||13/28|ENST00000354353.5:c.1593+108_1593+111dup|||||||rs68133946|2||-1|||insertion|HGNC|6284||||ENSP00000346321||F8WA96|UPI00004563D4||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000372403|protein_coding||13/28|ENST00000372403.4:c.1445+110_1445+111dup|||||||rs68133946|1||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000361480|||UPI000059D182||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000372403|protein_coding||13/28|ENST00000372403.4:c.1445+108_1445+111dup|||||||rs68133946|2||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000361480|||UPI000059D182||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000372408|protein_coding||13/28|ENST00000372408.2:c.1404+110_1404+111dup|||||||rs68133946|1||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000361485||Q5SVK0|UPI0000470249||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000372408|protein_coding||13/28|ENST00000372408.2:c.1404+108_1404+111dup|||||||rs68133946|2||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000361485||Q5SVK0|UPI0000470249||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000372421|protein_coding||13/27|ENST00000372421.5:c.1513+110_1513+111dup|||||||rs68133946|1||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000361498|||UPI000333501B||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000372421|protein_coding||13/27|ENST00000372421.5:c.1513+108_1513+111dup|||||||rs68133946|2||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000361498|||UPI000333501B||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000372437|protein_coding||13/28|ENST00000372437.1:c.1398+110_1398+111dup|||||||rs68133946|1||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000361514||Q5SVK5|UPI000047024F||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000372437|protein_coding||13/28|ENST00000372437.1:c.1398+108_1398+111dup|||||||rs68133946|2||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000361514||Q5SVK5|UPI000047024F||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000372440|protein_coding||13/27|ENST00000372440.1:c.1593+110_1593+111dup|||||||rs68133946|1||-1|||insertion|HGNC|6284||||ENSP00000361517|||UPI0000470248||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000372440|protein_coding||13/27|ENST00000372440.1:c.1593+108_1593+111dup|||||||rs68133946|2||-1|||insertion|HGNC|6284||||ENSP00000361517|||UPI0000470248||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000372443|protein_coding||13/28|ENST00000372443.1:c.1593+110_1593+111dup|||||||rs68133946|1||-1|||insertion|HGNC|6284||||ENSP00000361520||Q5SVJ7|UPI000047024C||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000372443|protein_coding||13/28|ENST00000372443.1:c.1593+108_1593+111dup|||||||rs68133946|2||-1|||insertion|HGNC|6284||||ENSP00000361520||Q5SVJ7|UPI000047024C||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000404771|protein_coding||13/29|ENST00000404771.3:c.1593+110_1593+111dup|||||||rs68133946|1||-1|||insertion|HGNC|6284||||ENSP00000385717||Q5SVJ8|UPI0002B8326C||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000404771|protein_coding||13/29|ENST00000404771.3:c.1593+108_1593+111dup|||||||rs68133946|2||-1|||insertion|HGNC|6284||||ENSP00000385717||Q5SVJ8|UPI0002B8326C||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000404857|protein_coding||13/27|ENST00000404857.1:c.1593+110_1593+111dup|||||||rs68133946|1||-1||1|insertion|HGNC|6284|YES||CCDS53545.1|ENSP00000385806|Q12791||UPI00003519E8|NM_001161353.1|1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000404857|protein_coding||13/27|ENST00000404857.1:c.1593+108_1593+111dup|||||||rs68133946|2||-1||1|insertion|HGNC|6284|YES||CCDS53545.1|ENSP00000385806|Q12791||UPI00003519E8|NM_001161353.1|1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000406533|protein_coding||13/28|ENST00000406533.3:c.1593+110_1593+111dup|||||||rs68133946|1||-1|||insertion|HGNC|6284||||ENSP00000385552||J3KQ16|UPI00004563D5||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000406533|protein_coding||13/28|ENST00000406533.3:c.1593+108_1593+111dup|||||||rs68133946|2||-1|||insertion|HGNC|6284||||ENSP00000385552||J3KQ16|UPI00004563D5||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000428546|protein_coding||1/5|ENST00000428546.1:c.44+110_44+111dup|||||||rs68133946|1||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000402254|||UPI000059D180||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000428546|protein_coding||1/5|ENST00000428546.1:c.44+108_44+111dup|||||||rs68133946|2||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000402254|||UPI000059D180||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000434208|protein_coding||6/21|ENST00000434208.1:c.628+110_628+111dup|||||||rs68133946|1||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000402150|||UPI000059D181||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000434208|protein_coding||6/21|ENST00000434208.1:c.628+108_628+111dup|||||||rs68133946|2||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000402150|||UPI000059D181||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000450795|protein_coding||1/6|ENST00000450795.1:c.70+110_70+111dup|||||||rs68133946|1||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000388370|||UPI000059D183||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000450795|protein_coding||1/6|ENST00000450795.1:c.70+108_70+111dup|||||||rs68133946|2||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000388370|||UPI000059D183||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000457953|protein_coding||13/28|ENST00000457953.1:c.1515+110_1515+111dup|||||||rs68133946|1||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000396608||Q5SVJ9|UPI000047024A||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000457953|protein_coding||13/28|ENST00000457953.1:c.1515+108_1515+111dup|||||||rs68133946|2||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000396608||Q5SVJ9|UPI000047024A||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant&non_coding_transcript_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000484343|processed_transcript||1/2|ENST00000484343.1:n.70+110_70+111dup|||||||rs68133946|1||-1|||insertion|HGNC|6284|||||||||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant&non_coding_transcript_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000484343|processed_transcript||1/2|ENST00000484343.1:n.70+108_70+111dup|||||||rs68133946|2||-1|||insertion|HGNC|6284|||||||||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant&non_coding_transcript_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000484507|processed_transcript||2/3|ENST00000484507.1:n.151+110_151+111dup|||||||rs68133946|1||-1|||insertion|HGNC|6284|||||||||1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant&non_coding_transcript_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000484507|processed_transcript||2/3|ENST00000484507.1:n.151+108_151+111dup|||||||rs68133946|2||-1|||insertion|HGNC|6284|||||||||1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000604624|protein_coding||12/27|ENST00000604624.1:c.1176+110_1176+111dup|||||||rs68133946|1||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000473714||S4R2X4|UPI000333518C|NM_001271518.1&NM_001014797.2|1||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|intron_variant|MODIFIER|KCNMA1|ENSG00000156113|Transcript|ENST00000604624|protein_coding||12/27|ENST00000604624.1:c.1176+108_1176+111dup|||||||rs68133946|2||-1|cds_start_NF||insertion|HGNC|6284||||ENSP00000473714||S4R2X4|UPI000333518C|NM_001271518.1&NM_001014797.2|1||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||,GT|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001524269|||||||||||rs68133946|1|||||insertion|||||||||||||||||0.2648|0.1542|0.3313|0.0974|0.2546||||||||||||||||||||,GTGT|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001524269|||||||||||rs68133946|2|||||insertion|||||||||||||||||0.2307|0.4222|0.2192|0.3877|0.274||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/2:7:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/2:7:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
11	120348771	.	G	GT	.	.	END=120348772;HOMLEN=12;HOMSEQ=TTTTTTTTTTTT;SVLEN=1;CSQ=T|intron_variant|MODIFIER|ARHGEF12|ENSG00000196914|Transcript|ENST00000356641|protein_coding||35/39|ENST00000356641.3:c.3476-82dup|||||||rs368383611|1||1|||insertion|HGNC|14193|||CCDS55794.1|ENSP00000349056|Q9NZN5|E9PMR6&B4E2K6|UPI00001C0372|NM_001198665.1|1||||||||||||||||||||||||||||||,T|intron_variant|MODIFIER|ARHGEF12|ENSG00000196914|Transcript|ENST00000397843|protein_coding||36/40|ENST00000397843.2:c.3533-82dup|||||||rs368383611|1||1||1|insertion|HGNC|14193|YES||CCDS41727.1|ENSP00000380942|Q9NZN5|E9PMR6|UPI00000708ED|NM_015313.2|1||||||||||||||||||||||||||||||,T|intron_variant&non_coding_transcript_variant|MODIFIER|ARHGEF12|ENSG00000196914|Transcript|ENST00000526067|retained_intron||3/4|ENST00000526067.1:n.942-82dup|||||||rs368383611|1||1|||insertion|HGNC|14193|||||||||1||||||||||||||||||||||||||||||,T|downstream_gene_variant|MODIFIER|ARHGEF12|ENSG00000196914|Transcript|ENST00000528681|retained_intron||||||||||rs368383611|1|489|1|||insertion|HGNC|14193|||||||||1||||||||||||||||||||||||||||||,T|downstream_gene_variant|MODIFIER|ARHGEF12|ENSG00000196914|Transcript|ENST00000529970|retained_intron||||||||||rs368383611|1|416|1|||insertion|HGNC|14193|||||||||1||||||||||||||||||||||||||||||,T|downstream_gene_variant|MODIFIER|ARHGEF12|ENSG00000196914|Transcript|ENST00000531616|retained_intron||||||||||rs368383611|1|4935|1|||insertion|HGNC|14193|||||||||1||||||||||||||||||||||||||||||,T|intron_variant|MODIFIER|ARHGEF12|ENSG00000196914|Transcript|ENST00000532993|protein_coding||36/40|ENST00000532993.1:c.3224-82dup|||||||rs368383611|1||1|||insertion|HGNC|14193||||ENSP00000432984||E9PMR6|UPI0001F78843||1||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
12	58187016	.	CT	C	.	.	CSQ=-|downstream_gene_variant|MODIFIER|AVIL|ENSG00000135407|Transcript|ENST00000257861|protein_coding||||||||||rs947862578|1|4648|-1|||deletion|HGNC|14188|YES||CCDS8959.1|ENSP00000257861|O75366|F8VVU1|UPI000013CF93|NM_006576.3|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|TSFM|ENSG00000123297|Transcript|ENST00000323833|protein_coding||6/6|ENST00000323833.8:c.634+170del|||||||rs947862578|1||1||1|deletion|HGNC|12367|YES||CCDS53809.1|ENSP00000313877|P43897||UPI000002A8C3|NM_001172696.1|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|TSFM|ENSG00000123297|Transcript|ENST00000350762|protein_coding||7/7|ENST00000350762.5:c.451+170del|||||||rs947862578|1||1|||deletion|HGNC|12367||||ENSP00000242983||F8W6R3|UPI0001AE6B0D||1||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|TSFM|ENSG00000123297|Transcript|ENST00000434359|protein_coding||||||||||rs947862578|1|161|1|cds_end_NF||deletion|HGNC|12367||||ENSP00000390679||C9JG32|UPI0001881AE1||1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|TSFM|ENSG00000123297|Transcript|ENST00000454289|protein_coding||5/5|ENST00000454289.3:c.571+170del|||||||rs947862578|1||1|||deletion|HGNC|12367|||CCDS8958.2|ENSP00000388330|P43897|E5KS95&C9JT21&C9JG32|UPI0000129D50|NM_005726.5|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|TSFM|ENSG00000123297|Transcript|ENST00000457189|protein_coding||5/5|ENST00000457189.1:c.421+170del|||||||rs947862578|1||1|cds_end_NF||deletion|HGNC|12367||||ENSP00000389162||C9JT21&C9JG32|UPI0001881AE2||1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|TSFM|ENSG00000123297|Transcript|ENST00000497617|processed_transcript||6/6|ENST00000497617.1:n.579+170del|||||||rs947862578|1||1|||deletion|HGNC|12367|||||||||1||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|AVIL|ENSG00000135407|Transcript|ENST00000537081|protein_coding||||||||||rs947862578|1|4148|-1|||deletion|HGNC|14188||||ENSP00000443207|O75366||UPI0001E88EA9||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|TSFM|ENSG00000123297|Transcript|ENST00000540550|protein_coding||4/4|ENST00000540550.1:c.484-2934del|||||||rs947862578|1||1|||deletion|HGNC|12367|||CCDS53811.1|ENSP00000440987|P43897||UPI0000EE26BD|NM_001172695.1|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|TSFM|ENSG00000123297|Transcript|ENST00000543727|protein_coding||5/5|ENST00000543727.1:c.571+170del|||||||rs947862578|1||1|||deletion|HGNC|12367|||CCDS53810.1|ENSP00000439342|P43897|C9JG32|UPI000189212F|NM_001172697.1|1||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|AVIL|ENSG00000135407|Transcript|ENST00000546952|retained_intron||||||||||rs947862578|1|4142|-1|||deletion|HGNC|14188|||||||||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|TSFM|ENSG00000123297|Transcript|ENST00000548851|protein_coding||5/5|ENST00000548851.1:c.571+170del|||||||rs947862578|1||1|||deletion|HGNC|12367||||ENSP00000450041||F8VPA7&C9JG32|UPI00020CE3D9||1||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|AVIL|ENSG00000135407|Transcript|ENST00000549851|nonsense_mediated_decay||||||||||rs947862578|1|4506|-1|||deletion|HGNC|14188||||ENSP00000450188||F8VNY0|UPI00020CE3DA||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|TSFM|ENSG00000123297|Transcript|ENST00000550559|protein_coding||5/6|ENST00000550559.1:c.571+170del|||||||rs947862578|1||1|||deletion|HGNC|12367||||ENSP00000448575||F8VS27&C9JG32|UPI00001FC657||1||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|AVIL|ENSG00000135407|Transcript|ENST00000551248|retained_intron||||||||||rs947862578|1|4544|-1|||deletion|HGNC|14188|||||||||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:24:.,.,.,.:.:.:PASS:0	0/1:19:1,19,0,3:.:2:PASS:3	0/0:24:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:19:1,19,0,3:.:2:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
12	75893478	.	CA	C	.	.	END=75893480;HOMLEN=12;HOMSEQ=AAAAAAAAAAAA;SVLEN=-1;CSQ=-|3_prime_UTR_variant|MODIFIER|KRR1|ENSG00000111615|Transcript|ENST00000229214|protein_coding|10/10||ENST00000229214.4:c.*110del||1280/4075|||||rs35207358|1||-1||1|deletion|HGNC|5176|YES||CCDS9012.1|ENSP00000229214|Q13601||UPI00001403EE|NM_007043.6|||||||0.4387|0.5216|0.4157|0.4483|0.502||||||||||||||||||||,-|3_prime_UTR_variant|MODIFIER|GLIPR1|ENSG00000139278|Transcript|ENST00000266659|protein_coding|6/6||ENST00000266659.3:c.*733del||1723/5877|||||rs35207358|1||1|||deletion|HGNC|17001|YES||CCDS9011.1|ENSP00000266659|P48060||UPI000012B60F|NM_006851.2|||||||0.4387|0.5216|0.4157|0.4483|0.502||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|KRR1|ENSG00000111615|Transcript|ENST00000438169|protein_coding||||||||||rs35207358|1|110|-1|||deletion|HGNC|5176||||ENSP00000411740|Q13601||UPI0001AE6AAF||||||||0.4387|0.5216|0.4157|0.4483|0.502||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|GLIPR1|ENSG00000139278|Transcript|ENST00000456650|protein_coding||||||||||rs35207358|1|982|1|cds_end_NF||deletion|HGNC|17001||||ENSP00000391144||F6VVE8|UPI00020CE2FC||||||||0.4387|0.5216|0.4157|0.4483|0.502||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|GLIPR1|ENSG00000139278|Transcript|ENST00000536703|nonsense_mediated_decay||||||||||rs35207358|1|406|1|||deletion|HGNC|17001||||ENSP00000440595||B4E3S5|UPI00017A891A||||||||0.4387|0.5216|0.4157|0.4483|0.502||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|GLIPR1|ENSG00000139278|Transcript|ENST00000550491|protein_coding||||||||||rs35207358|1|4037|1|cds_end_NF||deletion|HGNC|17001||||ENSP00000448008||J3QTC9|UPI00020CE2FD||||||||0.4387|0.5216|0.4157|0.4483|0.502||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|KRR1|ENSG00000111615|Transcript|ENST00000551070|retained_intron||||||||||rs35207358|1|131|-1|||deletion|HGNC|5176|||||||||||||||0.4387|0.5216|0.4157|0.4483|0.502||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
12	100930180	.	CT	C	.	.	CSQ=-|intron_variant|MODIFIER|NR1H4|ENSG00000012504|Transcript|ENST00000188403|protein_coding||4/8|ENST00000188403.7:c.751-99del|||||||rs113077673|1||1|||deletion|HGNC|7967|||CCDS55875.1|ENSP00000188403|Q96RI1||UPI000006EFC9|NM_001206993.1&NM_001206992.1|1||||||||||||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|NR1H4|ENSG00000012504|Transcript|ENST00000321046|nonsense_mediated_decay||6/10|ENST00000321046.5:c.721-94del|||||||rs113077673|1||1|||deletion|HGNC|7967||||ENSP00000315442||G8JLB0|UPI00020CE2BD||1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|NR1H4|ENSG00000012504|Transcript|ENST00000392986|protein_coding||6/10|ENST00000392986.3:c.733-99del|||||||rs113077673|1||1|||deletion|HGNC|7967|||CCDS55873.1|ENSP00000376712|Q96RI1|F1DAL1|UPI000013050E||1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|NR1H4|ENSG00000012504|Transcript|ENST00000548884|protein_coding||6/10|ENST00000548884.1:c.721-99del|||||||rs113077673|1||1|||deletion|HGNC|7967|||CCDS9078.1|ENSP00000448506|Q96RI1|B6ZGS9|UPI000002AFBD|NM_005123.3&NM_001206977.1&NM_001206979.1|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|NR1H4|ENSG00000012504|Transcript|ENST00000549996|protein_coding||5/9|ENST00000549996.1:c.580-99del|||||||rs113077673|1||1|||deletion|HGNC|7967|||CCDS55874.1|ENSP00000448978|Q96RI1||UPI00020CE2BE|NM_001206978.1|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|NR1H4|ENSG00000012504|Transcript|ENST00000551379|protein_coding||4/8|ENST00000551379.1:c.763-99del|||||||rs113077673|1||1||1|deletion|HGNC|7967|YES||CCDS55876.1|ENSP00000447149|Q96RI1|B7Z423|UPI000006E701||1||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT:DP4	0/0:0:21:.:.:PASS:.,.,.,.	0/1:3:16:.:2:PASS:16,0,3,0	0/0:.:21:.:.:VarscanHighConfidenceIndel:.,.,.,.	0/1:.:16:.:2:VarscanHighConfidenceIndel:16,0,3,0	./.:.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.,.,.	0/0:0:.:.:.:PASS:.,.,.,.	0/1:3:.:.:2:PASS:.,.,.,.	./.:.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.,.,.
12	110463769	.	C	CT	.	.	END=110463770;HOMLEN=15;HOMSEQ=TTTTTTTTTTTTTTT;SVLEN=1;CSQ=T|intron_variant|MODIFIER|ANKRD13A|ENSG00000076513|Transcript|ENST00000261739|protein_coding||8/14|ENST00000261739.4:c.883+156dup|||||||rs748271339|1||1||1|insertion|HGNC|21268|YES||CCDS9140.1|ENSP00000261739|Q8IZ07|Q3ZTS7&B4DDL0&B3KMT9|UPI000004472C|NM_033121.1|||||||||||||||||||||||||||||||,T|intron_variant&non_coding_transcript_variant|MODIFIER|ANKRD13A|ENSG00000076513|Transcript|ENST00000546476|retained_intron||2/4|ENST00000546476.1:n.576+156dup|||||||rs748271339|1||1|||insertion|HGNC|21268|||||||||||||||||||||||||||||||||||||||,T|downstream_gene_variant|MODIFIER|C12orf76|ENSG00000174456|Transcript|ENST00000546651|protein_coding||||||||||rs748271339|1|2102|-1|||insertion|HGNC|33790||||ENSP00000447351||F8VZK6|UPI0000E59950||||||||||||||||||||||||||||||||,T|upstream_gene_variant|MODIFIER|ANKRD13A|ENSG00000076513|Transcript|ENST00000547419|protein_coding||||||||||rs748271339|1|2593|1|cds_start_NF||insertion|HGNC|21268||||ENSP00000474745|||UPI00033350C1||||||||||||||||||||||||||||||||,T|intron_variant|MODIFIER|ANKRD13A|ENSG00000076513|Transcript|ENST00000547639|protein_coding||4/7|ENST00000547639.1:c.444+156dup|||||||rs748271339|1||1|cds_start_NF&cds_end_NF||insertion|HGNC|21268||||ENSP00000449781|||UPI00020CE467||||||||||||||||||||||||||||||||,T|upstream_gene_variant|MODIFIER|ANKRD13A|ENSG00000076513|Transcript|ENST00000549826|retained_intron||||||||||rs748271339|1|2982|1|||insertion|HGNC|21268|||||||||||||||||||||||||||||||||||||||,T|downstream_gene_variant|MODIFIER|ANKRD13A|ENSG00000076513|Transcript|ENST00000550404|processed_transcript||||||||||rs748271339|1|3500|1|||insertion|HGNC|21268|||||||||||||||||||||||||||||||||||||||,T|upstream_gene_variant|MODIFIER|ANKRD13A|ENSG00000076513|Transcript|ENST00000551491|protein_coding||||||||||rs748271339|1|3586|1|cds_start_NF||insertion|HGNC|21268||||ENSP00000447110||F8W150|UPI00033350A9||||||||||||||||||||||||||||||||,T|intron_variant&NMD_transcript_variant|MODIFIER|ANKRD13A|ENSG00000076513|Transcript|ENST00000553025|nonsense_mediated_decay||8/11|ENST00000553025.1:c.*224+156dup|||||||rs748271339|1||1|||insertion|HGNC|21268||||ENSP00000474172||S4R3D2|UPI00033350D1||||||||||||||||||||||||||||||||,T|upstream_gene_variant|MODIFIER|ANKRD13A|ENSG00000076513|Transcript|ENST00000553251|retained_intron||||||||||rs748271339|1|1934|1|||insertion|HGNC|21268|||||||||||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
13	95227137	.	AAAAG	A,AA	.	.	CSQ=-|intron_variant|MODIFIER|TGDS|ENSG00000088451|Transcript|ENST00000261296|protein_coding||11/11|ENST00000261296.5:c.983-35_983-32del|||||||rs373864754|1||-1||1|sequence_alteration|HGNC|20324|YES||CCDS9471.1|ENSP00000261296|O95455|Q2TU31|UPI000006E8F4|NM_014305.2|1|||||||||||0.07436|0.02589|0.03093|0.1043|0.01589|0.04089|0.0001321|0.02147|0.03722|0.03324|0.02268|||||||||,A|intron_variant|MODIFIER|TGDS|ENSG00000088451|Transcript|ENST00000261296|protein_coding||11/11|ENST00000261296.5:c.983-35_983-33del|||||||rs201674028|2||-1||1|sequence_alteration|HGNC|20324|YES||CCDS9471.1|ENSP00000261296|O95455|Q2TU31|UPI000006E8F4|NM_014305.2|1||||||0.6112|0.1988|0.0069|0.2873|0.1401|0.352|0.2172|0.1115|0.3381|0.06527|0.12|0.001773|0.08812|0.1365|0.1266|0.06702|||||||||,-|downstream_gene_variant|MODIFIER|TGDS|ENSG00000088451|Transcript|ENST00000470480|retained_intron||||||||||rs373864754|1|4399|-1|||sequence_alteration|HGNC|20324|||||||||1|||||||||||0.07436|0.02589|0.03093|0.1043|0.01589|0.04089|0.0001321|0.02147|0.03722|0.03324|0.02268|||||||||,A|downstream_gene_variant|MODIFIER|TGDS|ENSG00000088451|Transcript|ENST00000470480|retained_intron||||||||||rs201674028|2|4399|-1|||sequence_alteration|HGNC|20324|||||||||1||||||0.6112|0.1988|0.0069|0.2873|0.1401|0.352|0.2172|0.1115|0.3381|0.06527|0.12|0.001773|0.08812|0.1365|0.1266|0.06702|||||||||,-|downstream_gene_variant|MODIFIER|TGDS|ENSG00000088451|Transcript|ENST00000498294|processed_transcript||||||||||rs373864754|1|3843|-1|||sequence_alteration|HGNC|20324|||||||||1|||||||||||0.07436|0.02589|0.03093|0.1043|0.01589|0.04089|0.0001321|0.02147|0.03722|0.03324|0.02268|||||||||,A|downstream_gene_variant|MODIFIER|TGDS|ENSG00000088451|Transcript|ENST00000498294|processed_transcript||||||||||rs201674028|2|3843|-1|||sequence_alteration|HGNC|20324|||||||||1||||||0.6112|0.1988|0.0069|0.2873|0.1401|0.352|0.2172|0.1115|0.3381|0.06527|0.12|0.001773|0.08812|0.1365|0.1266|0.06702|||||||||	GT:AD:DP:BQ:SS:FT:DP4	0/0:3:18:.:.:PASS:.,.,.,.	0/2:0:44:.:2:PASS:3,31,2,8	0/0:.:18:.:.:PASS:.,.,.,.	0/2:.:44:.:2:PASS:3,31,2,8	./.:.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.,.,.	0/1:3:.:.:.:PindelSomaticCalls:.,.,.,.	0/0:0:.:.:2:PindelSomaticCalls:.,.,.,.	./.:.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.,.,.
14	35515606	.	TGG	T	.	.	CSQ=-|upstream_gene_variant|MODIFIER|FAM177A1|ENSG00000151327|Transcript|ENST00000280987|protein_coding||||||||||rs4007475|1|1|1||1|deletion|HGNC|19829|YES||CCDS9653.2|ENSP00000280987|Q8N128|G3V583&G3V3Z5|UPI00005A8F3C|NM_173607.3|||||||||||||||||||||||||1||||||,-|5_prime_UTR_variant|MODIFIER|FAM177A1|ENSG00000151327|Transcript|ENST00000382406|protein_coding|1/6||ENST00000382406.3:c.-33_-32del||24-25/858|||||rs4007475|1||1|||deletion|HGNC|19829|||CCDS41944.1|ENSP00000371843|Q8N128|G3V583&G3V3Z5|UPI000006E43B||||||||||||||||||||||||||1||||||,-|intron_variant|MODIFIER|FAM177A1|ENSG00000151327|Transcript|ENST00000396472|protein_coding||2/6|ENST00000396472.1:c.-28-103_-28-102del|||||||rs4007475|1||1|||deletion|HGNC|19829|||CCDS41944.1|ENSP00000379734|Q8N128|G3V583&G3V3Z5|UPI000006E43B|NM_001079519.1|||||||||||||||||||||||||1||||||,-|upstream_gene_variant|MODIFIER|FAM177A1|ENSG00000151327|Transcript|ENST00000553852|nonsense_mediated_decay||||||||||rs4007475|1|191|1|cds_start_NF||deletion|HGNC|19829||||ENSP00000451165||H0YJC3|UPI00021CF0EC||||||||||||||||||||||||||1||||||,-|upstream_gene_variant|MODIFIER|FAM177A1|ENSG00000151327|Transcript|ENST00000553955|nonsense_mediated_decay||||||||||rs4007475|1|279|1|cds_start_NF||deletion|HGNC|19829||||ENSP00000450424|||UPI00021CF0ED||||||||||||||||||||||||||1||||||,-|upstream_gene_variant|MODIFIER|FAM177A1|ENSG00000151327|Transcript|ENST00000554052|processed_transcript||||||||||rs4007475|1|51|1|||deletion|HGNC|19829|||||||||||||||||||||||||||||||||1||||||,-|intron_variant|MODIFIER|FAM177A1|ENSG00000151327|Transcript|ENST00000555211|protein_coding||2/3|ENST00000555211.1:c.-28-103_-28-102del|||||||rs4007475|1||1|cds_end_NF||deletion|HGNC|19829||||ENSP00000451508||G3V3Z5|UPI00021CF0EB||||||||||||||||||||||||||1||||||,-|upstream_gene_variant|MODIFIER|FAM177A1|ENSG00000151327|Transcript|ENST00000556858|nonsense_mediated_decay||||||||||rs4007475|1|202|1|cds_start_NF||deletion|HGNC|19829||||ENSP00000473546|||UPI0002B83352||||||||||||||||||||||||||1||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000067618|||||||||||rs4007475|1|||||deletion|||||||||||||||||||||||||||||||||||1||||||,-|TF_binding_site_variant|MODIFIER|||MotifFeature|ENSM00529338732|||||||||||rs4007475|1||-1|||deletion|||||||||||||||||||||||||||||||||||1||ENSPFM0550|12|N||TEAD4::FOXI1,-|TF_binding_site_variant|MODIFIER|||MotifFeature|ENSM00522874412|||||||||||rs4007475|1||1|||deletion|||||||||||||||||||||||||||||||||||1||ENSPFM0069|17|N||E2F1::EOMES,-|TF_binding_site_variant|MODIFIER|||MotifFeature|ENSM00642279804|||||||||||rs4007475|1||1|||deletion|||||||||||||||||||||||||||||||||||1||ENSPFM0240|12|N||GCM1::MAX	GT:DP:DP4:BQ:SS:FT:AD	0/0:4:.,.,.,.:.:.:PASS:0	0/1:7:6,0,6,0:.:2:PASS:4	0/1:4:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	1/1:7:6,0,6,0:.:1:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:4	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
14	72941206	.	G	GA	.	.	CSQ=A|intron_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000343854|protein_coding||8/15|ENST00000343854.6:c.619-127_619-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002|||CCDS55925.1|ENSP00000341199|P49758||UPI0000EE33D6|NM_001204419.1|||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000355512|protein_coding||8/15|ENST00000355512.6:c.619-127_619-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002||||ENSP00000347699|P49758||UPI00001AADFC||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000402788|protein_coding||8/15|ENST00000402788.2:c.619-127_619-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002|||CCDS9808.1|ENSP00000383953|P49758|Q2M3K2&B7Z2N1|UPI00001698D1|NM_001204423.1|||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000404301|protein_coding||8/16|ENST00000404301.2:c.619-127_619-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002||||ENSP00000385243|P49758||UPI00001AADFD||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000406236|protein_coding||8/16|ENST00000406236.4:c.619-127_619-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002||||ENSP00000384218|P49758||UPI00001AADFF||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000407322|protein_coding||8/16|ENST00000407322.4:c.619-127_619-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002||||ENSP00000384612|P49758||UPI00001AADFE||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000434263|protein_coding||6/16|ENST00000434263.2:c.412-127_412-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002||||ENSP00000412144||B7Z7N5|UPI0001915149||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000553525|protein_coding||9/17|ENST00000553525.1:c.619-127_619-126insA|||||||rs141283571|1||1||1|insertion|HGNC|10002|YES||CCDS55924.1|ENSP00000451030|P49758|Q59FJ8|UPI00001698D0|NM_001204424.1|||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000553530|protein_coding||9/16|ENST00000553530.1:c.619-127_619-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002|||CCDS9808.1|ENSP00000452331|P49758|Q2M3K2&B7Z2N1|UPI00001698D1|NM_004296.5&NM_001204422.1&NM_001204421.1&NM_001204418.1&NM_001204417.1&NM_001204420.1|||||||||||||||||||||||||||||||,A|downstream_gene_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000553690|processed_transcript||||||||||rs141283571|1|429|1|||insertion|HGNC|10002|||||||||||||||||||||||||||||||||||||||,A|intron_variant&NMD_transcript_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000554474|nonsense_mediated_decay||9/18|ENST00000554474.1:c.619-127_619-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002||||ENSP00000450858|P49758||UPI0000EE33D8||||||||||||||||||||||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000554734|retained_intron||1/2|ENST00000554734.1:n.95-127_95-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002|||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000554782|protein_coding||5/13|ENST00000554782.1:c.202-127_202-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002||||ENSP00000451912|P49758||UPI000016981E||||||||||||||||||||||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000555368|processed_transcript||7/9|ENST00000555368.1:n.659-127_659-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002|||||||||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000555571|protein_coding||9/16|ENST00000555571.1:c.619-127_619-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002|||CCDS9808.1|ENSP00000450936|P49758|Q2M3K2&B7Z2N1|UPI00001698D1||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|RGS6|ENSG00000182732|Transcript|ENST00000556437|protein_coding||9/17|ENST00000556437.1:c.619-127_619-126insA|||||||rs141283571|1||1|||insertion|HGNC|10002|||CCDS55924.1|ENSP00000451855|P49758|Q59FJ8|UPI00001698D0|NM_001204416.1|||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT	0/0:9:.,.,.,.:.:.:PASS	0/1:105:67,1,39,1:.:2:PASS	0/0:9:.,.,.,.:.:.:PASS	0/1:105:67,1,39,1:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.
14	92563254	.	AT	ATT,A	.	.	CSQ=TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000340660|protein_coding||1/9|ENST00000340660.6:c.25-774dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||CCDS32143.1|ENSP00000339110|P54252|G3V2G2&D3VVN9&D3VVK3|UPI0000140E20|NM_030660.4|1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000340660|protein_coding||1/9|ENST00000340660.6:c.25-774del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||CCDS32143.1|ENSP00000339110|P54252|G3V2G2&D3VVN9&D3VVK3|UPI0000140E20|NM_030660.4|1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000359366|nonsense_mediated_decay||1/9|ENST00000359366.5:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000352324||D3VVP3&D3VVD5&D3VVC1|UPI00001FDA34||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000359366|nonsense_mediated_decay||1/9|ENST00000359366.5:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000352324||D3VVP3&D3VVD5&D3VVC1|UPI00001FDA34||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000393287|protein_coding||1/10|ENST00000393287.5:c.25-73dup|||||||rs398026196|1||-1||1|sequence_alteration|HGNC|7106|YES||CCDS9900.1|ENSP00000376965|P54252|G3V4F4&G3V2G2&D3VVM7&D3VVL3&D3VVJ0&D3VVF1&D3VVD5&D3VVC1|UPI000013D23A||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000393287|protein_coding||1/10|ENST00000393287.5:c.25-73del|||||||rs398026196|2||-1||1|sequence_alteration|HGNC|7106|YES||CCDS9900.1|ENSP00000376965|P54252|G3V4F4&G3V2G2&D3VVM7&D3VVL3&D3VVJ0&D3VVF1&D3VVD5&D3VVC1|UPI000013D23A||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000429774|protein_coding||1/10|ENST00000429774.2:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000389376||D3VVM2&D3VVD5&D3VVC1&C9JQV6|UPI0002065833|NM_001127696.1&NM_001164779.1&NM_001164782.1|1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000429774|protein_coding||1/10|ENST00000429774.2:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000389376||D3VVM2&D3VVD5&D3VVC1&C9JQV6|UPI0002065833|NM_001127696.1&NM_001164779.1&NM_001164782.1|1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000454964|retained_intron||1/1|ENST00000454964.3:n.37-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000454964|retained_intron||1/1|ENST00000454964.3:n.37-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000502250|protein_coding||1/7|ENST00000502250.1:c.-217-3593dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||CCDS53908.1|ENSP00000425322|P54252|G3V2G2|UPI0001B7106A|NM_001164780.1|1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000502250|protein_coding||1/7|ENST00000502250.1:c.-217-3593del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||CCDS53908.1|ENSP00000425322|P54252|G3V2G2|UPI0001B7106A|NM_001164780.1|1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000503767|protein_coding||1/9|ENST00000503767.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||CCDS45154.1|ENSP00000426697|P54252|G3V2G2&D3VVM2&D3VVD5&D3VVC1|UPI0001754A96||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000503767|protein_coding||1/9|ENST00000503767.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||CCDS45154.1|ENSP00000426697|P54252|G3V2G2&D3VVM2&D3VVD5&D3VVC1|UPI0001754A96||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000504047|processed_transcript||1/4|ENST00000504047.1:n.64-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000504047|processed_transcript||1/4|ENST00000504047.1:n.64-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000506466|protein_coding||1/5|ENST00000506466.1:c.25-73dup|||||||rs398026196|1||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000435571||E9PJN5&D3VVD5&D3VVC1|UPI0001F77D84||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000506466|protein_coding||1/5|ENST00000506466.1:c.25-73del|||||||rs398026196|2||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000435571||E9PJN5&D3VVD5&D3VVC1|UPI0001F77D84||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000507965|retained_intron||1/3|ENST00000507965.1:n.46-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000507965|retained_intron||1/3|ENST00000507965.1:n.46-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000511362|processed_transcript||1/5|ENST00000511362.1:n.40-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000511362|processed_transcript||1/5|ENST00000511362.1:n.40-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000515746|nonsense_mediated_decay||1/5|ENST00000515746.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000422073||D6R9I5&D3VVD5&D3VVC1|UPI00001FDA37||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000515746|nonsense_mediated_decay||1/5|ENST00000515746.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000422073||D6R9I5&D3VVD5&D3VVC1|UPI00001FDA37||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|upstream_gene_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000526245|processed_transcript||||||||||rs398026196|1|3594|-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|upstream_gene_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000526245|processed_transcript||||||||||rs398026196|2|3594|-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|upstream_gene_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000526872|protein_coding||||||||||rs398026196|1|73|-1|cds_start_NF&cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000474067||S4R399|UPI0003335130||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|upstream_gene_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000526872|protein_coding||||||||||rs398026196|2|73|-1|cds_start_NF&cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000474067||S4R399|UPI0003335130||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000532032|protein_coding||1/9|ENST00000532032.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000437157|P54252|G3V4F4&G3V2G2&D3VVM7&D3VVL3&D3VVJ0&D3VVF1&D3VVD5&D3VVC1|UPI00001694ED||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000532032|protein_coding||1/9|ENST00000532032.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000437157|P54252|G3V4F4&G3V2G2&D3VVM7&D3VVL3&D3VVJ0&D3VVF1&D3VVD5&D3VVC1|UPI00001694ED||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000545170|protein_coding||1/10|ENST00000545170.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000445618||G3V4F4&F5H211&D3VVL3&D3VVJ0&D3VVF1&D3VVD5&D3VVC1|UPI00015DFD67|NM_004993.5&NM_001164776.1&NM_001164778.1&NM_001164774.1&NM_001164777.1|1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000545170|protein_coding||1/10|ENST00000545170.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000445618||G3V4F4&F5H211&D3VVL3&D3VVJ0&D3VVF1&D3VVD5&D3VVC1|UPI00015DFD67|NM_004993.5&NM_001164776.1&NM_001164778.1&NM_001164774.1&NM_001164777.1|1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553287|processed_transcript||1/6|ENST00000553287.1:n.47-3593dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553287|processed_transcript||1/6|ENST00000553287.1:n.47-3593del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553309|processed_transcript||1/9|ENST00000553309.1:n.47-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553309|processed_transcript||1/9|ENST00000553309.1:n.47-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553488|nonsense_mediated_decay||1/10|ENST00000553488.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000452461||D3VVP3&D3VVD5&D3VVC1|UPI00001FDA34||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553488|nonsense_mediated_decay||1/10|ENST00000553488.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000452461||D3VVP3&D3VVD5&D3VVC1|UPI00001FDA34||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553491|protein_coding||1/7|ENST00000553491.1:c.25-73dup|||||||rs398026196|1||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000451996||G3V4U9&D3VVQ0&D3VVD5&D3VVC1&D3VVB1&D3VVB0|UPI00021CF3B2|NM_001127697.2|1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553491|protein_coding||1/7|ENST00000553491.1:c.25-73del|||||||rs398026196|2||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000451996||G3V4U9&D3VVQ0&D3VVD5&D3VVC1&D3VVB1&D3VVB0|UPI00021CF3B2|NM_001127697.2|1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553498|processed_transcript||1/8|ENST00000553498.1:n.47-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553498|processed_transcript||1/8|ENST00000553498.1:n.47-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553570|nonsense_mediated_decay||1/7|ENST00000553570.1:c.25-774dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000451405||G3V3T0|UPI00021CF3B3||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553570|nonsense_mediated_decay||1/7|ENST00000553570.1:c.25-774del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000451405||G3V3T0|UPI00021CF3B3||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553686|processed_transcript||1/7|ENST00000553686.1:n.47-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000553686|processed_transcript||1/7|ENST00000553686.1:n.47-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554040|processed_transcript||1/6|ENST00000554040.1:n.47-774dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554040|processed_transcript||1/6|ENST00000554040.1:n.47-774del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554214|processed_transcript||1/7|ENST00000554214.1:n.47-774dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554214|processed_transcript||1/7|ENST00000554214.1:n.47-774del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554350|nonsense_mediated_decay||1/8|ENST00000554350.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000451103||G3V390&D3VVF1&D3VVD5&D3VVC1|UPI00021CF3B6||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554350|nonsense_mediated_decay||1/8|ENST00000554350.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000451103||G3V390&D3VVF1&D3VVD5&D3VVC1|UPI00021CF3B6||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554491|processed_transcript||1/10|ENST00000554491.1:n.47-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554491|processed_transcript||1/10|ENST00000554491.1:n.47-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554592|protein_coding||1/9|ENST00000554592.1:c.25-73dup|||||||rs398026196|1||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000451385||G3V3R7&G3V2G2&D3VVD5&D3VVC1|UPI00021CF3AD||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554592|protein_coding||1/9|ENST00000554592.1:c.25-73del|||||||rs398026196|2||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000451385||G3V3R7&G3V2G2&D3VVD5&D3VVC1|UPI00021CF3AD||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554672|protein_coding||1/7|ENST00000554672.1:c.-16-777dup|||||||rs398026196|1||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000451417||G3V3T6&G3V2G2|UPI00021CF3AF||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554672|protein_coding||1/7|ENST00000554672.1:c.-16-777del|||||||rs398026196|2||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000451417||G3V3T6&G3V2G2|UPI00021CF3AF||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554673|nonsense_mediated_decay||1/9|ENST00000554673.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000452356||G3V5H3&D3VVJ0&D3VVF1&D3VVD5&D3VVC1|UPI00021CF3B8||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554673|nonsense_mediated_decay||1/9|ENST00000554673.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000452356||G3V5H3&D3VVJ0&D3VVF1&D3VVD5&D3VVC1|UPI00021CF3B8||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554994|nonsense_mediated_decay||1/8|ENST00000554994.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000451771||G3V4F5&D3VVF1&D3VVD5&D3VVC1|UPI00021CF3B4||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000554994|nonsense_mediated_decay||1/8|ENST00000554994.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000451771||G3V4F5&D3VVF1&D3VVD5&D3VVC1|UPI00021CF3B4||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000555381|protein_coding||1/7|ENST00000555381.1:c.25-3080dup|||||||rs398026196|1||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000451001||G3V328&G3V2G2|UPI00021CF3AB|NM_001164781.1|1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000555381|protein_coding||1/7|ENST00000555381.1:c.25-3080del|||||||rs398026196|2||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000451001||G3V328&G3V2G2|UPI00021CF3AB|NM_001164781.1|1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000555816|nonsense_mediated_decay||1/7|ENST00000555816.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000451910||D3VVP3&D3VVD5&D3VVC1|UPI00001FDA34||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000555816|nonsense_mediated_decay||1/7|ENST00000555816.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000451910||D3VVP3&D3VVD5&D3VVC1|UPI00001FDA34||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000555958|processed_transcript||1/8|ENST00000555958.1:n.47-774dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000555958|processed_transcript||1/8|ENST00000555958.1:n.47-774del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556082|nonsense_mediated_decay||1/6|ENST00000556082.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000450492||D3VVP3&D3VVD5&D3VVC1|UPI00001FDA34||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556082|nonsense_mediated_decay||1/6|ENST00000556082.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000450492||D3VVP3&D3VVD5&D3VVC1|UPI00001FDA34||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556220|protein_coding||1/6|ENST00000556220.1:c.25-774dup|||||||rs398026196|1||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000450641||G3V2G1&D3VVQ7&D3VVP4|UPI00021CF3B7||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556220|protein_coding||1/6|ENST00000556220.1:c.25-774del|||||||rs398026196|2||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000450641||G3V2G1&D3VVQ7&D3VVP4|UPI00021CF3B7||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556274|nonsense_mediated_decay||1/8|ENST00000556274.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000451733||D3VVP3&D3VVD5&D3VVC1|UPI00001FDA34||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556274|nonsense_mediated_decay||1/8|ENST00000556274.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000451733||D3VVP3&D3VVD5&D3VVC1|UPI00001FDA34||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556288|nonsense_mediated_decay||1/8|ENST00000556288.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000450566||D3VVP3&D3VVD5&D3VVC1|UPI00001FDA34||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556288|nonsense_mediated_decay||1/8|ENST00000556288.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000450566||D3VVP3&D3VVD5&D3VVC1|UPI00001FDA34||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556315|nonsense_mediated_decay||1/8|ENST00000556315.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000451132||G3V3A6&D3VVD5&D3VVC1|UPI0000407FF0||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556315|nonsense_mediated_decay||1/8|ENST00000556315.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000451132||G3V3A6&D3VVD5&D3VVC1|UPI0000407FF0||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556339|processed_transcript||1/5|ENST00000556339.1:n.47-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556339|processed_transcript||1/5|ENST00000556339.1:n.47-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556374|nonsense_mediated_decay||1/10|ENST00000556374.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000451399||G3V3S5&D3VVD5&D3VVC1|UPI00021CF3B1||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556374|nonsense_mediated_decay||1/10|ENST00000556374.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000451399||G3V3S5&D3VVD5&D3VVC1|UPI00021CF3B1||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556644|processed_transcript||1/3|ENST00000556644.1:n.47-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106|||||||||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556644|processed_transcript||1/3|ENST00000556644.1:n.47-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106|||||||||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556671|nonsense_mediated_decay||1/8|ENST00000556671.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000451693||G3V4B1&D3VVD5&D3VVC1|UPI00021CF3B5||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556671|nonsense_mediated_decay||1/8|ENST00000556671.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000451693||G3V4B1&D3VVD5&D3VVC1|UPI00021CF3B5||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556898|nonsense_mediated_decay||1/9|ENST00000556898.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000451769||G3V4F4&D3VVJ0&D3VVF1&D3VVD5&D3VVC1|UPI00021CF3AE||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556898|nonsense_mediated_decay||1/9|ENST00000556898.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000451769||G3V4F4&D3VVJ0&D3VVF1&D3VVD5&D3VVC1|UPI00021CF3AE||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556958|nonsense_mediated_decay||1/6|ENST00000556958.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000452532||D6R9I5&D3VVD5&D3VVC1|UPI00001FDA37||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000556958|nonsense_mediated_decay||1/6|ENST00000556958.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000452532||D6R9I5&D3VVD5&D3VVC1|UPI00001FDA37||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000557030|nonsense_mediated_decay||1/6|ENST00000557030.1:c.25-73dup|||||||rs398026196|1||-1|||sequence_alteration|HGNC|7106||||ENSP00000452139||G3V526&D3VVD5&D3VVC1|UPI00021CF3B0||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000557030|nonsense_mediated_decay||1/6|ENST00000557030.1:c.25-73del|||||||rs398026196|2||-1|||sequence_alteration|HGNC|7106||||ENSP00000452139||G3V526&D3VVD5&D3VVC1|UPI00021CF3B0||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||,TT|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000557311|protein_coding||1/4|ENST00000557311.1:c.-63+9618dup|||||||rs398026196|1||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000450642||G3V2G2|UPI00021CF3AC||1||||||0.3971|0.4164|0.4444|0.4304|0.4519|||0.3785|0.3307|0.3619|0.4045|0.3924|0.367|0.3785|0.3805|0.3999|||||||||,-|intron_variant|MODIFIER|ATXN3|ENSG00000066427|Transcript|ENST00000557311|protein_coding||1/4|ENST00000557311.1:c.-63+9618del|||||||rs398026196|2||-1|cds_end_NF||sequence_alteration|HGNC|7106||||ENSP00000450642||G3V2G2|UPI00021CF3AC||1|||||||||||||0.1584|0.1307|0.2062|0.1491|0.1078|0.1475|0.1626|0.1551|0.1404|||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:24:.,.,.,.:.:.:PASS:0	0/2:32:0,35,0,6:.:2:PASS:3	0/1:24:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/2:32:0,35,0,6:.:5:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/2:.:.,.,.,.:.:2:PASS:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
15	28473275	.	T	TA	.	.	END=28473276;HOMLEN=15;HOMSEQ=AAAAAAAAAAAAAAA;SVLEN=1;CSQ=A|intron_variant|MODIFIER|HERC2|ENSG00000128731|Transcript|ENST00000261609|protein_coding||35/92|ENST00000261609.7:c.5464+88dup|||||||rs367658561|1||-1||1|insertion|HGNC|4868|YES||CCDS10021.1|ENSP00000261609|O95714||UPI00004578F7|NM_004667.5|1||||||||||||||||||||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|HERC2|ENSG00000128731|Transcript|ENST00000569335|retained_intron||2/2|ENST00000569335.1:n.514+88dup|||||||rs367658561|1||-1|||insertion|HGNC|4868|||||||||1||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
15	81187286	.	TA	T,TAA	.	.	CSQ=-|intron_variant|MODIFIER|KIAA1199|ENSG00000103888|Transcript|ENST00000220244|protein_coding||9/28|ENST00000220244.3:c.1087-44del|||||||rs370268279|1||1|||sequence_alteration|HGNC|29213|||CCDS10315.1|ENSP00000220244|Q8WUJ3||UPI00001D7799|NM_018689.1||||||||||||0.08071|0.06227|0.003945|0.01602|0.001319|0.003855|0.001942|0.0001038|0.003901|0.003518|0.003791|||||||||,AA|intron_variant|MODIFIER|KIAA1199|ENSG00000103888|Transcript|ENST00000220244|protein_coding||9/28|ENST00000220244.3:c.1087-44dup|||||||rs370268279|2||1|||sequence_alteration|HGNC|29213|||CCDS10315.1|ENSP00000220244|Q8WUJ3||UPI00001D7799|NM_018689.1||||||||||||0.03355|0.0292|0.0523|0.06667|0.07103|0.0798|0.06021|0.03167|0.04353|0.06482|0.06801|||||||||,-|intron_variant|MODIFIER|KIAA1199|ENSG00000103888|Transcript|ENST00000356249|protein_coding||10/29|ENST00000356249.5:c.1087-44del|||||||rs370268279|1||1|||sequence_alteration|HGNC|29213|||CCDS10315.1|ENSP00000348583|Q8WUJ3||UPI00001D7799|||||||||||||0.08071|0.06227|0.003945|0.01602|0.001319|0.003855|0.001942|0.0001038|0.003901|0.003518|0.003791|||||||||,AA|intron_variant|MODIFIER|KIAA1199|ENSG00000103888|Transcript|ENST00000356249|protein_coding||10/29|ENST00000356249.5:c.1087-44dup|||||||rs370268279|2||1|||sequence_alteration|HGNC|29213|||CCDS10315.1|ENSP00000348583|Q8WUJ3||UPI00001D7799|||||||||||||0.03355|0.0292|0.0523|0.06667|0.07103|0.0798|0.06021|0.03167|0.04353|0.06482|0.06801|||||||||,-|intron_variant|MODIFIER|KIAA1199|ENSG00000103888|Transcript|ENST00000394685|protein_coding||10/29|ENST00000394685.3:c.1087-44del|||||||rs370268279|1||1||1|sequence_alteration|HGNC|29213|YES||CCDS10315.1|ENSP00000378177|Q8WUJ3||UPI00001D7799|||||||||||||0.08071|0.06227|0.003945|0.01602|0.001319|0.003855|0.001942|0.0001038|0.003901|0.003518|0.003791|||||||||,AA|intron_variant|MODIFIER|KIAA1199|ENSG00000103888|Transcript|ENST00000394685|protein_coding||10/29|ENST00000394685.3:c.1087-44dup|||||||rs370268279|2||1||1|sequence_alteration|HGNC|29213|YES||CCDS10315.1|ENSP00000378177|Q8WUJ3||UPI00001D7799|||||||||||||0.03355|0.0292|0.0523|0.06667|0.07103|0.0798|0.06021|0.03167|0.04353|0.06482|0.06801|||||||||,-|downstream_gene_variant|MODIFIER|RP11-351M8.1|ENSG00000259649|Transcript|ENST00000558261|nonsense_mediated_decay||||||||||rs370268279|1|1261|-1|||sequence_alteration|Clone_based_vega_gene|||||ENSP00000453400||H0YLZ4|UPI00022F8659|||||||||||||0.08071|0.06227|0.003945|0.01602|0.001319|0.003855|0.001942|0.0001038|0.003901|0.003518|0.003791|||||||||,AA|downstream_gene_variant|MODIFIER|RP11-351M8.1|ENSG00000259649|Transcript|ENST00000558261|nonsense_mediated_decay||||||||||rs370268279|2|1261|-1|||sequence_alteration|Clone_based_vega_gene|||||ENSP00000453400||H0YLZ4|UPI00022F8659|||||||||||||0.03355|0.0292|0.0523|0.06667|0.07103|0.0798|0.06021|0.03167|0.04353|0.06482|0.06801|||||||||,-|downstream_gene_variant|MODIFIER|RP11-351M8.1|ENSG00000259649|Transcript|ENST00000560560|protein_coding||||||||||rs370268279|1|1245|-1|||sequence_alteration|Clone_based_vega_gene||YES|||ENSP00000454090||H0YNN9&H0YLS8|UPI0001662867|||||||||||||0.08071|0.06227|0.003945|0.01602|0.001319|0.003855|0.001942|0.0001038|0.003901|0.003518|0.003791|||||||||,AA|downstream_gene_variant|MODIFIER|RP11-351M8.1|ENSG00000259649|Transcript|ENST00000560560|protein_coding||||||||||rs370268279|2|1245|-1|||sequence_alteration|Clone_based_vega_gene||YES|||ENSP00000454090||H0YNN9&H0YLS8|UPI0001662867|||||||||||||0.03355|0.0292|0.0523|0.06667|0.07103|0.0798|0.06021|0.03167|0.04353|0.06482|0.06801|||||||||,-|downstream_gene_variant|MODIFIER|RP11-351M8.2|ENSG00000259546|Transcript|ENST00000560873|processed_transcript||||||||||rs370268279|1|1244|-1|||sequence_alteration|Clone_based_vega_gene||YES|||||||||||||||||||0.08071|0.06227|0.003945|0.01602|0.001319|0.003855|0.001942|0.0001038|0.003901|0.003518|0.003791|||||||||,AA|downstream_gene_variant|MODIFIER|RP11-351M8.2|ENSG00000259546|Transcript|ENST00000560873|processed_transcript||||||||||rs370268279|2|1244|-1|||sequence_alteration|Clone_based_vega_gene||YES|||||||||||||||||||0.03355|0.0292|0.0523|0.06667|0.07103|0.0798|0.06021|0.03167|0.04353|0.06482|0.06801|||||||||,-|downstream_gene_variant|MODIFIER|RP11-351M8.1|ENSG00000259649|Transcript|ENST00000561295|protein_coding||||||||||rs370268279|1|1252|-1|||sequence_alteration|Clone_based_vega_gene|||||ENSP00000453325||H0YLS8|UPI00022F8658|||||||||||||0.08071|0.06227|0.003945|0.01602|0.001319|0.003855|0.001942|0.0001038|0.003901|0.003518|0.003791|||||||||,AA|downstream_gene_variant|MODIFIER|RP11-351M8.1|ENSG00000259649|Transcript|ENST00000561295|protein_coding||||||||||rs370268279|2|1252|-1|||sequence_alteration|Clone_based_vega_gene|||||ENSP00000453325||H0YLS8|UPI00022F8658|||||||||||||0.03355|0.0292|0.0523|0.06667|0.07103|0.0798|0.06021|0.03167|0.04353|0.06482|0.06801|||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/2:4:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/2:4:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
15	88690736	.	CCTTCTTCTTCTTCTTCTTCTT	C	.	.	CSQ=-|intron_variant|MODIFIER|NTRK3|ENSG00000140538|Transcript|ENST00000317501|protein_coding||4/14|ENST00000317501.3:c.396-123_396-103del|||||||rs34299110|1||-1|||deletion|HGNC|8033|||CCDS32323.1|ENSP00000318328|Q16288|R4GNH5&Q96CY4&A9X3Y2|UPI000006D70E|NM_001007156.2|1||||||0.7466|0.2968|0.373|0.3509|0.3896||||||||||||||||||||,-|intron_variant|MODIFIER|NTRK3|ENSG00000140538|Transcript|ENST00000355254|protein_coding||4/17|ENST00000355254.2:c.396-123_396-103del|||||||rs34299110|1||-1|||deletion|HGNC|8033|||CCDS10340.1|ENSP00000347397|Q16288|R4GNH5|UPI000013D7A1||1||||||0.7466|0.2968|0.373|0.3509|0.3896||||||||||||||||||||,-|intron_variant|MODIFIER|NTRK3|ENSG00000140538|Transcript|ENST00000357724|protein_coding||4/17|ENST00000357724.2:c.396-123_396-103del|||||||rs34299110|1||-1|||deletion|HGNC|8033||||ENSP00000350356||R4GNH5&O95192&E9PG56|UPI0000366A9D||1||||||0.7466|0.2968|0.373|0.3509|0.3896||||||||||||||||||||,-|intron_variant|MODIFIER|NTRK3|ENSG00000140538|Transcript|ENST00000360948|protein_coding||4/18|ENST00000360948.2:c.396-123_396-103del|||||||rs34299110|1||-1||1|deletion|HGNC|8033|YES||CCDS32322.1|ENSP00000354207|Q16288|R4GNH5|UPI000006DC82|NM_001012338.2|1||||||0.7466|0.2968|0.373|0.3509|0.3896||||||||||||||||||||,-|intron_variant|MODIFIER|NTRK3|ENSG00000140538|Transcript|ENST00000394480|protein_coding||5/18|ENST00000394480.2:c.396-123_396-103del|||||||rs34299110|1||-1|||deletion|HGNC|8033|||CCDS10340.1|ENSP00000377990|Q16288|R4GNH5|UPI000013D7A1|NM_002530.3&NM_001243101.1|1||||||0.7466|0.2968|0.373|0.3509|0.3896||||||||||||||||||||,-|intron_variant|MODIFIER|NTRK3|ENSG00000140538|Transcript|ENST00000540489|protein_coding||3/13|ENST00000540489.2:c.396-123_396-103del|||||||rs34299110|1||-1|||deletion|HGNC|8033|||CCDS32323.1|ENSP00000444673|Q16288|R4GNH5&Q96CY4&A9X3Y2|UPI000006D70E||1||||||0.7466|0.2968|0.373|0.3509|0.3896||||||||||||||||||||,-|intron_variant|MODIFIER|NTRK3|ENSG00000140538|Transcript|ENST00000542733|protein_coding||3/15|ENST00000542733.2:c.102-123_102-103del|||||||rs34299110|1||-1|||deletion|HGNC|8033||||ENSP00000437773||R4GNH5&B7Z7U4|UPI0001915246||1||||||0.7466|0.2968|0.373|0.3509|0.3896||||||||||||||||||||,-|intron_variant|MODIFIER|NTRK3|ENSG00000140538|Transcript|ENST00000557856|protein_coding||3/15|ENST00000557856.1:c.396-123_396-103del|||||||rs34299110|1||-1|||deletion|HGNC|8033|||CCDS58399.1|ENSP00000453959||R4GNH5&O95192&H0YND1|UPI00018927E2||1||||||0.7466|0.2968|0.373|0.3509|0.3896||||||||||||||||||||,-|intron_variant|MODIFIER|NTRK3|ENSG00000140538|Transcript|ENST00000558676|protein_coding||3/13|ENST00000558676.1:c.396-123_396-103del|||||||rs34299110|1||-1|||deletion|HGNC|8033||||ENSP00000453511||R4GNH5&O95192&H0YM90|UPI00018920A6||1||||||0.7466|0.2968|0.373|0.3509|0.3896||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|MED28P6|ENSG00000259183|Transcript|ENST00000558776|processed_pseudogene||||||||||rs34299110|1|3341|-1|||deletion|HGNC|45083|YES||||||||||||||0.7466|0.2968|0.373|0.3509|0.3896||||||||||||||||||||,-|intron_variant|MODIFIER|NTRK3|ENSG00000140538|Transcript|ENST00000559188|protein_coding||4/5|ENST00000559188.1:c.102-123_102-103del|||||||rs34299110|1||-1|cds_end_NF||deletion|HGNC|8033||||ENSP00000473656||R4GNH5|UPI0002B83318||1||||||0.7466|0.2968|0.373|0.3509|0.3896||||||||||||||||||||	GT:AD:BQ:SS:DP:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50:FT:DP4	0/0:0:.:.:18:19:12,12:0,0:10,10:22.68:0.02:0:PASS:.,.,.,.	0/1:4:.:2:27:28:5,6:5,5:20,19:28.78:0:0:PASS:0,28,0,4	0/0:.:.:.:18:.:.,.:.,.:.,.:.:.:.:VarscanHighConfidenceIndel:.,.,.,.	0/1:.:.:2:27:.:.,.:.,.:.,.:.:.:.:VarscanHighConfidenceIndel:0,28,0,4	0/0:12:.:.:19:19:12,12:0,0:10,10:22.68:0.02:0:QSI_ref-Repeat:.,.,.,.	0/1:5:.:2:28:28:5,6:5,5:20,19:28.78:0:0:QSI_ref-Repeat:.,.,.,.	0/0:0:.:.:.:.:.,.:.,.:.,.:.:.:.:PASS:.,.,.,.	0/1:4:.:2:.:.:.,.:.,.:.,.:.:.:.:PASS:.,.,.,.	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.:.,.,.,.
16	460578	.	CT	C	.	.	END=460580;HOMLEN=0;SVLEN=-1;CSQ=-|intron_variant|MODIFIER|DECR2|ENSG00000242612|Transcript|ENST00000219481|protein_coding||5/8|ENST00000219481.5:c.463-112del|||||||rs11315123|1||1||1|deletion|HGNC|2754|YES||CCDS10409.1|ENSP00000219481|Q9NUI1|Q9H3W9|UPI000003BBDC|NM_020664.3||||||0.5094|0.5189|0.5908|0.5089|0.4602|0.4898||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|DECR2|ENSG00000242612|Transcript|ENST00000397710|protein_coding||||||||||rs11315123|1|225|1|||deletion|HGNC|2754||||ENSP00000380822|Q9NUI1||UPI00001C0F23|||||||0.5094|0.5189|0.5908|0.5089|0.4602|0.4898||||||||||||||||||||,-|intron_variant|MODIFIER|DECR2|ENSG00000242612|Transcript|ENST00000424398|protein_coding||5/8|ENST00000424398.2:c.427-112del|||||||rs11315123|1||1|||deletion|HGNC|2754||||ENSP00000400374||Q9H3W9&Q4VXZ8|UPI00005190E6|||||||0.5094|0.5189|0.5908|0.5089|0.4602|0.4898||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|DECR2|ENSG00000242612|Transcript|ENST00000429116|nonsense_mediated_decay||2/5|ENST00000429116.1:c.*14-112del|||||||rs11315123|1||1|cds_start_NF||deletion|HGNC|2754||||ENSP00000393382|||UPI000173A683|||||||0.5094|0.5189|0.5908|0.5089|0.4602|0.4898||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|DECR2|ENSG00000242612|Transcript|ENST00000437024|nonsense_mediated_decay||7/10|ENST00000437024.1:c.*429-112del|||||||rs11315123|1||1|||deletion|HGNC|2754||||ENSP00000402180||G3V0I9|UPI0000EE6566|||||||0.5094|0.5189|0.5908|0.5089|0.4602|0.4898||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|DECR2|ENSG00000242612|Transcript|ENST00000439661|nonsense_mediated_decay||6/9|ENST00000439661.1:c.*14-112del|||||||rs11315123|1||1|||deletion|HGNC|2754||||ENSP00000399697|Q9NUI1||UPI00001C0F23|||||||0.5094|0.5189|0.5908|0.5089|0.4602|0.4898||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|NME4|ENSG00000103202|Transcript|ENST00000444498|nonsense_mediated_decay||||||||||rs11315123|1|212|1|||deletion|HGNC|7852||||ENSP00000395605||F2Z2X0&A2IDC9|UPI000157480C|||||||0.5094|0.5189|0.5908|0.5089|0.4602|0.4898||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|DECR2|ENSG00000242612|Transcript|ENST00000445291|nonsense_mediated_decay||6/8|ENST00000445291.1:c.*485-112del|||||||rs11315123|1||1|||deletion|HGNC|2754||||ENSP00000395913||G3V0I9|UPI0000EE6566|||||||0.5094|0.5189|0.5908|0.5089|0.4602|0.4898||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|DECR2|ENSG00000242612|Transcript|ENST00000461749|retained_intron||1/3|ENST00000461749.1:n.770-112del|||||||rs11315123|1||1|||deletion|HGNC|2754||||||||||||||0.5094|0.5189|0.5908|0.5089|0.4602|0.4898||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|DECR2|ENSG00000242612|Transcript|ENST00000461802|processed_transcript||||||||||rs11315123|1|3408|1|||deletion|HGNC|2754||||||||||||||0.5094|0.5189|0.5908|0.5089|0.4602|0.4898||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|DECR2|ENSG00000242612|Transcript|ENST00000461947|processed_transcript||2/4|ENST00000461947.1:n.221-112del|||||||rs11315123|1||1|||deletion|HGNC|2754||||||||||||||0.5094|0.5189|0.5908|0.5089|0.4602|0.4898||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|DECR2|ENSG00000242612|Transcript|ENST00000465166|retained_intron||||||||||rs11315123|1|284|1|||deletion|HGNC|2754||||||||||||||0.5094|0.5189|0.5908|0.5089|0.4602|0.4898||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|DECR2|ENSG00000242612|Transcript|ENST00000469922|retained_intron||1/1|ENST00000469922.1:n.257-112del|||||||rs11315123|1||1|||deletion|HGNC|2754||||||||||||||0.5094|0.5189|0.5908|0.5089|0.4602|0.4898||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
16	628994	.	TGGGC	T	.	.	CSQ=-|intron_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000026218|protein_coding||6/9|ENST00000026218.5:c.1223+62_1223+65del|||||||rs3842719|1||1||1|deletion|HGNC|14135|YES||CCDS10411.1|ENSP00000026218|Q9BRB3|J3QTH6&B8ZZC7&B8ZZ31&B8ZZ29|UPI000006CC88|NM_148920.2|1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000293874|protein_coding||||||||||rs3842719|1|4476|1|cds_end_NF||deletion|HGNC|14135||||ENSP00000293874||J3QTH6&B8ZZ29|UPI000204A90F||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|intron_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000321878|protein_coding||6/10|ENST00000321878.5:c.1223+62_1223+65del|||||||rs3842719|1||1|||deletion|HGNC|14135|||CCDS10412.1|ENSP00000326674|Q9BRB3|J3QTH6&B8ZZC7&B8ZZ31&B8ZZ29|UPI000006E2F6|NM_004204.3|1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000409439|protein_coding||||||||||rs3842719|1|3092|1|cds_end_NF||deletion|HGNC|14135||||ENSP00000386554||J3QTH6&B8ZZC7&B8ZZ29|UPI000204A910||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|intron_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000409527|protein_coding||7/11|ENST00000409527.2:c.1223+62_1223+65del|||||||rs3842719|1||1|||deletion|HGNC|14135|||CCDS10412.1|ENSP00000386760|Q9BRB3|J3QTH6&B8ZZC7&B8ZZ31&B8ZZ29|UPI000006E2F6||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000420990|nonsense_mediated_decay||2/7|ENST00000420990.2:c.255+62_255+65del|||||||rs3842719|1||1|cds_start_NF||deletion|HGNC|14135||||ENSP00000409341|||UPI000204A911||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000422307|protein_coding||||||||||rs3842719|1|2741|1|cds_end_NF||deletion|HGNC|14135||||ENSP00000413753||J3QTH6&B8ZZC7&B8ZZ31&B8ZZ29|UPI0001881AA2||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000439574|protein_coding||||||||||rs3842719|1|4586|1|cds_end_NF||deletion|HGNC|14135||||ENSP00000387820||B8ZZ29|UPI0001881AA3||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000443147|nonsense_mediated_decay||6/11|ENST00000443147.1:c.1265+62_1265+65del|||||||rs3842719|1||1|||deletion|HGNC|14135||||ENSP00000410434||J3QTH6&E7ERP4&B8ZZC7&B8ZZ31&B8ZZ29|UPI0001AE680A||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000470411|protein_coding||||||||||rs3842719|1|1778|1|||deletion|HGNC|14135||||ENSP00000439650|Q9BRB3|J3QTH6&B8ZZC7&B8ZZ29|UPI0000140C90||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000476438|retained_intron||||||||||rs3842719|1|2763|1|||deletion|HGNC|14135|||||||||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000480424|retained_intron||1/4|ENST00000480424.2:n.12+62_12+65del|||||||rs3842719|1||1|||deletion|HGNC|14135|||||||||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000537901|retained_intron||||||||||rs3842719|1|193|1|||deletion|HGNC|14135|||||||||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000540241|protein_coding||||||||||rs3842719|1|93|1|cds_start_NF||deletion|HGNC|14135||||ENSP00000439374||H0YFM9|UPI000204A912||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000540548|processed_transcript||||||||||rs3842719|1|3492|1|||deletion|HGNC|14135|||||||||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|PIGQ|ENSG00000007541|Transcript|ENST00000544860|processed_transcript||||||||||rs3842719|1|152|1|||deletion|HGNC|14135|||||||||1||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000371231|||||||||||rs3842719|1|||||deletion|||||||||||||||||0.4796|0.4928|0.6359|0.4324|0.6278||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:17:.,.,.,.:.:.:PASS:0	0/1:41:0,41,0,19:.:2:PASS:7	0/1:17:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:41:0,41,0,19:.:1:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:7	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
16	4700318	.	CA	C	.	.	CSQ=-|intron_variant|MODIFIER|MGRN1|ENSG00000102858|Transcript|ENST00000262370|protein_coding||1/16|ENST00000262370.7:c.89-30del|||||||rs373572089|1||1||1|deletion|HGNC|20254|YES||CCDS42115.1|ENSP00000262370|O60291|K7ERA1|UPI000018CE7F|NM_015246.3||||||||||||||0.3604|0.2748|0.3628|0.3578|0.3547|0.3812|0.3697|0.3768|0.3588|||||||||,-|intron_variant|MODIFIER|MGRN1|ENSG00000102858|Transcript|ENST00000399577|protein_coding||1/16|ENST00000399577.5:c.89-30del|||||||rs373572089|1||1|||deletion|HGNC|20254|||CCDS45402.1|ENSP00000382487|O60291|K7ERA1|UPI0000409A51|NM_001142290.2||||||||||||||0.3604|0.2748|0.3628|0.3578|0.3547|0.3812|0.3697|0.3768|0.3588|||||||||,-|intron_variant|MODIFIER|MGRN1|ENSG00000102858|Transcript|ENST00000415496|protein_coding||1/15|ENST00000415496.1:c.89-30del|||||||rs373572089|1||1|||deletion|HGNC|20254||||ENSP00000393311||K7ERA1&E9PB19|UPI000185BDB5|NM_001142291.2&NM_001142289.2||||||||||||||0.3604|0.2748|0.3628|0.3578|0.3547|0.3812|0.3697|0.3768|0.3588|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|MGRN1|ENSG00000102858|Transcript|ENST00000536343|nonsense_mediated_decay||1/14|ENST00000536343.1:c.89-30del|||||||rs373572089|1||1|||deletion|HGNC|20254||||ENSP00000443810||K7ERA1&B4DR12|UPI00017A7C95|||||||||||||||0.3604|0.2748|0.3628|0.3578|0.3547|0.3812|0.3697|0.3768|0.3588|||||||||,-|intron_variant|MODIFIER|MGRN1|ENSG00000102858|Transcript|ENST00000586183|protein_coding||1/16|ENST00000586183.1:c.89-30del|||||||rs373572089|1||1|||deletion|HGNC|20254|||CCDS45401.2|ENSP00000465860|O60291|K7ERA1|UPI0001894763|||||||||||||||0.3604|0.2748|0.3628|0.3578|0.3547|0.3812|0.3697|0.3768|0.3588|||||||||,-|intron_variant|MODIFIER|MGRN1|ENSG00000102858|Transcript|ENST00000587747|protein_coding||1/17|ENST00000587747.1:c.89-30del|||||||rs373572089|1||1|cds_end_NF||deletion|HGNC|20254||||ENSP00000467414||K7ERA1&K7EPJ5|UPI0000D4D79C|||||||||||||||0.3604|0.2748|0.3628|0.3578|0.3547|0.3812|0.3697|0.3768|0.3588|||||||||,-|intron_variant|MODIFIER|MGRN1|ENSG00000102858|Transcript|ENST00000588994|protein_coding||1/15|ENST00000588994.1:c.89-30del|||||||rs373572089|1||1|||deletion|HGNC|20254|||CCDS59256.1|ENSP00000468819|O60291|K7ERA1|UPI0001894762|||||||||||||||0.3604|0.2748|0.3628|0.3578|0.3547|0.3812|0.3697|0.3768|0.3588|||||||||,-|upstream_gene_variant|MODIFIER|MGRN1|ENSG00000102858|Transcript|ENST00000590790|protein_coding||||||||||rs373572089|1|69|1|cds_start_NF&cds_end_NF||deletion|HGNC|20254||||ENSP00000464811||K7ERA1|UPI0002841213|||||||||||||||0.3604|0.2748|0.3628|0.3578|0.3547|0.3812|0.3697|0.3768|0.3588|||||||||,-|intron_variant|MODIFIER|MGRN1|ENSG00000102858|Transcript|ENST00000591895|protein_coding||1/4|ENST00000591895.1:c.-26-30del|||||||rs373572089|1||1|cds_end_NF||deletion|HGNC|20254||||ENSP00000468171||K7ERA1|UPI0002466D10|||||||||||||||0.3604|0.2748|0.3628|0.3578|0.3547|0.3812|0.3697|0.3768|0.3588|||||||||,-|upstream_gene_variant|MODIFIER|MGRN1|ENSG00000102858|Transcript|ENST00000593224|protein_coding||||||||||rs373572089|1|82|1|cds_start_NF&cds_end_NF||deletion|HGNC|20254||||ENSP00000465249||K7EJN3|UPI0002841214|||||||||||||||0.3604|0.2748|0.3628|0.3578|0.3547|0.3812|0.3697|0.3768|0.3588|||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000371576|||||||||||rs373572089|1|||||deletion||||||||||||||||||||||||0.3604|0.2748|0.3628|0.3578|0.3547|0.3812|0.3697|0.3768|0.3588|||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001583164|||||||||||rs373572089|1|||||deletion||||||||||||||||||||||||0.3604|0.2748|0.3628|0.3578|0.3547|0.3812|0.3697|0.3768|0.3588|||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:15:.,.,.,.:.:.:PASS:0	0/1:17:18,2,7,0:.:2:PASS:3	0/1:15:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:17:18,2,7,0:.:1:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
16	58200464	.	ACT	A	.	.	CSQ=-|intron_variant|MODIFIER|CSNK2A2|ENSG00000070770|Transcript|ENST00000262506|protein_coding||9/11|ENST00000262506.3:c.827+22_827+23del|||||||rs112507755|1||-1||1|deletion|HGNC|2459|YES||CCDS10794.1|ENSP00000262506|P19784|H3BNI9|UPI0000000C95|NM_001896.2||||||||||||||0.2061|0.1364|0.2852|0.3089|0.2254|0.1273|0.1751|0.2383|0.3128|||||||||,-|intron_variant|MODIFIER|CSNK2A2|ENSG00000070770|Transcript|ENST00000563307|protein_coding||3/4|ENST00000563307.1:c.232+22_232+23del|||||||rs112507755|1||-1|cds_start_NF||deletion|HGNC|2459||||ENSP00000457911|||UPI0002466F80|||||||||||||||0.2061|0.1364|0.2852|0.3089|0.2254|0.1273|0.1751|0.2383|0.3128|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|CSNK2A2|ENSG00000070770|Transcript|ENST00000566813|processed_transcript||8/10|ENST00000566813.1:n.879+22_879+23del|||||||rs112507755|1||-1|||deletion|HGNC|2459||||||||||||||||||||||0.2061|0.1364|0.2852|0.3089|0.2254|0.1273|0.1751|0.2383|0.3128|||||||||,-|intron_variant|MODIFIER|CSNK2A2|ENSG00000070770|Transcript|ENST00000567730|protein_coding||5/7|ENST00000567730.2:c.467+22_467+23del|||||||rs112507755|1||-1|cds_start_NF||deletion|HGNC|2459||||ENSP00000456606||H3BSA1|UPI000268AE99|||||||||||||||0.2061|0.1364|0.2852|0.3089|0.2254|0.1273|0.1751|0.2383|0.3128|||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:142:.,.,.,.:.:.:PASS:7	0/1:126:96,30,9,4:.:2:PASS:13	0/0:142:.,.,.,.:.:.:PASS:.	0/1:126:96,30,9,4:.:2:PASS:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/1:.:.,.,.,.:.:.:PindelSomaticCalls:7	0/1:.:.,.,.,.:.:2:PindelSomaticCalls:13	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
16	84230067	.	GCAACCCCTTCGCT	G	.	.	END=84230081;HOMLEN=23;HOMSEQ=CAACCCCTTCGCTCAACCCCTTC;SVLEN=-13;CSQ=-|intron_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000268624|protein_coding||9/10|ENST00000268624.3:c.1772+115_1772+127del|||||||rs3217260|1||1||1|deletion|HGNC|30714|YES||CCDS10944.1|ENSP00000268624|Q8NCV1|D3DUL6|UPI000013D7CA|NM_139174.3|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000315906|protein_coding||8/9|ENST00000315906.5:c.1526+115_1526+127del|||||||rs3217260|1||1|||deletion|HGNC|30714|||CCDS45536.1|ENSP00000325153|Q8NCV1|D3DUL6|UPI0000073CA5|NM_001145400.1|||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|RP11-486L19.2|ENSG00000250685|Transcript|ENST00000536986|antisense||1/2|ENST00000536986.1:n.172+408_172+420del|||||||rs3217260|1||-1|||deletion|Clone_based_vega_gene||YES||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|RP11-486L19.2|ENSG00000250685|Transcript|ENST00000561900|antisense||||||||||rs3217260|1|1748|-1|||deletion|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000563849|retained_intron||||||||||rs3217260|1|60|1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000564169|retained_intron||||||||||rs3217260|1|1024|1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000564430|retained_intron||6/7|ENST00000564430.1:n.2140+115_2140+127del|||||||rs3217260|1||1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|RP11-486L19.2|ENSG00000250685|Transcript|ENST00000565643|antisense||1/4|ENST00000565643.1:n.172+408_172+420del|||||||rs3217260|1||-1|||deletion|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000566526|retained_intron||7/8|ENST00000566526.1:n.2124+115_2124+127del|||||||rs3217260|1||1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000567413|processed_transcript||||||||||rs3217260|1|4588|1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000567685|protein_coding||||||||||rs3217260|1|625|1|cds_start_NF&cds_end_NF||deletion|HGNC|30714||||ENSP00000454950|||UPI0002467136||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000569221|retained_intron||||||||||rs3217260|1|1515|1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|RP11-486L19.2|ENSG00000250685|Transcript|ENST00000569834|antisense||1/2|ENST00000569834.1:n.171+408_171+420del|||||||rs3217260|1||-1|||deletion|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001589788|||||||||||rs3217260|1|||||deletion|||||||||||||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:4:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:4:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
16	84230082	.	AACCCCTTC	A	.	.	CSQ=-|intron_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000268624|protein_coding||9/10|ENST00000268624.3:c.1772+107_1772+114del|||||||rs770359859|1||1||1|deletion|HGNC|30714|YES||CCDS10944.1|ENSP00000268624|Q8NCV1|D3DUL6|UPI000013D7CA|NM_139174.3|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000315906|protein_coding||8/9|ENST00000315906.5:c.1526+107_1526+114del|||||||rs770359859|1||1|||deletion|HGNC|30714|||CCDS45536.1|ENSP00000325153|Q8NCV1|D3DUL6|UPI0000073CA5|NM_001145400.1|||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|RP11-486L19.2|ENSG00000250685|Transcript|ENST00000536986|antisense||1/2|ENST00000536986.1:n.172+398_172+405del|||||||rs770359859|1||-1|||deletion|Clone_based_vega_gene||YES||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|RP11-486L19.2|ENSG00000250685|Transcript|ENST00000561900|antisense||||||||||rs770359859|1|1763|-1|||deletion|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000563849|retained_intron||||||||||rs770359859|1|50|1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000564169|retained_intron||||||||||rs770359859|1|1039|1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000564430|retained_intron||6/7|ENST00000564430.1:n.2140+107_2140+114del|||||||rs770359859|1||1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|RP11-486L19.2|ENSG00000250685|Transcript|ENST00000565643|antisense||1/4|ENST00000565643.1:n.172+398_172+405del|||||||rs770359859|1||-1|||deletion|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000566526|retained_intron||7/8|ENST00000566526.1:n.2124+107_2124+114del|||||||rs770359859|1||1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000567413|processed_transcript||||||||||rs770359859|1|4603|1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000567685|protein_coding||||||||||rs770359859|1|640|1|cds_start_NF&cds_end_NF||deletion|HGNC|30714||||ENSP00000454950|||UPI0002467136||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000569221|retained_intron||||||||||rs770359859|1|1530|1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|RP11-486L19.2|ENSG00000250685|Transcript|ENST00000569834|antisense||1/2|ENST00000569834.1:n.171+398_171+405del|||||||rs770359859|1||-1|||deletion|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001589788|||||||||||rs770359859|1|||||deletion|||||||||||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT	0/0:10:.,.,.,.:0:.:PASS	0/1:12:8,0,4,0:39:2:PASS	0/0:10:.,.,.,.:.:.:PASS	0/1:12:8,0,4,0:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	0/0:11:10,1,0,0:0:.:PASS	0/1:12:8,0,4,0:39:2:PASS
16	84230091	.	GCTCAA	G	.	.	CSQ=-|intron_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000268624|protein_coding||9/10|ENST00000268624.3:c.1772+117_1772+121del|||||||rs879172869|1||1||1|deletion|HGNC|30714|YES||CCDS10944.1|ENSP00000268624|Q8NCV1|D3DUL6|UPI000013D7CA|NM_139174.3|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000315906|protein_coding||8/9|ENST00000315906.5:c.1526+117_1526+121del|||||||rs879172869|1||1|||deletion|HGNC|30714|||CCDS45536.1|ENSP00000325153|Q8NCV1|D3DUL6|UPI0000073CA5|NM_001145400.1|||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|RP11-486L19.2|ENSG00000250685|Transcript|ENST00000536986|antisense||1/2|ENST00000536986.1:n.172+392_172+396del|||||||rs879172869|1||-1|||deletion|Clone_based_vega_gene||YES||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|RP11-486L19.2|ENSG00000250685|Transcript|ENST00000561900|antisense||||||||||rs879172869|1|1772|-1|||deletion|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000563849|retained_intron||||||||||rs879172869|1|44|1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000564169|retained_intron||||||||||rs879172869|1|1048|1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000564430|retained_intron||6/7|ENST00000564430.1:n.2140+117_2140+121del|||||||rs879172869|1||1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|RP11-486L19.2|ENSG00000250685|Transcript|ENST00000565643|antisense||1/4|ENST00000565643.1:n.172+392_172+396del|||||||rs879172869|1||-1|||deletion|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000566526|retained_intron||7/8|ENST00000566526.1:n.2124+117_2124+121del|||||||rs879172869|1||1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000567413|processed_transcript||||||||||rs879172869|1|4612|1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000567685|protein_coding||||||||||rs879172869|1|649|1|cds_start_NF&cds_end_NF||deletion|HGNC|30714||||ENSP00000454950|||UPI0002467136||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ADAD2|ENSG00000140955|Transcript|ENST00000569221|retained_intron||||||||||rs879172869|1|1539|1|||deletion|HGNC|30714|||||||||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|RP11-486L19.2|ENSG00000250685|Transcript|ENST00000569834|antisense||1/2|ENST00000569834.1:n.171+392_171+396del|||||||rs879172869|1||-1|||deletion|Clone_based_vega_gene||||||||||||||||||||||||||||||||||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001589788|||||||||||rs879172869|1|||||deletion|||||||||||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT	0/0:12:.,.,.,.:0:.:PASS	0/1:11:7,0,4,0:39:2:PASS	0/0:12:.,.,.,.:.:.:PASS	0/1:11:7,0,4,0:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	0/0:12:11,1,0,0:0:.:PASS	0/1:13:9,0,4,0:39:2:PASS
16	89167075	.	C	CCCCAGGAGGCTCCCGGGAG	.	.	END=89167076;HOMLEN=1;HOMSEQ=C;SVLEN=19;CSQ=CCCAGGAGGCTCCCGGGAG|5_prime_UTR_variant|MODIFIER|ACSF3|ENSG00000176715|Transcript|ENST00000317447|protein_coding|3/11||ENST00000317447.4:c.-14_-13insCCAGGAGGCTCCCGGGAGC||363-364/3664|||||rs11273288|1||1||1|insertion|HGNC|27288|YES||CCDS10974.1|ENSP00000320646|Q4G176|H3BTS0&F5H755&F5H5A1&F5H3B2&F5H362&F5GX20|UPI00001AF19E|NM_174917.3&NM_001127214.2&NM_001243279.1&NM_001284316.1|1||||||0.5295|0.7233|0.3978|0.7187|0.4642|0.5032|0.6828||||||||||||1||||||,CCCAGGAGGCTCCCGGGAG|intron_variant|MODIFIER|ACSF3|ENSG00000176715|Transcript|ENST00000378345|protein_coding||1/8|ENST00000378345.4:c.-129-1936_-129-1935insCCAGGAGGCTCCCGGGAGC|||||||rs11273288|1||1|||insertion|HGNC|27288||||ENSP00000367596||F5H755&F5H5A1&F5H3B2&F5H362|UPI000059D3E0||1||||||0.5295|0.7233|0.3978|0.7187|0.4642|0.5032|0.6828||||||||||||1||||||,CCCAGGAGGCTCCCGGGAG|5_prime_UTR_variant|MODIFIER|ACSF3|ENSG00000176715|Transcript|ENST00000406948|protein_coding|2/10||ENST00000406948.3:c.-14_-13insCCAGGAGGCTCCCGGGAGC||120-121/2247|||||rs11273288|1||1|||insertion|HGNC|27288|||CCDS10974.1|ENSP00000384627|Q4G176|H3BTS0&F5H755&F5H5A1&F5H3B2&F5H362&F5GX20|UPI00001AF19E||1||||||0.5295|0.7233|0.3978|0.7187|0.4642|0.5032|0.6828||||||||||||1||||||,CCCAGGAGGCTCCCGGGAG|5_prime_UTR_variant|MODIFIER|ACSF3|ENSG00000176715|Transcript|ENST00000537290|protein_coding|2/3||ENST00000537290.1:c.-14_-13insCCAGGAGGCTCCCGGGAGC||144-145/869|||||rs11273288|1||1|cds_end_NF||insertion|HGNC|27288||||ENSP00000440734||H3BTS0&F5GX20|UPI000204A950||1||||||0.5295|0.7233|0.3978|0.7187|0.4642|0.5032|0.6828||||||||||||1||||||,CCCAGGAGGCTCCCGGGAG|intron_variant|MODIFIER|ACSF3|ENSG00000176715|Transcript|ENST00000537895|protein_coding||1/3|ENST00000537895.1:c.-129-1936_-129-1935insCCAGGAGGCTCCCGGGAGC|||||||rs11273288|1||1|cds_end_NF||insertion|HGNC|27288||||ENSP00000439201||F5H3B2|UPI000204A94F||1||||||0.5295|0.7233|0.3978|0.7187|0.4642|0.5032|0.6828||||||||||||1||||||,CCCAGGAGGCTCCCGGGAG|upstream_gene_variant|MODIFIER|ACSF3|ENSG00000176715|Transcript|ENST00000538340|protein_coding||||||||||rs11273288|1|1945|1|cds_start_NF&cds_end_NF||insertion|HGNC|27288||||ENSP00000445870||H0YH37|UPI000204A954||1||||||0.5295|0.7233|0.3978|0.7187|0.4642|0.5032|0.6828||||||||||||1||||||,CCCAGGAGGCTCCCGGGAG|intron_variant|MODIFIER|ACSF3|ENSG00000176715|Transcript|ENST00000540697|protein_coding||1/5|ENST00000540697.1:c.-129-1936_-129-1935insCCAGGAGGCTCCCGGGAGC|||||||rs11273288|1||1|cds_end_NF||insertion|HGNC|27288||||ENSP00000445397||F5H3B2&F5H362|UPI000204A951||1||||||0.5295|0.7233|0.3978|0.7187|0.4642|0.5032|0.6828||||||||||||1||||||,CCCAGGAGGCTCCCGGGAG|5_prime_UTR_variant|MODIFIER|ACSF3|ENSG00000176715|Transcript|ENST00000541755|protein_coding|4/4||ENST00000541755.2:c.-14_-13insCCAGGAGGCTCCCGGGAGC||377-378/477|||||rs11273288|1||1|cds_end_NF||insertion|HGNC|27288||||ENSP00000457301||H3BTS0|UPI0002467228||1||||||0.5295|0.7233|0.3978|0.7187|0.4642|0.5032|0.6828||||||||||||1||||||,CCCAGGAGGCTCCCGGGAG|5_prime_UTR_variant&NMD_transcript_variant|MODIFIER|ACSF3|ENSG00000176715|Transcript|ENST00000542688|nonsense_mediated_decay|2/9||ENST00000542688.1:c.-14_-13insCCAGGAGGCTCCCGGGAGC||95-96/2024|||||rs11273288|1||1|||insertion|HGNC|27288||||ENSP00000446281||H3BTS0&F5H2G6&F5GX20|UPI00018915D7||1||||||0.5295|0.7233|0.3978|0.7187|0.4642|0.5032|0.6828||||||||||||1||||||,CCCAGGAGGCTCCCGGGAG|upstream_gene_variant|MODIFIER|ACSF3|ENSG00000176715|Transcript|ENST00000543676|protein_coding||||||||||rs11273288|1|2028|1|cds_start_NF||insertion|HGNC|27288||||ENSP00000442683||F5H3B2|UPI000204A955||1||||||0.5295|0.7233|0.3978|0.7187|0.4642|0.5032|0.6828||||||||||||1||||||,CCCAGGAGGCTCCCGGGAG|upstream_gene_variant|MODIFIER|ACSF3|ENSG00000176715|Transcript|ENST00000544543|protein_coding||||||||||rs11273288|1|1684|1|cds_end_NF||insertion|HGNC|27288||||ENSP00000442781||F5H755&F5H3B2&F5H362|UPI000204A953||1||||||0.5295|0.7233|0.3978|0.7187|0.4642|0.5032|0.6828||||||||||||1||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
17	1264611	.	TA	T	.	.	CSQ=-|intron_variant|MODIFIER|YWHAE|ENSG00000108953|Transcript|ENST00000264335|protein_coding||3/5|ENST00000264335.8:c.372-20del|||||||rs55734488|1||-1||1|deletion|HGNC|12851|YES||CCDS11001.1|ENSP00000264335|P62258|B7ZA86|UPI0000021A46|NM_006761.4|1||||||0.4191|0.5202|0.4514|0.4105|0.4673|||0.4478|0.4579|0.4971|0.4432|0.4751|0.4459|0.4302|0.4415|0.4605|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|YWHAE|ENSG00000108953|Transcript|ENST00000466227|nonsense_mediated_decay||2/3|ENST00000466227.2:c.279+612del|||||||rs55734488|1||-1|cds_start_NF||deletion|HGNC|12851||||ENSP00000464883|||UPI0002840E9B||1||||||0.4191|0.5202|0.4514|0.4105|0.4673|||0.4478|0.4579|0.4971|0.4432|0.4751|0.4459|0.4302|0.4415|0.4605|||||||||,-|downstream_gene_variant|MODIFIER|YWHAE|ENSG00000108953|Transcript|ENST00000469398|retained_intron||||||||||rs55734488|1|353|-1|||deletion|HGNC|12851|||||||||1||||||0.4191|0.5202|0.4514|0.4105|0.4673|||0.4478|0.4579|0.4971|0.4432|0.4751|0.4459|0.4302|0.4415|0.4605|||||||||,-|downstream_gene_variant|MODIFIER|YWHAE|ENSG00000108953|Transcript|ENST00000486241|retained_intron||||||||||rs55734488|1|363|-1|||deletion|HGNC|12851|||||||||1||||||0.4191|0.5202|0.4514|0.4105|0.4673|||0.4478|0.4579|0.4971|0.4432|0.4751|0.4459|0.4302|0.4415|0.4605|||||||||,-|downstream_gene_variant|MODIFIER|YWHAE|ENSG00000108953|Transcript|ENST00000489287|retained_intron||||||||||rs55734488|1|3430|-1|||deletion|HGNC|12851|||||||||1||||||0.4191|0.5202|0.4514|0.4105|0.4673|||0.4478|0.4579|0.4971|0.4432|0.4751|0.4459|0.4302|0.4415|0.4605|||||||||,-|upstream_gene_variant|MODIFIER|YWHAE|ENSG00000108953|Transcript|ENST00000496706|protein_coding||||||||||rs55734488|1|24|-1|cds_start_NF||deletion|HGNC|12851||||ENSP00000466324||K7EM20|UPI0002840E9C||1||||||0.4191|0.5202|0.4514|0.4105|0.4673|||0.4478|0.4579|0.4971|0.4432|0.4751|0.4459|0.4302|0.4415|0.4605|||||||||,-|intron_variant|MODIFIER|YWHAE|ENSG00000108953|Transcript|ENST00000571732|protein_coding||4/6|ENST00000571732.1:c.306-20del|||||||rs55734488|1||-1|||deletion|HGNC|12851||||ENSP00000461762|P62258|B7ZA86|UPI00001E6021||1||||||0.4191|0.5202|0.4514|0.4105|0.4673|||0.4478|0.4579|0.4971|0.4432|0.4751|0.4459|0.4302|0.4415|0.4605|||||||||,-|intron_variant|MODIFIER|YWHAE|ENSG00000108953|Transcript|ENST00000573026|protein_coding||1/1|ENST00000573026.1:c.65-15819del|||||||rs55734488|1||-1|||deletion|HGNC|12851||||ENSP00000458386||I3L0W5|UPI0000200576||1||||||0.4191|0.5202|0.4514|0.4105|0.4673|||0.4478|0.4579|0.4971|0.4432|0.4751|0.4459|0.4302|0.4415|0.4605|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|YWHAE|ENSG00000108953|Transcript|ENST00000573196|nonsense_mediated_decay||2/3|ENST00000573196.1:c.264+3541del|||||||rs55734488|1||-1|||deletion|HGNC|12851||||ENSP00000461766||B4DJF2|UPI00017A7205||1||||||0.4191|0.5202|0.4514|0.4105|0.4673|||0.4478|0.4579|0.4971|0.4432|0.4751|0.4459|0.4302|0.4415|0.4605|||||||||,-|intron_variant|MODIFIER|YWHAE|ENSG00000108953|Transcript|ENST00000575977|protein_coding||2/2|ENST00000575977.1:c.264+3541del|||||||rs55734488|1||-1|||deletion|HGNC|12851||||ENSP00000460712||I3L3T1|UPI0000200575||1||||||0.4191|0.5202|0.4514|0.4105|0.4673|||0.4478|0.4579|0.4971|0.4432|0.4751|0.4459|0.4302|0.4415|0.4605|||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001590983|||||||||||rs55734488|1|||||deletion|||||||||||||||||0.4191|0.5202|0.4514|0.4105|0.4673|||0.4478|0.4579|0.4971|0.4432|0.4751|0.4459|0.4302|0.4415|0.4605|||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:26:.,.,.,.:.:.:PASS:0	0/1:32:4,28,1,9:.:2:PASS:5	0/1:26:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:32:4,28,1,9:.:1:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:5	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
17	2297571	.	GCA	G	.	.	END=2297574;HOMLEN=25;HOMSEQ=CACACACACACACACACACACACAC;SVLEN=-2;CSQ=-|intron_variant|MODIFIER|MNT|ENSG00000070444|Transcript|ENST00000174618|protein_coding||3/5|ENST00000174618.4:c.695+26_695+27del|||||||rs35367394|1||-1||1|deletion|HGNC|7188|YES||CCDS11018.1|ENSP00000174618|Q99583|K7ES66|UPI000012F2C6|NM_020310.2|||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|MNT|ENSG00000070444|Transcript|ENST00000571232|processed_transcript||||||||||rs35367394|1|448|-1|||deletion|HGNC|7188|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|MNT|ENSG00000070444|Transcript|ENST00000571836|processed_transcript||||||||||rs35367394|1|1051|-1|||deletion|HGNC|7188|||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|MNT|ENSG00000070444|Transcript|ENST00000572892|processed_transcript||||||||||rs35367394|1|1518|-1|||deletion|HGNC|7188|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|MNT|ENSG00000070444|Transcript|ENST00000574559|processed_transcript||||||||||rs35367394|1|735|-1|||deletion|HGNC|7188|||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|MNT|ENSG00000070444|Transcript|ENST00000575374|processed_transcript||||||||||rs35367394|1|2463|-1|||deletion|HGNC|7188|||||||||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|MNT|ENSG00000070444|Transcript|ENST00000575394|protein_coding||1/1|ENST00000575394.1:c.74-6230_74-6229del|||||||rs35367394|1||-1|||deletion|HGNC|7188||||ENSP00000476269|||UPI00025A2CCA||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|MNT|ENSG00000070444|Transcript|ENST00000575402|retained_intron||||||||||rs35367394|1|2200|-1|||deletion|HGNC|7188|||||||||||||||||||||||||||||||||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000282087|||||||||||rs35367394|1|||||deletion|||||||||||||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:7:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:7:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
17	3352494	.	C	CA	.	.	CSQ=A|intron_variant|MODIFIER|SPATA22|ENSG00000141255|Transcript|ENST00000268981|protein_coding||5/7|ENST00000268981.5:c.330-52dup|||||||rs35147573|1||-1|||insertion|HGNC|30705|||CCDS54067.1|ENSP00000268981|Q8NHS9|I3L517&I3L4D7&I3L2B9&I3L1L5|UPI0001C0B3B9|NM_001170699.1|||||||0.2209|0.3501|0.4187|0.1809|0.2014|0.1994|0.1555|0.1589|0.1586|0.2349|0.1283|0.2933|0.2218|0.1151|0.1568|0.139|||||||||,A|intron_variant|MODIFIER|SPATA22|ENSG00000141255|Transcript|ENST00000355380|protein_coding||4/7|ENST00000355380.4:c.201-52dup|||||||rs35147573|1||-1|||insertion|HGNC|30705|||CCDS54066.1|ENSP00000347541|Q8NHS9|I3L517&I3L2B9&I3L1L5|UPI000013D7EB|NM_001170696.1|||||||0.2209|0.3501|0.4187|0.1809|0.2014|0.1994|0.1555|0.1589|0.1586|0.2349|0.1283|0.2933|0.2218|0.1151|0.1568|0.139|||||||||,A|intron_variant|MODIFIER|SPATA22|ENSG00000141255|Transcript|ENST00000397168|protein_coding||5/8|ENST00000397168.3:c.330-52dup|||||||rs35147573|1||-1|||insertion|HGNC|30705|||CCDS11027.1|ENSP00000380354|Q8NHS9|I3L517&I3L4D7&I3L2B9&I3L1L5|UPI0000140D16|NM_032598.4|||||||0.2209|0.3501|0.4187|0.1809|0.2014|0.1994|0.1555|0.1589|0.1586|0.2349|0.1283|0.2933|0.2218|0.1151|0.1568|0.139|||||||||,A|intron_variant|MODIFIER|SPATA22|ENSG00000141255|Transcript|ENST00000541913|protein_coding||5/8|ENST00000541913.1:c.282-52dup|||||||rs35147573|1||-1|||insertion|HGNC|30705||||ENSP00000441920||I3L517&I3L3S6&I3L2B9&I3L1L5&F5GWB9|UPI0002064D98||||||||0.2209|0.3501|0.4187|0.1809|0.2014|0.1994|0.1555|0.1589|0.1586|0.2349|0.1283|0.2933|0.2218|0.1151|0.1568|0.139|||||||||,A|intron_variant|MODIFIER|SPATA22|ENSG00000141255|Transcript|ENST00000571553|protein_coding||5/6|ENST00000571553.1:c.117-52dup|||||||rs35147573|1||-1|cds_end_NF||insertion|HGNC|30705||||ENSP00000459552||I3L517&I3L2B9&I3L1L5|UPI00025A2CE0||||||||0.2209|0.3501|0.4187|0.1809|0.2014|0.1994|0.1555|0.1589|0.1586|0.2349|0.1283|0.2933|0.2218|0.1151|0.1568|0.139|||||||||,A|intron_variant|MODIFIER|SPATA22|ENSG00000141255|Transcript|ENST00000571607|protein_coding||4/4|ENST00000571607.1:c.117-52dup|||||||rs35147573|1||-1|cds_end_NF||insertion|HGNC|30705||||ENSP00000458923||I3L1L5|UPI00025A2CE4||||||||0.2209|0.3501|0.4187|0.1809|0.2014|0.1994|0.1555|0.1589|0.1586|0.2349|0.1283|0.2933|0.2218|0.1151|0.1568|0.139|||||||||,A|intron_variant|MODIFIER|SPATA22|ENSG00000141255|Transcript|ENST00000572582|protein_coding||5/5|ENST00000572582.1:c.330-52dup|||||||rs35147573|1||-1|cds_end_NF||insertion|HGNC|30705||||ENSP00000461180||I3L4D7&I3L1L5|UPI00025A2CE3||||||||0.2209|0.3501|0.4187|0.1809|0.2014|0.1994|0.1555|0.1589|0.1586|0.2349|0.1283|0.2933|0.2218|0.1151|0.1568|0.139|||||||||,A|intron_variant|MODIFIER|SPATA22|ENSG00000141255|Transcript|ENST00000572969|protein_coding||5/8|ENST00000572969.1:c.330-52dup|||||||rs35147573|1||-1|||insertion|HGNC|30705|||CCDS11027.1|ENSP00000460187|Q8NHS9|I3L517&I3L4D7&I3L2B9&I3L1L5|UPI0000140D16|NM_001170698.1|||||||0.2209|0.3501|0.4187|0.1809|0.2014|0.1994|0.1555|0.1589|0.1586|0.2349|0.1283|0.2933|0.2218|0.1151|0.1568|0.139|||||||||,A|intron_variant|MODIFIER|SPATA22|ENSG00000141255|Transcript|ENST00000573128|protein_coding||5/8|ENST00000573128.1:c.330-52dup|||||||rs35147573|1||-1||1|insertion|HGNC|30705|YES||CCDS11027.1|ENSP00000459580|Q8NHS9|I3L517&I3L4D7&I3L2B9&I3L1L5|UPI0000140D16||||||||0.2209|0.3501|0.4187|0.1809|0.2014|0.1994|0.1555|0.1589|0.1586|0.2349|0.1283|0.2933|0.2218|0.1151|0.1568|0.139|||||||||,A|intron_variant|MODIFIER|SPATA22|ENSG00000141255|Transcript|ENST00000574051|protein_coding||5/5|ENST00000574051.1:c.291-52dup|||||||rs35147573|1||-1|cds_end_NF||insertion|HGNC|30705||||ENSP00000461462||I3L517&I3L4R7&I3L1L5|UPI00025A2CE1||||||||0.2209|0.3501|0.4187|0.1809|0.2014|0.1994|0.1555|0.1589|0.1586|0.2349|0.1283|0.2933|0.2218|0.1151|0.1568|0.139|||||||||,A|intron_variant|MODIFIER|SPATA22|ENSG00000141255|Transcript|ENST00000574797|protein_coding||3/3|ENST00000574797.1:c.117-52dup|||||||rs35147573|1||-1|cds_end_NF||insertion|HGNC|30705||||ENSP00000461722||I3L517&I3L1L5|UPI00025A2CE2||||||||0.2209|0.3501|0.4187|0.1809|0.2014|0.1994|0.1555|0.1589|0.1586|0.2349|0.1283|0.2933|0.2218|0.1151|0.1568|0.139|||||||||,A|intron_variant|MODIFIER|SPATA22|ENSG00000141255|Transcript|ENST00000575375|protein_coding||5/8|ENST00000575375.1:c.330-52dup|||||||rs35147573|1||-1|||insertion|HGNC|30705|||CCDS11027.1|ENSP00000459329|Q8NHS9|I3L517&I3L4D7&I3L2B9&I3L1L5|UPI0000140D16|NM_001170697.1&NM_001170695.1|||||||0.2209|0.3501|0.4187|0.1809|0.2014|0.1994|0.1555|0.1589|0.1586|0.2349|0.1283|0.2933|0.2218|0.1151|0.1568|0.139|||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:26:.,.,.,.:.:.:PASS:0	0/1:20:0,20,0,11:.:2:PASS:3	0/1:26:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:20:0,20,0,11:.:1:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
17	4802255	.	GGCCTCTGCCTCGCTCCACCC	G	.	.	CSQ=-|intron_variant|MODIFIER|CHRNE|ENSG00000108556|Transcript|ENST00000293780|protein_coding||11/11|ENST00000293780.4:c.1326+21_1326+40del|||||||rs147753790|1||-1||1|deletion|HGNC|1966|YES||CCDS11058.1|ENSP00000293780|Q04844|Q8N731|UPI0000125262|NM_000080.3|1|||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|downstream_gene_variant|MODIFIER|MINK1|ENSG00000141503|Transcript|ENST00000347992|protein_coding||||||||||rs147753790|1|907|1|||deletion|HGNC|17565|||CCDS45589.1|ENSP00000269296|Q8N4C8|Q9HBM9&Q8NG69|UPI00000411AB|NM_170663.4||||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|downstream_gene_variant|MODIFIER|MINK1|ENSG00000141503|Transcript|ENST00000355280|protein_coding||||||||||rs147753790|1|908|1|||deletion|HGNC|17565|YES||CCDS45588.1|ENSP00000347427|Q8N4C8|Q9HBM9&Q8NG69|UPI00001678BB|NM_001024937.3&NM_015716.4&NM_153827.4||||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|upstream_gene_variant|MODIFIER|C17orf107|ENSG00000205710|Transcript|ENST00000381365|protein_coding||||||||||rs147753790|1|556|1|||deletion|HGNC|37238|YES||CCDS45591.1|ENSP00000370770|Q6ZR85||UPI00001C0FE1|NM_001145536.1||||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|downstream_gene_variant|MODIFIER|MINK1|ENSG00000141503|Transcript|ENST00000453408|protein_coding||||||||||rs147753790|1|1674|1|||deletion|HGNC|17565|||CCDS45590.1|ENSP00000406487|Q8N4C8|Q9HBM9&Q8NG69|UPI000053F60D|||||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|upstream_gene_variant|MODIFIER|C17orf107|ENSG00000205710|Transcript|ENST00000521575|protein_coding||||||||||rs147753790|1|438|1|||deletion|HGNC|37238||||ENSP00000429241||E5RJ01|UPI0001E8F204|||||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|downstream_gene_variant|MODIFIER|MINK1|ENSG00000141503|Transcript|ENST00000571207|nonsense_mediated_decay||||||||||rs147753790|1|900|1|cds_start_NF||deletion|HGNC|17565||||ENSP00000459699|||UPI00025A2D44|||||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|downstream_gene_variant|MODIFIER|MINK1|ENSG00000141503|Transcript|ENST00000572304|retained_intron||||||||||rs147753790|1|4745|1|||deletion|HGNC|17565||||||||||||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|downstream_gene_variant|MODIFIER|MINK1|ENSG00000141503|Transcript|ENST00000572330|retained_intron||||||||||rs147753790|1|1156|1|||deletion|HGNC|17565||||||||||||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|CHRNE|ENSG00000108556|Transcript|ENST00000572438|retained_intron||6/6|ENST00000572438.1:n.1012+21_1012+40del|||||||rs147753790|1||-1|||deletion|HGNC|1966|||||||||1|||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|downstream_gene_variant|MODIFIER|MINK1|ENSG00000141503|Transcript|ENST00000574453|nonsense_mediated_decay||||||||||rs147753790|1|908|1|||deletion|HGNC|17565||||ENSP00000461500||I3L4T2|UPI00025A2D42|||||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|downstream_gene_variant|MODIFIER|MINK1|ENSG00000141503|Transcript|ENST00000574871|retained_intron||||||||||rs147753790|1|901|1|||deletion|HGNC|17565||||||||||||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|downstream_gene_variant|MODIFIER|MINK1|ENSG00000141503|Transcript|ENST00000575511|retained_intron||||||||||rs147753790|1|3172|1|||deletion|HGNC|17565||||||||||||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|downstream_gene_variant|MODIFIER|CHRNE|ENSG00000108556|Transcript|ENST00000575637|processed_transcript||||||||||rs147753790|1|2029|-1|||deletion|HGNC|1966|||||||||1|||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|downstream_gene_variant|MODIFIER|MINK1|ENSG00000141503|Transcript|ENST00000576037|protein_coding||||||||||rs147753790|1|1816|1|cds_start_NF||deletion|HGNC|17565||||ENSP00000459102||I3L1U1|UPI00025A2D45|||||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000090557|||||||||||rs147753790|1|||||deletion||||||||||||||||||||||0.02746|0.07156|0.1776|0.02954|0.1431|0.137|0.5296|0.1362|0.08897|0.1373|0.3504|||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:5:.,.,.,.:0:.:PASS:0	0/1:13:4,9,1,3:36:2:PASS:6	0/0:5:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:13:4,9,1,3:.:2:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:6	0/0:5:0,5,0,0:0:.:PASS:.	0/1:12:3,5,1,3:36:2:PASS:.
17	55075670	.	CA	CAA,C	.	.	CSQ=AA|intron_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000262288|protein_coding||9/12|ENST00000262288.3:c.881-75dup|||||||rs367630962|1||1||1|sequence_alteration|HGNC|29507|YES||CCDS11593.1|ENSP00000262288|Q9HB40|I3L506|UPI0000038BD2|NM_021626.2|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000262288|protein_coding||9/12|ENST00000262288.3:c.881-75del|||||||rs367630962|2||1||1|sequence_alteration|HGNC|29507|YES||CCDS11593.1|ENSP00000262288|Q9HB40|I3L506|UPI0000038BD2|NM_021626.2|||||||||||||||||||||||||||||||,AA|non_coding_transcript_exon_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000570479|retained_intron|1/4||ENST00000570479.1:n.20dup||20/924|||||rs367630962|1||1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,-|non_coding_transcript_exon_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000570479|retained_intron|1/4||ENST00000570479.1:n.20del||20/924|||||rs367630962|2||1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,AA|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000570480|retained_intron||||||||||rs367630962|1|1208|1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000570480|retained_intron||||||||||rs367630962|2|1208|1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,AA|non_coding_transcript_exon_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000570505|retained_intron|3/3||ENST00000570505.1:n.513dup||513/528|||||rs367630962|1||1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,-|non_coding_transcript_exon_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000570505|retained_intron|3/3||ENST00000570505.1:n.513del||513/528|||||rs367630962|2||1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,AA|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000570589|retained_intron||||||||||rs367630962|1|1175|1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000570589|retained_intron||||||||||rs367630962|2|1175|1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,AA|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000571345|processed_transcript||||||||||rs367630962|1|3335|1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000571345|processed_transcript||||||||||rs367630962|2|3335|1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,AA|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000571898|processed_transcript||||||||||rs367630962|1|2806|1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000571898|processed_transcript||||||||||rs367630962|2|2806|1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,AA|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000572591|nonsense_mediated_decay||||||||||rs367630962|1|1314|1|||sequence_alteration|HGNC|29507||||ENSP00000459807||I3L2N6|UPI00025A2EA9||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000572591|nonsense_mediated_decay||||||||||rs367630962|2|1314|1|||sequence_alteration|HGNC|29507||||ENSP00000459807||I3L2N6|UPI00025A2EA9||||||||||||||||||||||||||||||||,AA|intron_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000573239|protein_coding||1/3|ENST00000573239.1:c.42+1255dup|||||||rs367630962|1||1|cds_start_NF||sequence_alteration|HGNC|29507||||ENSP00000461678|||UPI00025A2EAC||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000573239|protein_coding||1/3|ENST00000573239.1:c.42+1255del|||||||rs367630962|2||1|cds_start_NF||sequence_alteration|HGNC|29507||||ENSP00000461678|||UPI00025A2EAC||||||||||||||||||||||||||||||||,AA|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000573789|retained_intron||||||||||rs367630962|1|2435|1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000573789|retained_intron||||||||||rs367630962|2|2435|1|||sequence_alteration|HGNC|29507|||||||||||||||||||||||||||||||||||||||,AA|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000575395|protein_coding||||||||||rs367630962|1|2766|1|cds_end_NF||sequence_alteration|HGNC|29507||||ENSP00000461694||I3L506|UPI00025A2EAB||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000575395|protein_coding||||||||||rs367630962|2|2766|1|cds_end_NF||sequence_alteration|HGNC|29507||||ENSP00000461694||I3L506|UPI00025A2EAB||||||||||||||||||||||||||||||||,AA|intron_variant&NMD_transcript_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000575423|nonsense_mediated_decay||9/12|ENST00000575423.1:c.*636-75dup|||||||rs367630962|1||1|||sequence_alteration|HGNC|29507||||ENSP00000458671||I3L195|UPI00025A2EA8||||||||||||||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000575423|nonsense_mediated_decay||9/12|ENST00000575423.1:c.*636-75del|||||||rs367630962|2||1|||sequence_alteration|HGNC|29507||||ENSP00000458671||I3L195|UPI00025A2EA8||||||||||||||||||||||||||||||||,AA|intron_variant&NMD_transcript_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000576154|nonsense_mediated_decay||9/12|ENST00000576154.1:c.881-64dup|||||||rs367630962|1||1|||sequence_alteration|HGNC|29507||||ENSP00000458587|Q9HB40|I3L506|UPI000006F01E||||||||||||||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|SCPEP1|ENSG00000121064|Transcript|ENST00000576154|nonsense_mediated_decay||9/12|ENST00000576154.1:c.881-64del|||||||rs367630962|2||1|||sequence_alteration|HGNC|29507||||ENSP00000458587|Q9HB40|I3L506|UPI000006F01E||||||||||||||||||||||||||||||||,AA|upstream_gene_variant|MODIFIER|AC007114.1|ENSG00000265809|Transcript|ENST00000580911|miRNA||||||||||rs367630962|1|4673|1|||sequence_alteration|Clone_based_ensembl_gene||YES||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|AC007114.1|ENSG00000265809|Transcript|ENST00000580911|miRNA||||||||||rs367630962|2|4673|1|||sequence_alteration|Clone_based_ensembl_gene||YES||||||||||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT:DP4	0/0:0:31:.:.:PASS:.,.,.,.	0/2:8:36:.:2:PASS:41,0,7,0	0/0:.:31:.:.:FalseIndel:.,.,.,.	0/2:.:36:.:2:FalseIndel:41,0,7,0	./.:.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.,.,.	0/0:0:.:.:.:PASS:.,.,.,.	0/2:8:.:.:2:PASS:.,.,.,.	./.:.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.,.,.
17	58525216	.	GA	G	.	.	END=58525218;HOMLEN=11;HOMSEQ=AAAAAAAAAAA;SVLEN=-1;CSQ=-|intron_variant|MODIFIER|APPBP2|ENSG00000062725|Transcript|ENST00000083182|protein_coding||12/12|ENST00000083182.3:c.1505-22del|||||||rs572924329|1||-1||1|deletion|HGNC|622|YES||CCDS32699.1|ENSP00000083182|Q92624|K7EIZ9|UPI000006D959|NM_006380.2&NM_001282476.1||||||||||||0.2135|0.22|0.2813|0.2856|0.3084|0.2964|0.2815|0.2519|0.2729|0.2913|0.3088|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|APPBP2|ENSG00000062725|Transcript|ENST00000589341|nonsense_mediated_decay||11/11|ENST00000589341.1:c.*1230-22del|||||||rs572924329|1||-1|||deletion|HGNC|622||||ENSP00000467025||K7ENN3|UPI0000E038A2|||||||||||||0.2135|0.22|0.2813|0.2856|0.3084|0.2964|0.2815|0.2519|0.2729|0.2913|0.3088|||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
17	67101527	.	TC	T	.	.	END=67101529;HOMLEN=8;HOMSEQ=CCCCCCCC;SVLEN=-1;CSQ=-|intron_variant|MODIFIER|ABCA6|ENSG00000154262|Transcript|ENST00000284425|protein_coding||20/38|ENST00000284425.2:c.2740+75del|||||||rs920437473|1||-1||1|deletion|HGNC|36|YES||CCDS11683.1|ENSP00000284425|Q8N139||UPI000013DD9D|NM_080284.2|||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ABCA6|ENSG00000154262|Transcript|ENST00000589803|retained_intron||||||||||rs920437473|1|104|-1|||deletion|HGNC|36|||||||||||||||||||||||||||||||||||||||,-|non_coding_transcript_exon_variant|MODIFIER|ABCA6|ENSG00000154262|Transcript|ENST00000590311|retained_intron|5/5||ENST00000590311.1:n.6711del||6711/8186|||||rs920437473|1||-1|||deletion|HGNC|36|||||||||||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
17	76456454	.	GAGTGTA	G,GAGTGTGCA	.	.	CSQ=-|intron_variant|MODIFIER|DNAH17|ENSG00000187775|Transcript|ENST00000389840|protein_coding||58/80|ENST00000389840.5:c.9298-121_9298-116del||||||||1||-1||1|sequence_alteration|HGNC|2946|YES|||ENSP00000374490|Q9UFH2||UPI0001A5EE11||1||||||||||||||||||||||||||||||,AGTGTGCA|intron_variant|MODIFIER|DNAH17|ENSG00000187775|Transcript|ENST00000389840|protein_coding||58/80|ENST00000389840.5:c.9298-121_9298-120insGC||||||||2||-1||1|sequence_alteration|HGNC|2946|YES|||ENSP00000374490|Q9UFH2||UPI0001A5EE11||1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|DNAH17|ENSG00000187775|Transcript|ENST00000585328|protein_coding||58/80|ENST00000585328.1:c.9325-121_9325-116del||||||||1||-1|||sequence_alteration|HGNC|2946||||ENSP00000465516||K7EK91|UPI0001611443|NM_173628.3|1||||||||||||||||||||||||||||||,AGTGTGCA|intron_variant|MODIFIER|DNAH17|ENSG00000187775|Transcript|ENST00000585328|protein_coding||58/80|ENST00000585328.1:c.9325-121_9325-120insGC||||||||2||-1|||sequence_alteration|HGNC|2946||||ENSP00000465516||K7EK91|UPI0001611443|NM_173628.3|1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|DNAH17|ENSG00000187775|Transcript|ENST00000586052|processed_transcript||14/34|ENST00000586052.1:n.2722-121_2722-116del||||||||1||-1|||sequence_alteration|HGNC|2946|||||||||1||||||||||||||||||||||||||||||,AGTGTGCA|intron_variant&non_coding_transcript_variant|MODIFIER|DNAH17|ENSG00000187775|Transcript|ENST00000586052|processed_transcript||14/34|ENST00000586052.1:n.2722-121_2722-120insGC||||||||2||-1|||sequence_alteration|HGNC|2946|||||||||1||||||||||||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|DNAH17|ENSG00000187775|Transcript|ENST00000591369|nonsense_mediated_decay||5/27|ENST00000591369.1:c.942-121_942-116del||||||||1||-1|cds_start_NF||sequence_alteration|HGNC|2946||||ENSP00000466150|||UPI000198C831||1||||||||||||||||||||||||||||||,AGTGTGCA|intron_variant&NMD_transcript_variant|MODIFIER|DNAH17|ENSG00000187775|Transcript|ENST00000591369|nonsense_mediated_decay||5/27|ENST00000591369.1:c.942-121_942-120insGC||||||||2||-1|cds_start_NF||sequence_alteration|HGNC|2946||||ENSP00000466150|||UPI000198C831||1||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|DNAH17|ENSG00000187775|Transcript|ENST00000592152|processed_transcript|||||||||||1|1485|-1|||sequence_alteration|HGNC|2946|||||||||1||||||||||||||||||||||||||||||,AGTGTGCA|upstream_gene_variant|MODIFIER|DNAH17|ENSG00000187775|Transcript|ENST00000592152|processed_transcript|||||||||||2|1485|-1|||sequence_alteration|HGNC|2946|||||||||1||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT	0/0:34:.,.,.,.:.:.:PASS	0/2:38:0,37,0,7:.:2:PASS	0/0:34:.,.,.,.:.:.:PASS	0/2:38:0,37,0,7:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.
18	43666280	.	TAGTTAATATATTAATACCTTAAGA	T,TAGTTAATATATTAATACCTTAAGAT	.	.	CSQ=-|intron_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000282050|protein_coding||10/12|ENST00000282050.2:c.1284+49_1285-58del|||||||rs146099416&COSV56359510|1||-1||1|sequence_alteration|HGNC|823|YES||CCDS11927.1|ENSP00000282050|P25705|K7EQH4&K7ERX7&K7EK77&K7EJP1&B4DGW3|UPI000006221A|NM_001001937.1|1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|intron_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000282050|protein_coding||10/12|ENST00000282050.2:c.1284+48_1284+49insA|||||||rs1555694804&COSV56359510|2||-1||1|sequence_alteration|HGNC|823|YES||CCDS11927.1|ENSP00000282050|P25705|K7EQH4&K7ERX7&K7EK77&K7EJP1&B4DGW3|UPI000006221A|NM_001001937.1|1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|intron_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000398752|protein_coding||9/11|ENST00000398752.6:c.1284+49_1285-58del|||||||rs146099416&COSV56359510|1||-1|||sequence_alteration|HGNC|823|||CCDS11927.1|ENSP00000381736|P25705|K7EQH4&K7ERX7&K7EK77&K7EJP1&B4DGW3|UPI000006221A|NM_004046.5&NM_001001935.2|1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|intron_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000398752|protein_coding||9/11|ENST00000398752.6:c.1284+48_1284+49insA|||||||rs1555694804&COSV56359510|2||-1|||sequence_alteration|HGNC|823|||CCDS11927.1|ENSP00000381736|P25705|K7EQH4&K7ERX7&K7EK77&K7EJP1&B4DGW3|UPI000006221A|NM_004046.5&NM_001001935.2|1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000585650|nonsense_mediated_decay||||||||||rs146099416&COSV56359510|1|3621|-1|||sequence_alteration|HGNC|823||||ENSP00000467983||K7EQU6|UPI0002840E40||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000585650|nonsense_mediated_decay||||||||||rs1555694804&COSV56359510|2|3621|-1|||sequence_alteration|HGNC|823||||ENSP00000467983||K7EQU6|UPI0002840E40||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|non_coding_transcript_exon_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000586523|retained_intron|1/1||ENST00000586523.1:n.2359_2382del||2359-2382/4547|||||rs146099416&COSV56359510|1||-1|||sequence_alteration|HGNC|823|||||||||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|non_coding_transcript_exon_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000586523|retained_intron|1/1||ENST00000586523.1:n.2358_2359insA||2359-2382/4547|||||rs1555694804&COSV56359510|2||-1|||sequence_alteration|HGNC|823|||||||||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000586592|nonsense_mediated_decay||9/11|ENST00000586592.1:c.*1347+49_*1348-58del|||||||rs146099416&COSV56359510|1||-1|||sequence_alteration|HGNC|823||||ENSP00000466275|||UPI0000201C9C||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|intron_variant&NMD_transcript_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000586592|nonsense_mediated_decay||9/11|ENST00000586592.1:c.*1347+49_*1347+48insA|||||||rs1555694804&COSV56359510|2||-1|||sequence_alteration|HGNC|823||||ENSP00000466275|||UPI0000201C9C||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000587902|retained_intron||1/2|ENST00000587902.1:n.198+49_199-58del|||||||rs146099416&COSV56359510|1||-1|||sequence_alteration|HGNC|823|||||||||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|intron_variant&non_coding_transcript_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000587902|retained_intron||1/2|ENST00000587902.1:n.198+48_198+49insA|||||||rs1555694804&COSV56359510|2||-1|||sequence_alteration|HGNC|823|||||||||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000589252|protein_coding||||||||||rs146099416&COSV56359510|1|1089|-1|cds_end_NF||sequence_alteration|HGNC|823||||ENSP00000466975||K7ENJ4|UPI0002840E3A||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000589252|protein_coding||||||||||rs1555694804&COSV56359510|2|1089|-1|cds_end_NF||sequence_alteration|HGNC|823||||ENSP00000466975||K7ENJ4|UPI0002840E3A||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000589611|retained_intron||||||||||rs146099416&COSV56359510|1|3091|-1|||sequence_alteration|HGNC|823|||||||||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000589611|retained_intron||||||||||rs1555694804&COSV56359510|2|3091|-1|||sequence_alteration|HGNC|823|||||||||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000589869|protein_coding||||||||||rs146099416&COSV56359510|1|1798|-1|cds_end_NF||sequence_alteration|HGNC|823||||ENSP00000465497||K7EQH4&K7EK77&K7EJP1&B4DGW3|UPI0002840E3B||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000589869|protein_coding||||||||||rs1555694804&COSV56359510|2|1798|-1|cds_end_NF||sequence_alteration|HGNC|823||||ENSP00000465497||K7EQH4&K7EK77&K7EJP1&B4DGW3|UPI0002840E3B||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000590156|nonsense_mediated_decay||9/11|ENST00000590156.1:c.*1180+49_*1181-58del|||||||rs146099416&COSV56359510|1||-1|||sequence_alteration|HGNC|823||||ENSP00000466309||K7EM08|UPI0002840E38||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|intron_variant&NMD_transcript_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000590156|nonsense_mediated_decay||9/11|ENST00000590156.1:c.*1180+49_*1180+48insA|||||||rs1555694804&COSV56359510|2||-1|||sequence_alteration|HGNC|823||||ENSP00000466309||K7EM08|UPI0002840E38||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000590324|protein_coding||||||||||rs146099416&COSV56359510|1|3294|-1|cds_end_NF||sequence_alteration|HGNC|823||||ENSP00000465259||K7EQH4&K7EJP1|UPI0002840E3E||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000590324|protein_coding||||||||||rs1555694804&COSV56359510|2|3294|-1|cds_end_NF||sequence_alteration|HGNC|823||||ENSP00000465259||K7EQH4&K7EJP1|UPI0002840E3E||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000590406|protein_coding||||||||||rs146099416&COSV56359510|1|3261|-1|cds_end_NF||sequence_alteration|HGNC|823||||ENSP00000468458||K7EQH4&K7ERX7&K7EJP1|UPI0002840E3D||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000590406|protein_coding||||||||||rs1555694804&COSV56359510|2|3261|-1|cds_end_NF||sequence_alteration|HGNC|823||||ENSP00000468458||K7EQH4&K7ERX7&K7EJP1|UPI0002840E3D||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000590448|retained_intron||||||||||rs146099416&COSV56359510|1|3421|-1|||sequence_alteration|HGNC|823|||||||||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000590448|retained_intron||||||||||rs1555694804&COSV56359510|2|3421|-1|||sequence_alteration|HGNC|823|||||||||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|intron_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000590665|protein_coding||9/11|ENST00000590665.1:c.1218+49_1219-58del|||||||rs146099416&COSV56359510|1||-1|||sequence_alteration|HGNC|823|||CCDS59315.1|ENSP00000467037||K7ENP3|UPI000258D167|NM_001257334.1|1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|intron_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000590665|protein_coding||9/11|ENST00000590665.1:c.1218+48_1218+49insA|||||||rs1555694804&COSV56359510|2||-1|||sequence_alteration|HGNC|823|||CCDS59315.1|ENSP00000467037||K7ENP3|UPI000258D167|NM_001257334.1|1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000591981|nonsense_mediated_decay||||||||||rs146099416&COSV56359510|1|3484|-1|||sequence_alteration|HGNC|823||||ENSP00000465805||K7EKV9|UPI0002B83269||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000591981|nonsense_mediated_decay||||||||||rs1555694804&COSV56359510|2|3484|-1|||sequence_alteration|HGNC|823||||ENSP00000465805||K7EKV9|UPI0002B83269||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000592364|nonsense_mediated_decay||5/5|ENST00000592364.1:c.*157+49_*158-58del|||||||rs146099416&COSV56359510|1||-1|||sequence_alteration|HGNC|823||||ENSP00000468618||K7ESA0|UPI0002840E39||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|intron_variant&NMD_transcript_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000592364|nonsense_mediated_decay||5/5|ENST00000592364.1:c.*157+49_*157+48insA|||||||rs1555694804&COSV56359510|2||-1|||sequence_alteration|HGNC|823||||ENSP00000468618||K7ESA0|UPI0002840E39||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000592989|protein_coding||||||||||rs146099416&COSV56359510|1|3484|-1|cds_end_NF||sequence_alteration|HGNC|823||||ENSP00000467830||K7EQH4|UPI0002840E3F||1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|downstream_gene_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000592989|protein_coding||||||||||rs1555694804&COSV56359510|2|3484|-1|cds_end_NF||sequence_alteration|HGNC|823||||ENSP00000467830||K7EQH4|UPI0002840E3F||1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||,-|intron_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000593152|protein_coding||9/11|ENST00000593152.2:c.1134+49_1135-58del|||||||rs146099416&COSV56359510|1||-1|||sequence_alteration|HGNC|823|||CCDS58620.1|ENSP00000465477|P25705|K7EQH4&K7EK77&K7EJP1&B4DGW3|UPI00003CEFBB|NM_001257335.1|1|||||0.1669|0.0151|0.2061|0.0397|0.2982|0.3405|||||||||||||0&1|0&1||||||,AGTTAATATATTAATACCTTAAGAT|intron_variant|MODIFIER|ATP5A1|ENSG00000152234|Transcript|ENST00000593152|protein_coding||9/11|ENST00000593152.2:c.1134+48_1134+49insA|||||||rs1555694804&COSV56359510|2||-1|||sequence_alteration|HGNC|823|||CCDS58620.1|ENSP00000465477|P25705|K7EQH4&K7EK77&K7EJP1&B4DGW3|UPI00003CEFBB|NM_001257335.1|1|||||||||||0.04878|0.2361|||||||||||0&1|0&1||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:25:.,.,.,.:.:.:PASS:36	0/2:15:4,6,3,2:.:2:PASS:35	0/0:25:.,.,.,.:.:.:PASS:.	0/2:15:4,6,3,2:.:2:PASS:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/1:.:.,.,.,.:.:.:PindelSomaticCalls:36	0/1:.:.,.,.,.:.:2:PindelSomaticCalls:35	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
19	2901114	.	CGCCGAAGTCT	C	.	.	CSQ=-|intron_variant|MODIFIER|ZNF57|ENSG00000171970|Transcript|ENST00000306908|protein_coding||1/3|ENST00000306908.5:c.3+71_3+80del|||||||rs11279103|1||1||1|deletion|HGNC|13125|YES||CCDS12098.1|ENSP00000303696|Q68EA5|K7ERB8&G3V131&E5RHE3&A5HJR3|UPI000006FE5C|NM_173480.2|||||||0.6097|0.8112|0.7212|0.8777|0.771|0.6039|0.8337||||||||||||||||||,-|upstream_gene_variant|MODIFIER|AC119403.1|ENSG00000266938|Transcript|ENST00000590960|processed_pseudogene||||||||||rs11279103|1|3895|-1|||deletion|Clone_based_vega_gene||YES||||||||||||||0.6097|0.8112|0.7212|0.8777|0.771|0.6039|0.8337||||||||||||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000105958|||||||||||rs11279103|1|||||deletion|||||||||||||||||0.6097|0.8112|0.7212|0.8777|0.771|0.6039|0.8337||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:4:.,.,.,.:0:.:PASS:0	0/1:18:2,16,1,5:30:2:PASS:5	0/0:4:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:18:2,16,1,5:.:2:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:5	0/0:4:1,3,0,0:0:.:PASS:.	0/1:18:1,11,1,5:30:2:PASS:.
19	4199809	.	C	CA	.	.	CSQ=A|intron_variant|MODIFIER|ANKRD24|ENSG00000089847|Transcript|ENST00000262970|protein_coding||1/19|ENST00000262970.5:c.394-63_394-62insA|||||||rs112892199|1||1|||insertion|HGNC|29424||||ENSP00000262970|Q8TF21||UPI000170BA2E|||||||0.3622|0.3843|0.3127|0.3234|0.4622|0.3047|0.3898|0.4136|0.3727|0.3854|0.2761|0.3553|0.3441|0.4804|0.4255|0.405|0.308|||||||||,A|intron_variant|MODIFIER|ANKRD24|ENSG00000089847|Transcript|ENST00000318934|protein_coding||2/20|ENST00000318934.4:c.123+43_123+44insA|||||||rs112892199|1||1|||insertion|HGNC|29424|||CCDS45925.1|ENSP00000321731|Q8TF21||UPI000041F5A9|||||||0.3622|0.3843|0.3127|0.3234|0.4622|0.3047|0.3898|0.4136|0.3727|0.3854|0.2761|0.3553|0.3441|0.4804|0.4255|0.405|0.308|||||||||,A|intron_variant&NMD_transcript_variant|MODIFIER|ANKRD24|ENSG00000089847|Transcript|ENST00000595928|nonsense_mediated_decay||1/7|ENST00000595928.1:c.123-63_123-62insA|||||||rs112892199|1||1|cds_start_NF||insertion|HGNC|29424||||ENSP00000471346|||UPI0002A47387|||||||0.3622|0.3843|0.3127|0.3234|0.4622|0.3047|0.3898|0.4136|0.3727|0.3854|0.2761|0.3553|0.3441|0.4804|0.4255|0.405|0.308|||||||||,A|intron_variant|MODIFIER|ANKRD24|ENSG00000089847|Transcript|ENST00000597689|protein_coding||1/15|ENST00000597689.1:c.37-63_37-62insA|||||||rs112892199|1||1|cds_end_NF||insertion|HGNC|29424||||ENSP00000470227||M0QZ18|UPI0000E5A193|||||||0.3622|0.3843|0.3127|0.3234|0.4622|0.3047|0.3898|0.4136|0.3727|0.3854|0.2761|0.3553|0.3441|0.4804|0.4255|0.405|0.308|||||||||,A|intron_variant|MODIFIER|ANKRD24|ENSG00000089847|Transcript|ENST00000600132|protein_coding||3/21|ENST00000600132.1:c.123+43_123+44insA|||||||rs112892199|1||1||1|insertion|HGNC|29424|YES||CCDS45925.1|ENSP00000471252|Q8TF21||UPI000041F5A9|NM_133475.1||||||0.3622|0.3843|0.3127|0.3234|0.4622|0.3047|0.3898|0.4136|0.3727|0.3854|0.2761|0.3553|0.3441|0.4804|0.4255|0.405|0.308|||||||||,A|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001154223|||||||||||rs112892199|1|||||insertion||||||||||||||||0.3622|0.3843|0.3127|0.3234|0.4622|0.3047|0.3898|0.4136|0.3727|0.3854|0.2761|0.3553|0.3441|0.4804|0.4255|0.405|0.308|||||||||,A|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00001608547|||||||||||rs112892199|1|||||insertion||||||||||||||||0.3622|0.3843|0.3127|0.3234|0.4622|0.3047|0.3898|0.4136|0.3727|0.3854|0.2761|0.3553|0.3441|0.4804|0.4255|0.405|0.308|||||||||	GT:DP:DP4:BQ:SS:FT:AD:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50	0/0:3:.,.,.,.:0:.:PASS:0:4:3,3:0,0:1,1:4.03:0:0	0/1:8:5,2,5,2:34:2:PASS:5:8:1,1:7,7:0,0:9.47:0.54:0	0/0:3:.,.,.,.:.:.:FalseIndel:.:.:.,.:.,.:.,.:.:.:.	1/1:8:5,2,5,2:.:2:FalseIndel:.:.:.,.:.,.:.,.:.:.:.	0/0:4:.,.,.,.:.:.:QSI_ref:3:4:3,3:0,0:1,1:4.03:0:0	0/1:8:.,.,.,.:.:2:QSI_ref:1:8:1,1:7,7:0,0:9.47:0.54:0	0/0:.:.,.,.,.:.:.:PASS:0:.:.,.:.,.:.,.:.:.:.	0/1:.:.,.,.,.:.:2:PASS:5:.:.,.:.,.:.,.:.:.:.	0/0:4:4,0,0,0:0:.:FalseIndel:.:.:.,.:.,.:.,.:.:.:.	0/1:9:1,1,5,2:34:2:FalseIndel:.:.:.,.:.,.:.,.:.:.:.
19	16513357	.	CT	C	.	.	END=16513359;HOMLEN=10;HOMSEQ=TTTTTTTTTT;SVLEN=-1;CSQ=-|intron_variant|MODIFIER|EPS15L1|ENSG00000127527|Transcript|ENST00000248070|protein_coding||15/22|ENST00000248070.6:c.1627-62del|||||||rs34782743|1||-1|||deletion|HGNC|24634|||CCDS32944.1|ENSP00000248070|Q9UBC2|B4DME4|UPI0000073E6D|NM_021235.2|1||||||0.1362|0.1037|0.119|0.1769|0.184||||||||||||||||||||,-|intron_variant|MODIFIER|EPS15L1|ENSG00000127527|Transcript|ENST00000455140|protein_coding||15/23|ENST00000455140.2:c.1627-62del|||||||rs34782743|1||-1||1|deletion|HGNC|24634|YES||CCDS58654.1|ENSP00000393313|Q9UBC2||UPI0000D4C04A|NM_001258374.1|1||||||0.1362|0.1037|0.119|0.1769|0.184||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|RN7SL844P|ENSG00000243745|Transcript|ENST00000473320|misc_RNA||||||||||rs34782743|1|3588|-1|||deletion|HGNC|46860|YES||||||||||||||0.1362|0.1037|0.119|0.1769|0.184||||||||||||||||||||,-|intron_variant|MODIFIER|EPS15L1|ENSG00000127527|Transcript|ENST00000535753|protein_coding||15/21|ENST00000535753.2:c.1627-62del|||||||rs34782743|1||-1|||deletion|HGNC|24634|||CCDS58653.1|ENSP00000440103|Q9UBC2|Q69YZ4|UPI000015F6E1|NM_001258375.1|1||||||0.1362|0.1037|0.119|0.1769|0.184||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|EPS15L1|ENSG00000127527|Transcript|ENST00000592031|nonsense_mediated_decay||15/22|ENST00000592031.1:c.*1364-62del|||||||rs34782743|1||-1|||deletion|HGNC|24634||||ENSP00000465286||K7EJR2|UPI0002A472B8||1||||||0.1362|0.1037|0.119|0.1769|0.184||||||||||||||||||||,-|intron_variant|MODIFIER|EPS15L1|ENSG00000127527|Transcript|ENST00000594975|protein_coding||15/21|ENST00000594975.1:c.1627-62del|||||||rs34782743|1||-1|||deletion|HGNC|24634||||ENSP00000471662||M0R165|UPI000048A7D8||1||||||0.1362|0.1037|0.119|0.1769|0.184||||||||||||||||||||,-|intron_variant|MODIFIER|EPS15L1|ENSG00000127527|Transcript|ENST00000597937|protein_coding||15/15|ENST00000597937.1:c.1627-62del|||||||rs34782743|1||-1|||deletion|HGNC|24634|||CCDS59363.1|ENSP00000472267|Q9UBC2|M0R2S2&A5PKY0|UPI0000203640|NM_001258376.1|1||||||0.1362|0.1037|0.119|0.1769|0.184||||||||||||||||||||,-|intron_variant|MODIFIER|EPS15L1|ENSG00000127527|Transcript|ENST00000599790|protein_coding||1/7|ENST00000599790.1:c.14-62del|||||||rs34782743|1||-1|cds_start_NF||deletion|HGNC|24634||||ENSP00000473242|||UPI0002A47211||1||||||0.1362|0.1037|0.119|0.1769|0.184||||||||||||||||||||,-|intron_variant|MODIFIER|EPS15L1|ENSG00000127527|Transcript|ENST00000602009|protein_coding||9/9|ENST00000602009.1:c.1165-62del|||||||rs34782743|1||-1|||deletion|HGNC|24634||||ENSP00000472771||M0R2S2|UPI000059D6A4||1||||||0.1362|0.1037|0.119|0.1769|0.184||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|EPS15L1|ENSG00000127527|Transcript|ENST00000602022|nonsense_mediated_decay||15/22|ENST00000602022.1:c.1627-62del|||||||rs34782743|1||-1|||deletion|HGNC|24634|||CCDS58653.1|ENSP00000471981|Q9UBC2|Q69YZ4|UPI000015F6E1||1||||||0.1362|0.1037|0.119|0.1769|0.184||||||||||||||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:4:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:4:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
19	41062902	.	AC	A	.	.	CSQ=-|intron_variant|MODIFIER|SPTBN4|ENSG00000160460|Transcript|ENST00000338932|protein_coding||25/30|ENST00000338932.3:c.5290-16del|||||||rs34510741|1||1|||deletion|HGNC|14896||||ENSP00000340345|Q9H254||UPI000002B418|||||||||||||||0.459|0.4639|0.4607|0.46|0.4564|0.4579|0.4597|0.446|0.4547|||||||||,-|intron_variant|MODIFIER|SPTBN4|ENSG00000160460|Transcript|ENST00000352632|protein_coding||25/35|ENST00000352632.3:c.5290-16del|||||||rs34510741|1||1||1|deletion|HGNC|14896|YES||CCDS12559.1|ENSP00000263373|Q9H254||UPI0000135DBB|||||||||||||||0.459|0.4639|0.4607|0.46|0.4564|0.4579|0.4597|0.446|0.4547|||||||||,-|intron_variant|MODIFIER|SPTBN4|ENSG00000160460|Transcript|ENST00000392023|protein_coding||8/9|ENST00000392023.1:c.1318-16del|||||||rs34510741|1||1|||deletion|HGNC|14896|||CCDS42569.1|ENSP00000375877|Q9H254|Q9UFA1|UPI000059D725|NM_025213.2||||||||||||||0.459|0.4639|0.4607|0.46|0.4564|0.4579|0.4597|0.446|0.4547|||||||||,-|intron_variant|MODIFIER|SPTBN4|ENSG00000160460|Transcript|ENST00000392025|protein_coding||9/19|ENST00000392025.1:c.1519-16del|||||||rs34510741|1||1|||deletion|HGNC|14896||||ENSP00000375879||C9JY79|UPI0000366E05|||||||||||||||0.459|0.4639|0.4607|0.46|0.4564|0.4579|0.4597|0.446|0.4547|||||||||,-|intron_variant|MODIFIER|SPTBN4|ENSG00000160460|Transcript|ENST00000595535|protein_coding||25/26|ENST00000595535.1:c.5290-16del|||||||rs34510741|1||1|||deletion|HGNC|14896||||ENSP00000470693||Q9UFA1&M0QZQ3|UPI0002A47323|||||||||||||||0.459|0.4639|0.4607|0.46|0.4564|0.4579|0.4597|0.446|0.4547|||||||||,-|downstream_gene_variant|MODIFIER|SPTBN4|ENSG00000160460|Transcript|ENST00000596900|retained_intron||||||||||rs34510741|1|1695|1|||deletion|HGNC|14896||||||||||||||||||||||0.459|0.4639|0.4607|0.46|0.4564|0.4579|0.4597|0.446|0.4547|||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|SPTBN4|ENSG00000160460|Transcript|ENST00000597389|nonsense_mediated_decay||13/23|ENST00000597389.1:c.*1446-16del|||||||rs34510741|1||1|cds_start_NF||deletion|HGNC|14896||||ENSP00000472136||M0R1V6|UPI0002A470AE|||||||||||||||0.459|0.4639|0.4607|0.46|0.4564|0.4579|0.4597|0.446|0.4547|||||||||,-|intron_variant|MODIFIER|SPTBN4|ENSG00000160460|Transcript|ENST00000598249|protein_coding||25/35|ENST00000598249.1:c.5290-16del|||||||rs34510741|1||1|||deletion|HGNC|14896|||CCDS12559.1|ENSP00000469242|Q9H254||UPI0000135DBB|NM_020971.2||||||||||||||0.459|0.4639|0.4607|0.46|0.4564|0.4579|0.4597|0.446|0.4547|||||||||	GT:AD:DP:BQ:SS:FT:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50	0/0:0:20:.:.:PASS:20:13,13:0,0:7,7:18.23:0.01:0	0/1:9:46:.:2:PASS:46:14,14:13,13:21,21:41.55:0:0	./.:.:.:.:.:.:.:.,.:.,.:.,.:.:.:.	./.:.:.:.:.:.:.:.,.:.,.:.,.:.:.:.	0/0:13:20:.:.:QSI_ref-Repeat:20:13,13:0,0:7,7:18.23:0.01:0	0/1:14:46:.:2:QSI_ref-Repeat:46:14,14:13,13:21,21:41.55:0:0	0/0:0:.:.:.:PASS:.:.,.:.,.:.,.:.:.:.	0/1:9:.:.:2:PASS:.:.,.:.,.:.,.:.:.:.	./.:.:.:.:.:.:.:.,.:.,.:.,.:.:.:.	./.:.:.:.:.:.:.:.,.:.,.:.,.:.:.:.
20	17928175	.	CCTG	C	.	.	CSQ=-|inframe_deletion|MODERATE|SNX5|ENSG00000089006|Transcript|ENST00000377759|protein_coding|11/13||ENST00000377759.4:c.1030_1032del|ENSP00000366988.3:p.Gln344del|1325-1327/2270|1030-1032/1215|344/404|Q/-|CAG/-||1||-1|||deletion|HGNC|14969|||CCDS13130.1|ENSP00000366988|Q9Y5X3||UPI0000135B43|NM_014426.2||||Pfam:PF09325&PIRSF:PIRSF036924&PANTHER:PTHR10555&PANTHER:PTHR10555:SF6&Superfamily:SSF103657|||||||||||||||||||||||||||,-|inframe_deletion|MODERATE|SNX5|ENSG00000089006|Transcript|ENST00000377768|protein_coding|12/14||ENST00000377768.3:c.1030_1032del|ENSP00000366998.3:p.Gln344del|1343-1345/2288|1030-1032/1215|344/404|Q/-|CAG/-||1||-1||1|deletion|HGNC|14969|YES||CCDS13130.1|ENSP00000366998|Q9Y5X3||UPI0000135B43|NM_152227.1||||Pfam:PF09325&PIRSF:PIRSF036924&PANTHER:PTHR10555&PANTHER:PTHR10555:SF6&Superfamily:SSF103657|||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SNX5|ENSG00000089006|Transcript|ENST00000419004|protein_coding|||||||||||1|2598|-1|cds_end_NF||deletion|HGNC|14969||||ENSP00000406731||Q5QPE4|UPI000046FCD6||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SNX5|ENSG00000089006|Transcript|ENST00000431277|protein_coding|||||||||||1|1356|-1|cds_end_NF||deletion|HGNC|14969||||ENSP00000404448||Q5QPE5|UPI000046FCD5||||||||||||||||||||||||||||||||,-|non_coding_transcript_exon_variant|MODIFIER|SNX5|ENSG00000089006|Transcript|ENST00000463050|retained_intron|6/6||ENST00000463050.1:n.459_461del||459-461/786||||||1||-1|||deletion|HGNC|14969|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SNX5|ENSG00000089006|Transcript|ENST00000474883|processed_transcript|||||||||||1|3992|-1|||deletion|HGNC|14969|||||||||||||||||||||||||||||||||||||||,-|non_coding_transcript_exon_variant|MODIFIER|SNX5|ENSG00000089006|Transcript|ENST00000476648|processed_transcript|7/9||ENST00000476648.1:n.546_548del||546-548/950||||||1||-1|||deletion|HGNC|14969|||||||||||||||||||||||||||||||||||||||,-|non_coding_transcript_exon_variant|MODIFIER|SNX5|ENSG00000089006|Transcript|ENST00000483485|processed_transcript|12/14||ENST00000483485.1:n.2142_2144del||2142-2144/3087||||||1||-1|||deletion|HGNC|14969|||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|SNX5|ENSG00000089006|Transcript|ENST00000484809|retained_intron|||||||||||1|3910|-1|||deletion|HGNC|14969|||||||||||||||||||||||||||||||||||||||,-|non_coding_transcript_exon_variant|MODIFIER|SNX5|ENSG00000089006|Transcript|ENST00000490175|processed_transcript|11/13||ENST00000490175.1:n.1080_1082del||1080-1082/2025||||||1||-1|||deletion|HGNC|14969|||||||||||||||||||||||||||||||||||||||,-|non_coding_transcript_exon_variant|MODIFIER|SNX5|ENSG00000089006|Transcript|ENST00000491090|processed_transcript|1/4||ENST00000491090.1:n.88_90del||88-90/819||||||1||-1|||deletion|HGNC|14969|||||||||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|SNX5|ENSG00000089006|Transcript|ENST00000494401|processed_transcript|||||||||||1|2788|-1|||deletion|HGNC|14969|||||||||||||||||||||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|SNX5|ENSG00000089006|Transcript|ENST00000606570|retained_intron|||||||||||1|2002|-1|||deletion|HGNC|14969|||||||||||||||||||||||||||||||||||||||	GT:AD:BQ:SS:DP:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50:FT:DP4	0/0:249:.:.:255:256:249,249:0,0:9,9:248.44:0.19:0:PASS:.,.,.,.	0/1:239:.:2:330:339:239,239:69,70:37,37:325.76:0:0:PASS:240,90,49,17	0/0:.:.:.:255:.:.,.:.,.:.,.:.:.:.:PASS:.,.,.,.	0/1:.:.:2:330:.:.,.:.,.:.,.:.:.:.:PASS:240,90,49,17	0/0:249:.:.:256:256:249,249:0,0:9,9:248.44:0.19:0:PASS:.,.,.,.	0/1:239:.:2:339:339:239,239:69,70:37,37:325.76:0:0:PASS:.,.,.,.	0/0:0:.:.:.:.:.,.:.,.:.,.:.:.:.:PASS:.,.,.,.	0/1:55:.:2:.:.:.,.:.,.:.,.:.:.:.:PASS:.,.,.,.	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.:.,.,.,.
20	30060720	.	GCA	G	.	.	CSQ=-|upstream_gene_variant|MODIFIER|REM1|ENSG00000088320|Transcript|ENST00000201979|protein_coding||||||||||rs34150499|1|2374|1|||deletion|HGNC|15922|YES||CCDS13181.1|ENSP00000201979|O75628||UPI0000073CEB|NM_014012.5||||||||||||||0.03977|0.002389|0.04327|0.03699|0.04636|0.03243|0.04198|0.03237|0.0579|||||||||,-|intron_variant|MODIFIER|DEFB124|ENSG00000180383|Transcript|ENST00000317676|protein_coding||1/1|ENST00000317676.2:c.58+37_58+38del|||||||rs34150499|1||-1||1|deletion|HGNC|18104|YES||CCDS33457.1|ENSP00000326309|Q8NES8||UPI00005E4A77|NM_001037500.1||||||||||||||0.03977|0.002389|0.04327|0.03699|0.04636|0.03243|0.04198|0.03237|0.0579|||||||||,-|non_coding_transcript_exon_variant|MODIFIER|DEFB124|ENSG00000180383|Transcript|ENST00000481595|processed_transcript|2/2||ENST00000481595.1:n.251_252del||251-252/571|||||rs34150499|1||-1|||deletion|HGNC|18104||||||||||||||||||||||0.03977|0.002389|0.04327|0.03699|0.04636|0.03243|0.04198|0.03237|0.0579|||||||||	GT:AD:DP:BQ:SS:FT:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50:DP4	0/0:37:40:.:.:PASS:40:37,37:0,0:4,4:38.52:0.01:0:.,.,.,.	0/1:40:54:.:2:PASS:55:40,41:9,9:9,9:58.12:0:0:49,5,7,1	0/0:.:40:.:.:PASS:.:.,.:.,.:.,.:.:.:.:.,.,.,.	0/1:.:54:.:2:PASS:.:.,.:.,.:.,.:.:.:.:49,5,7,1	0/0:37:40:.:.:QSI_ref-Repeat:40:37,37:0,0:4,4:38.52:0.01:0:.,.,.,.	0/1:40:55:.:2:QSI_ref-Repeat:55:40,41:9,9:9,9:58.12:0:0:.,.,.,.	0/0:0:.:.:.:PASS:.:.,.:.,.:.,.:.:.:.:.,.,.,.	0/1:7:.:.:2:PASS:.:.,.:.,.:.,.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.,.,.,.
20	30354257	.	GGT	GGTGT,G	.	.	CSQ=GTGT|intron_variant|MODIFIER|TPX2|ENSG00000088325|Transcript|ENST00000300403|protein_coding||4/17|ENST00000300403.6:c.230-101_230-100dup|||||||rs35700111|1||1||1|sequence_alteration|HGNC|1249|YES||CCDS13190.1|ENSP00000300403|Q9ULW0|Q96FC3&Q643R0&B3KM90|UPI00000015BB|NM_012112.4|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|TPX2|ENSG00000088325|Transcript|ENST00000300403|protein_coding||4/17|ENST00000300403.6:c.230-101_230-100del|||||||rs35700111|2||1||1|sequence_alteration|HGNC|1249|YES||CCDS13190.1|ENSP00000300403|Q9ULW0|Q96FC3&Q643R0&B3KM90|UPI00000015BB|NM_012112.4|||||||||||||||||||||||||||||||,GTGT|intron_variant|MODIFIER|TPX2|ENSG00000088325|Transcript|ENST00000340513|protein_coding||4/18|ENST00000340513.4:c.230-101_230-100dup|||||||rs35700111|1||1|||sequence_alteration|HGNC|1249||||ENSP00000341145||Q96RR5&Q96FC3|UPI0000071EB5||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|TPX2|ENSG00000088325|Transcript|ENST00000340513|protein_coding||4/18|ENST00000340513.4:c.230-101_230-100del|||||||rs35700111|2||1|||sequence_alteration|HGNC|1249||||ENSP00000341145||Q96RR5&Q96FC3|UPI0000071EB5||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:48:.,.,.,.:.:.:PASS:1	0/1:41:48,0,9,0:.:2:PASS:3	0/0:48:.,.,.,.:.:.:PASS:.	0/1:41:48,0,9,0:.:2:PASS:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/2:.:.,.,.,.:.:.:PindelSomaticCalls:1	0/2:.:.,.,.,.:.:2:PindelSomaticCalls:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
20	46279833	.	GCAA	G	.	.	CSQ=-|inframe_deletion|MODERATE|NCOA3|ENSG00000124151|Transcript|ENST00000341724|protein_coding|19/22||ENST00000341724.6:c.3540_3542del|ENSP00000342123.6:p.Gln1202del|3799-3801/7774|3538-3540/4053|1180/1350|Q/-|CAA/-|rs767107142|1||1|||deletion|HGNC|7670||||ENSP00000342123||C9JCR8|UPI0000456FAB|||||Coiled-coils_(Ncoils):Coil&PIRSF:PIRSF038181&PANTHER:PTHR10684&PANTHER:PTHR10684:SF3&Low_complexity_(Seg):seg|2|||||||||0.0002913|0.0001254|2.92e-05|0|0.002922|4.766e-05|9.211e-05|0|0.0001334|||||||||,-|inframe_deletion|MODERATE|NCOA3|ENSG00000124151|Transcript|ENST00000371997|protein_coding|20/23||ENST00000371997.3:c.3735_3737del|ENSP00000361065.3:p.Gln1267del|3910-3912/6750|3733-3735/4248|1245/1415|Q/-|CAA/-|rs767107142|1||1|||deletion|HGNC|7670|||CCDS54472.1|ENSP00000361065|Q9Y6Q9||UPI000002AEE1|||||Coiled-coils_(Ncoils):Coil&PIRSF:PIRSF038181&PANTHER:PTHR10684&PANTHER:PTHR10684:SF3&Low_complexity_(Seg):seg|2|||||||||0.0002913|0.0001254|2.92e-05|0|0.002922|4.766e-05|9.211e-05|0|0.0001334|||||||||,-|inframe_deletion|MODERATE|NCOA3|ENSG00000124151|Transcript|ENST00000371998|protein_coding|20/23||ENST00000371998.3:c.3762_3764del|ENSP00000361066.3:p.Gln1276del|3951-3953/4668|3760-3762/4275|1254/1424|Q/-|CAA/-|rs767107142|1||1||1|deletion|HGNC|7670|YES||CCDS13407.1|ENSP00000361066|Q9Y6Q9|Q569F6&B4DYT5|UPI000012FE45|||||Coiled-coils_(Ncoils):Coil&PIRSF:PIRSF038181&PANTHER:PTHR10684&PANTHER:PTHR10684:SF3&Low_complexity_(Seg):seg|2|||||||||0.0002913|0.0001254|2.92e-05|0|0.002922|4.766e-05|9.211e-05|0|0.0001334|||||||||,-|inframe_deletion|MODERATE|NCOA3|ENSG00000124151|Transcript|ENST00000372004|protein_coding|20/23||ENST00000372004.3:c.3750_3752del|ENSP00000361073.1:p.Gln1272del|3964-3966/7939|3748-3750/4263|1250/1420|Q/-|CAA/-|rs767107142|1||1|||deletion|HGNC|7670|||CCDS13406.1|ENSP00000361073|Q9Y6Q9|Q0IIN7|UPI000002AEE3|NM_006534.3&NM_181659.2&NM_001174088.1&NM_001174087.1||||Coiled-coils_(Ncoils):Coil&PIRSF:PIRSF038181&PANTHER:PTHR10684&PANTHER:PTHR10684:SF3&Low_complexity_(Seg):seg|2|||||||||0.0002913|0.0001254|2.92e-05|0|0.002922|4.766e-05|9.211e-05|0|0.0001334|||||||||	GT:DP:DP4:BQ:SS:FT	0/0:70:.,.,.,.:.:.:PASS	0/1:108:82,25,8,3:.:2:PASS	0/0:70:.,.,.,.:.:.:PASS	0/1:108:82,25,8,3:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.
21	30338153	.	C	CA	.	.	END=30338154;HOMLEN=11;HOMSEQ=AAAAAAAAAAA;SVLEN=1;CSQ=A|intron_variant|MODIFIER|LTN1|ENSG00000198862|Transcript|ENST00000361371|protein_coding||11/29|ENST00000361371.5:c.2163+33dup|||||||rs71335064|1||-1|||insertion|HGNC|13082||||ENSP00000354977|O94822|G1UI34|UPI00001A95E0|||||||||||||0.07002|0.07561|0.1059|0.1156|0.1356|0.1134|0.1198|0.03406|0.0989|0.1127|0.1603|||||||||,A|intron_variant|MODIFIER|LTN1|ENSG00000198862|Transcript|ENST00000389194|protein_coding||11/29|ENST00000389194.2:c.2301+33dup|||||||rs71335064|1||-1||1|insertion|HGNC|13082|YES||CCDS33527.2|ENSP00000373846|O94822|G1UI34|UPI000049DF6C|NM_015565.2||||||||||||0.07002|0.07561|0.1059|0.1156|0.1356|0.1134|0.1198|0.03406|0.0989|0.1127|0.1603|||||||||,A|intron_variant|MODIFIER|LTN1|ENSG00000198862|Transcript|ENST00000389195|protein_coding||11/12|ENST00000389195.2:c.2301+33dup|||||||rs71335064|1||-1|||insertion|HGNC|13082||||ENSP00000373847||H7BYG8&G1UI34|UPI0000E5A38F|||||||||||||0.07002|0.07561|0.1059|0.1156|0.1356|0.1134|0.1198|0.03406|0.0989|0.1127|0.1603|||||||||,A|downstream_gene_variant|MODIFIER|LTN1|ENSG00000198862|Transcript|ENST00000483326|nonsense_mediated_decay||||||||||rs71335064|1|1063|-1|cds_start_NF||insertion|HGNC|13082||||ENSP00000474690|||UPI00033351CA|||||||||||||0.07002|0.07561|0.1059|0.1156|0.1356|0.1134|0.1198|0.03406|0.0989|0.1127|0.1603|||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:3:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
21	34726106	.	A	AT	.	.	CSQ=T|intron_variant|MODIFIER|IFNAR1|ENSG00000142166|Transcript|ENST00000270139|protein_coding||10/10|ENST00000270139.3:c.1440+24dup|||||||rs772509641|1||1||1|insertion|HGNC|5432|YES||CCDS13624.1|ENSP00000270139|P17181|B4DNT3|UPI000006FE3C|NM_000629.2||||||||||||||5.992e-05|7.422e-05|0|0.0001161|0|0|0.0001004|0|0|||||||||,T|intron_variant|MODIFIER|IFNAR1|ENSG00000142166|Transcript|ENST00000416947|protein_coding||10/10|ENST00000416947.2:c.1233+24dup|||||||rs772509641|1||1|||insertion|HGNC|5432||||ENSP00000395606||B4DNT3|UPI00017A79D5|||||||||||||||5.992e-05|7.422e-05|0|0.0001161|0|0|0.0001004|0|0|||||||||,T|intron_variant|MODIFIER|IFNAR1|ENSG00000142166|Transcript|ENST00000442357|protein_coding||10/10|ENST00000442357.2:c.1257+912dup|||||||rs772509641|1||1|||insertion|HGNC|5432||||ENSP00000407406||C9JV08|UPI0001AE6298|||||||||||||||5.992e-05|7.422e-05|0|0.0001161|0|0|0.0001004|0|0|||||||||	GT:AD:BQ:SS:DP:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50:FT:DP4	0/0:191:.:.:229:229:191,191:0,0:33,33:233.88:0.18:0:PASS:.,.,.,.	0/1:148:.:2:253:253:148,148:57,57:44,44:260.76:0:0:PASS:47,204,14,36	0/0:.:.:.:228:.:.,.:.,.:.,.:.:.:.:FalseIndel:.,.,.,.	0/1:.:.:2:251:.:.,.:.,.:.,.:.:.:.:FalseIndel:47,204,14,36	0/0:191:.:.:229:229:191,191:0,0:33,33:233.88:0.18:0:PASS:.,.,.,.	0/1:148:.:2:253:253:148,148:57,57:44,44:260.76:0:0:PASS:.,.,.,.	0/0:0:.:.:.:.:.,.:.,.:.,.:.:.:.:PASS:.,.,.,.	0/1:40:.:2:.:.:.,.:.,.:.,.:.:.:.:PASS:.,.,.,.	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.:.,.,.,.
21	41384834	.	C	CTT	.	.	CSQ=TT|3_prime_UTR_variant|MODIFIER|DSCAM|ENSG00000171587|Transcript|ENST00000400454|protein_coding|33/33||ENST00000400454.1:c.*125_*126dup||6643-6644/8552|||||rs11451228|1||-1||1|insertion|HGNC|3039|YES||CCDS42929.1|ENSP00000383303|O60469||UPI00000422DF|NM_001271534.1&NM_001389.3|||||||0.2451|0.2277|0.1389|0.3738|0.2423||||||||||||||||||||,TT|3_prime_UTR_variant|MODIFIER|DSCAM|ENSG00000171587|Transcript|ENST00000404019|protein_coding|29/29||ENST00000404019.2:c.*125_*126dup||5367-5368/5374|||||rs11451228|1||-1|cds_start_NF||insertion|HGNC|3039||||ENSP00000385342||Q8WY19|UPI0000070397||||||||0.2451|0.2277|0.1389|0.3738|0.2423||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:4:.,.,.,.:.:.:PASS:0	0/1:6:6,0,2,0:.:2:PASS:3	1/1:4:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:6:6,0,2,0:.:1:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
21	45712357	.	AC	A	.	.	CSQ=-|intron_variant|MODIFIER|AIRE|ENSG00000160224|Transcript|ENST00000291582|protein_coding||9/13|ENST00000291582.5:c.1095+78del|||||||rs5844181|1||1||1|deletion|HGNC|360|YES||CCDS13706.1|ENSP00000291582|O43918||UPI0000030FA6|NM_000383.3|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|AIRE|ENSG00000160224|Transcript|ENST00000329347|protein_coding||3/8|ENST00000329347.4:c.474+78del|||||||rs5844181|1||1|||deletion|HGNC|360||||ENSP00000331055||C9JFR1|UPI00015DF77E||1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|AIRE|ENSG00000160224|Transcript|ENST00000337909|retained_intron||2/6|ENST00000337909.5:n.556+78del|||||||rs5844181|1||1|||deletion|HGNC|360|||||||||1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|AIRE|ENSG00000160224|Transcript|ENST00000355347|protein_coding||3/7|ENST00000355347.4:c.474+78del|||||||rs5844181|1||1|||deletion|HGNC|360||||ENSP00000347505||C9JL37|UPI0000457002||1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|AIRE|ENSG00000160224|Transcript|ENST00000397994|retained_intron||2/7|ENST00000397994.4:n.556+78del|||||||rs5844181|1||1|||deletion|HGNC|360|||||||||1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|AIRE|ENSG00000160224|Transcript|ENST00000527919|retained_intron||9/13|ENST00000527919.1:n.1825+78del|||||||rs5844181|1||1|||deletion|HGNC|360|||||||||1||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|AIRE|ENSG00000160224|Transcript|ENST00000530812|retained_intron||7/11|ENST00000530812.1:n.2842+78del|||||||rs5844181|1||1|||deletion|HGNC|360|||||||||1||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:3:.,.,.,.:.:.:PASS:0	0/1:8:0,7,0,4:.:2:PASS:4	0/0:3:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:8:0,7,0,4:.:2:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:4	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
22	31301792	.	A	AGCCACC	.	.	END=31301793;HOMLEN=18;HOMSEQ=GCCACCGCCACCGCCACC;SVLEN=6;CSQ=GCCACC|intron_variant|MODIFIER|OSBP2|ENSG00000184792|Transcript|ENST00000332585|protein_coding||12/13|ENST00000332585.6:c.2376-19_2376-14dup|||||||rs201836388|1||1||1|insertion|HGNC|8504|YES||CCDS43002.1|ENSP00000332576|Q969R2|C9JS84&C9J7J0|UPI0000161E15|NM_030758.3|||||||0.003|0.0303|0|0.0487|0.0072|0.007321|0.04166|0.03039|0.006374|0.02086|0.08495|0.0001156|0.0256|0.04123|0.03983|0.01713|||||||||,GCCACC|intron_variant|MODIFIER|OSBP2|ENSG00000184792|Transcript|ENST00000382310|protein_coding||11/11|ENST00000382310.3:c.2229-19_2229-14dup|||||||rs201836388|1||1|||insertion|HGNC|8504||||ENSP00000371747||C9J7J0&B4DFA8|UPI00017A6E02||||||||0.003|0.0303|0|0.0487|0.0072|0.007321|0.04166|0.03039|0.006374|0.02086|0.08495|0.0001156|0.0256|0.04123|0.03983|0.01713|||||||||,GCCACC|intron_variant|MODIFIER|OSBP2|ENSG00000184792|Transcript|ENST00000401475|protein_coding||11/12|ENST00000401475.1:c.1275-19_1275-14dup|||||||rs201836388|1||1|||insertion|HGNC|8504|||CCDS63450.1|ENSP00000385254||Q8NA37&C9J7J0&B4DTR3|UPI0000072878|NM_001282740.1|||||||0.003|0.0303|0|0.0487|0.0072|0.007321|0.04166|0.03039|0.006374|0.02086|0.08495|0.0001156|0.0256|0.04123|0.03983|0.01713|||||||||,GCCACC|intron_variant|MODIFIER|OSBP2|ENSG00000184792|Transcript|ENST00000403222|protein_coding||13/14|ENST00000403222.3:c.1878-19_1878-14dup|||||||rs201836388|1||1|||insertion|HGNC|8504|||CCDS63446.1|ENSP00000384213||Q8NA37&C9J7J0&B4DTR3&B4DKE4&B0QYF9|UPI00017A766C|NM_001282738.1|||||||0.003|0.0303|0|0.0487|0.0072|0.007321|0.04166|0.03039|0.006374|0.02086|0.08495|0.0001156|0.0256|0.04123|0.03983|0.01713|||||||||,GCCACC|intron_variant|MODIFIER|OSBP2|ENSG00000184792|Transcript|ENST00000407373|protein_coding||12/13|ENST00000407373.1:c.1857-19_1857-14dup|||||||rs201836388|1||1|||insertion|HGNC|8504||||ENSP00000385237||Q6ZN50&C9JS84&C9J7J0|UPI000035E79C||||||||0.003|0.0303|0|0.0487|0.0072|0.007321|0.04166|0.03039|0.006374|0.02086|0.08495|0.0001156|0.0256|0.04123|0.03983|0.01713|||||||||,GCCACC|downstream_gene_variant|MODIFIER|EIF4HP2|ENSG00000237977|Transcript|ENST00000424380|processed_pseudogene||||||||||rs201836388|1|3024|1|||insertion|HGNC|49036|YES||||||||||||||0.003|0.0303|0|0.0487|0.0072|0.007321|0.04166|0.03039|0.006374|0.02086|0.08495|0.0001156|0.0256|0.04123|0.03983|0.01713|||||||||,GCCACC|intron_variant|MODIFIER|OSBP2|ENSG00000184792|Transcript|ENST00000431368|protein_coding||10/11|ENST00000431368.1:c.1391-19_1391-14dup|||||||rs201836388|1||1|cds_start_NF||insertion|HGNC|8504||||ENSP00000415274|||UPI000173A33B||||||||0.003|0.0303|0|0.0487|0.0072|0.007321|0.04166|0.03039|0.006374|0.02086|0.08495|0.0001156|0.0256|0.04123|0.03983|0.01713|||||||||,GCCACC|intron_variant|MODIFIER|OSBP2|ENSG00000184792|Transcript|ENST00000437268|protein_coding||11/12|ENST00000437268.2:c.1602-19_1602-14dup|||||||rs201836388|1||1|||insertion|HGNC|8504|||CCDS63449.1|ENSP00000389200||F5H2A3&C9JS84&C9J7J0|UPI0002065311|NM_001282741.1|||||||0.003|0.0303|0|0.0487|0.0072|0.007321|0.04166|0.03039|0.006374|0.02086|0.08495|0.0001156|0.0256|0.04123|0.03983|0.01713|||||||||,GCCACC|intron_variant|MODIFIER|OSBP2|ENSG00000184792|Transcript|ENST00000446658|protein_coding||12/13|ENST00000446658.2:c.2373-19_2373-14dup|||||||rs201836388|1||1|||insertion|HGNC|8504|||CCDS63448.1|ENSP00000392080||Q8NA37&Q0VF99&C9J7J0&B4DTR3|UPI0000DB2601|NM_001282739.1|||||||0.003|0.0303|0|0.0487|0.0072|0.007321|0.04166|0.03039|0.006374|0.02086|0.08495|0.0001156|0.0256|0.04123|0.03983|0.01713|||||||||,GCCACC|intron_variant|MODIFIER|OSBP2|ENSG00000184792|Transcript|ENST00000452656|protein_coding||8/9|ENST00000452656.1:c.1084-19_1084-14dup|||||||rs201836388|1||1|cds_start_NF||insertion|HGNC|8504||||ENSP00000409838||H7C368|UPI0001610FCC||||||||0.003|0.0303|0|0.0487|0.0072|0.007321|0.04166|0.03039|0.006374|0.02086|0.08495|0.0001156|0.0256|0.04123|0.03983|0.01713|||||||||,GCCACC|intron_variant|MODIFIER|OSBP2|ENSG00000184792|Transcript|ENST00000535268|protein_coding||10/11|ENST00000535268.1:c.1008-19_1008-14dup|||||||rs201836388|1||1|||insertion|HGNC|8504|||CCDS63451.1|ENSP00000438713||B4DTR3|UPI00017A7E0D|NM_001282742.1|||||||0.003|0.0303|0|0.0487|0.0072|0.007321|0.04166|0.03039|0.006374|0.02086|0.08495|0.0001156|0.0256|0.04123|0.03983|0.01713|||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:4:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:4:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
22	41918653	.	GT	G	.	.	CSQ=-|intron_variant|MODIFIER|ACO2|ENSG00000100412|Transcript|ENST00000216254|protein_coding||9/17|ENST00000216254.4:c.1139-179del|||||||rs11331024|1||1||1|deletion|HGNC|118|YES||CCDS14017.1|ENSP00000216254|Q99798|B4DZ08&B4DEC3|UPI000003CA3B|NM_001098.2|1||||||0.0272|0.4308|0.0546|0.2137|0.3262||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|POLR3H|ENSG00000100413|Transcript|ENST00000355209|protein_coding||||||||||rs11331024|1|3176|-1|||deletion|HGNC|30349|YES||CCDS14018.1|ENSP00000347345|Q9Y535||UPI0000073CE5|NM_001018050.2|1||||||0.0272|0.4308|0.0546|0.2137|0.3262||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|POLR3H|ENSG00000100413|Transcript|ENST00000396504|protein_coding||||||||||rs11331024|1|3154|-1|||deletion|HGNC|30349|||CCDS14018.1|ENSP00000379761|Q9Y535||UPI0000073CE5|NM_138338.3&NM_001282885.1&NM_001282884.1|1||||||0.0272|0.4308|0.0546|0.2137|0.3262||||||||||||||||||||,-|intron_variant|MODIFIER|ACO2|ENSG00000100412|Transcript|ENST00000396512|protein_coding||9/17|ENST00000396512.3:c.1214-179del|||||||rs11331024|1||1|||deletion|HGNC|118||||ENSP00000379769||B4DEC3&A2A274|UPI0000D4CA22||1||||||0.0272|0.4308|0.0546|0.2137|0.3262||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ACO2|ENSG00000100412|Transcript|ENST00000466237|processed_transcript||||||||||rs11331024|1|1060|1|||deletion|HGNC|118|||||||||1||||||0.0272|0.4308|0.0546|0.2137|0.3262||||||||||||||||||||	GT:AD:BQ:SS:DP:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50:FT	0/0:0:.:.:2:2:2,2:0,0:0,0:5.77:0:0:PASS	0/1:4:.:2:4:4:0,0:4,4:0,0:5.63:0:0:PASS	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.	0/0:2:.:.:2:2:2,2:0,0:0,0:5.77:0:0:QSI_ref	0/1:0:.:2:4:4:0,0:4,4:0,0:5.63:0:0:QSI_ref	0/0:0:.:.:.:.:.,.:.,.:.,.:.:.:.:PASS	0/1:4:.:2:.:.:.,.:.,.:.,.:.:.:.:PASS	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.	./.:.:.:.:.:.:.,.:.,.:.,.:.:.:.:.
X	23724675	.	CAAA	C,CA	.	.	CSQ=-|intron_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000336430|protein_coding||10/14|ENST00000336430.7:c.815+67_815+69del|||||||rs35002168|1||-1|||sequence_alteration|HGNC|17152|||CCDS35216.1|ENSP00000336580|Q9Y305|Q9H2R8&Q96EA2|UPI000013F264|NM_001033583.2|||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000336430|protein_coding||10/14|ENST00000336430.7:c.815+68_815+69del||||||||2||-1|||sequence_alteration|HGNC|17152|||CCDS35216.1|ENSP00000336580|Q9Y305|Q9H2R8&Q96EA2|UPI000013F264|NM_001033583.2|||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000379295|protein_coding||12/16|ENST00000379295.1:c.635+67_635+69del|||||||rs35002168|1||-1|||sequence_alteration|HGNC|17152||||ENSP00000368597|Q9Y305|Q9H2R8|UPI00001AEFDC||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000379295|protein_coding||12/16|ENST00000379295.1:c.635+68_635+69del||||||||2||-1|||sequence_alteration|HGNC|17152||||ENSP00000368597|Q9Y305|Q9H2R8|UPI00001AEFDC||||||||||||||||||||||||||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000379297|retained_intron||1/5|ENST00000379297.1:n.573+67_573+69del|||||||rs35002168|1||-1|||sequence_alteration|HGNC|17152|||||||||||||||||||||||||||||||||||||||,A|intron_variant&non_coding_transcript_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000379297|retained_intron||1/5|ENST00000379297.1:n.573+68_573+69del||||||||2||-1|||sequence_alteration|HGNC|17152|||||||||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000379303|protein_coding||11/15|ENST00000379303.5:c.842+67_842+69del|||||||rs35002168|1||-1||1|sequence_alteration|HGNC|17152|YES||CCDS43924.1|ENSP00000368605|Q9Y305|Q9H2R8|UPI00003D7D31|NM_001037171.1|||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000379303|protein_coding||11/15|ENST00000379303.5:c.842+68_842+69del||||||||2||-1||1|sequence_alteration|HGNC|17152|YES||CCDS43924.1|ENSP00000368605|Q9Y305|Q9H2R8|UPI00003D7D31|NM_001037171.1|||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000449612|retained_intron||||||||||rs35002168|1|1156|-1|||sequence_alteration|HGNC|17152|||||||||||||||||||||||||||||||||||||||,A|downstream_gene_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000449612|retained_intron|||||||||||2|1156|-1|||sequence_alteration|HGNC|17152|||||||||||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000473710|protein_coding||7/9|ENST00000473710.1:c.593+67_593+69del|||||||rs35002168|1||-1|cds_start_NF&cds_end_NF||sequence_alteration|HGNC|17152||||ENSP00000420490||H7C5Q2|UPI0001B791A0||||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000473710|protein_coding||7/9|ENST00000473710.1:c.593+68_593+69del||||||||2||-1|cds_start_NF&cds_end_NF||sequence_alteration|HGNC|17152||||ENSP00000420490||H7C5Q2|UPI0001B791A0||||||||||||||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000492081|protein_coding||||||||||rs35002168|1|1270|-1|||sequence_alteration|HGNC|17152||||ENSP00000417778||C9J7L8|UPI0001B791A1||||||||||||||||||||||||||||||||,A|downstream_gene_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000492081|protein_coding|||||||||||2|1270|-1|||sequence_alteration|HGNC|17152||||ENSP00000417778||C9J7L8|UPI0001B791A1||||||||||||||||||||||||||||||||,-|intron_variant&NMD_transcript_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000494361|nonsense_mediated_decay||10/14|ENST00000494361.1:c.*701+67_*701+69del|||||||rs35002168|1||-1|||sequence_alteration|HGNC|17152||||ENSP00000420238||F8WDI2|UPI0000481A21||||||||||||||||||||||||||||||||,A|intron_variant&NMD_transcript_variant|MODIFIER|ACOT9|ENSG00000123130|Transcript|ENST00000494361|nonsense_mediated_decay||10/14|ENST00000494361.1:c.*701+68_*701+69del||||||||2||-1|||sequence_alteration|HGNC|17152||||ENSP00000420238||F8WDI2|UPI0000481A21||||||||||||||||||||||||||||||||	GT:AD:DP:BQ:SS:FT:DP4	0/0:0:28:.:.:PASS:.,.,.,.	0/1:3:20:.:2:PASS:26,0,3,0	0/2:.:28:.:.:VarscanHighConfidenceIndel:.,.,.,.	0/1:.:20:.:5:VarscanHighConfidenceIndel:26,0,3,0	./.:.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.,.,.	0/0:0:.:.:.:PASS:.,.,.,.	0/1:3:.:.:2:PASS:.,.,.,.	./.:.:.:.:.:.:.,.,.,.	./.:.:.:.:.:.:.,.,.,.
X	54972154	.	C	CGT	.	.	CSQ=GT|intron_variant|MODIFIER|PFKFB1|ENSG00000158571|Transcript|ENST00000374992|protein_coding||5/9|ENST00000374992.2:c.394-180_394-179dup|||||||rs779266579|1||-1|||insertion|HGNC|8872||||ENSP00000364131||Q4VBA9|UPI000050ED39||||||||||||||||||||||||||||||||,GT|intron_variant|MODIFIER|PFKFB1|ENSG00000158571|Transcript|ENST00000375006|protein_coding||9/13|ENST00000375006.3:c.994-180_994-179dup|||||||rs779266579|1||-1||1|insertion|HGNC|8872|YES||CCDS14364.1|ENSP00000364145|P16118|I1Z9G4&I1Z9G3|UPI000012A3ED|NM_001271804.1&NM_002625.3|||||||||||||||||||||||||||||||,GT|intron_variant|MODIFIER|PFKFB1|ENSG00000158571|Transcript|ENST00000545676|protein_coding||8/12|ENST00000545676.1:c.799-180_799-179dup|||||||rs779266579|1||-1|||insertion|HGNC|8872|||CCDS65273.1|ENSP00000444074||I1Z9G3&B4DUN5|UPI00017A7F2E|NM_001271805.1|||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT	0/0:13:.,.,.,.:.:.:PASS	0/1:5:0,6,0,2:.:2:PASS	0/0:13:.,.,.,.:.:.:PASS	0/1:5:0,6,0,2:.:2:PASS	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.	./.:.:.,.,.,.:.:.:.
X	55027964	.	AT	A	.	.	END=55027966;HOMLEN=9;HOMSEQ=TTTTTTTTT;SVLEN=-1;CSQ=-|intron_variant|MODIFIER|APEX2|ENSG00000169188|Transcript|ENST00000374987|protein_coding||1/5|ENST00000374987.3:c.158-5del|||||||rs375803683|1||1||1|deletion|HGNC|17889|YES||CCDS14365.1|ENSP00000364126|Q9UBZ4|E5KN95&B7ZA71|UPI0000071F5B|NM_014481.3|||||||0.2233|0.021|0|0.0039|0.007|0.2698|0.0537|0.04282|0.3202|0.02557|0.006513|0.004537|0.004107|0.009142|0.02567|0.003995|||||||||,-|intron_variant&non_coding_transcript_variant|MODIFIER|APEX2|ENSG00000169188|Transcript|ENST00000471758|processed_transcript||1/4|ENST00000471758.1:n.188-5del|||||||rs375803683|1||1|||deletion|HGNC|17889|||||||||||||||0.2233|0.021|0|0.0039|0.007|0.2698|0.0537|0.04282|0.3202|0.02557|0.006513|0.004537|0.004107|0.009142|0.02567|0.003995|||||||||,-|upstream_gene_variant|MODIFIER|PFKFB1|ENSG00000158571|Transcript|ENST00000545676|protein_coding||||||||||rs375803683|1|2998|-1|||deletion|HGNC|8872|||CCDS65273.1|ENSP00000444074||I1Z9G3&B4DUN5|UPI00017A7F2E|NM_001271805.1|||||||0.2233|0.021|0|0.0039|0.007|0.2698|0.0537|0.04282|0.3202|0.02557|0.006513|0.004537|0.004107|0.009142|0.02567|0.003995|||||||||,-|regulatory_region_variant|MODIFIER|||RegulatoryFeature|ENSR00000246753|||||||||||rs375803683|1|||||deletion|||||||||||||||||0.2233|0.021|0|0.0039|0.007|0.2698|0.0537|0.04282|0.3202|0.02557|0.006513|0.004537|0.004107|0.009142|0.02567|0.003995|||||||||	GT:AD:DP:BQ:SS:FT	0/0:0:.:.:.:PASS	0/1:5:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	./.:.:.:.:.:.	0/0:0:.:.:.:PASS	0/1:5:.:.:2:PASS	./.:.:.:.:.:.	./.:.:.:.:.:.
X	70361651	.	CA	CAA,C	.	.	CSQ=AA|intron_variant|MODIFIER|MED12|ENSG00000184634|Transcript|ENST00000333646|protein_coding||43/44|ENST00000333646.6:c.6418-81dup|||||||rs371432455|1||1|||sequence_alteration|HGNC|11957||||ENSP00000333125|Q93074|Q8WWP6&Q7Z3Z5&Q7Z2F4&Q7Z2F1&Q7Z2E0&H0Y6W6|UPI0000212306|NM_005120.2|1||||||0.2094|0.2195|0.0419|0.3407|0.1504||||||||||||||||||||,-|intron_variant|MODIFIER|MED12|ENSG00000184634|Transcript|ENST00000333646|protein_coding||43/44|ENST00000333646.6:c.6418-81del|||||||rs371432455|2||1|||sequence_alteration|HGNC|11957||||ENSP00000333125|Q93074|Q8WWP6&Q7Z3Z5&Q7Z2F4&Q7Z2F1&Q7Z2E0&H0Y6W6|UPI0000212306|NM_005120.2|1||||||||||||||||||||||||||||||,AA|upstream_gene_variant|MODIFIER|NLGN3|ENSG00000196338|Transcript|ENST00000358741|protein_coding||||||||||rs371432455|1|3060|1|||sequence_alteration|HGNC|14289|YES||CCDS55441.1|ENSP00000351591|Q9NZ94||UPI000006FCBB|NM_181303.1|1||||||0.2094|0.2195|0.0419|0.3407|0.1504||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|NLGN3|ENSG00000196338|Transcript|ENST00000358741|protein_coding||||||||||rs371432455|2|3060|1|||sequence_alteration|HGNC|14289|YES||CCDS55441.1|ENSP00000351591|Q9NZ94||UPI000006FCBB|NM_181303.1|1||||||||||||||||||||||||||||||,AA|upstream_gene_variant|MODIFIER|NLGN3|ENSG00000196338|Transcript|ENST00000374051|protein_coding||||||||||rs371432455|1|3041|1|||sequence_alteration|HGNC|14289|||CCDS14407.1|ENSP00000363163|Q9NZ94||UPI000006E386|NM_018977.3|1||||||0.2094|0.2195|0.0419|0.3407|0.1504||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|NLGN3|ENSG00000196338|Transcript|ENST00000374051|protein_coding||||||||||rs371432455|2|3041|1|||sequence_alteration|HGNC|14289|||CCDS14407.1|ENSP00000363163|Q9NZ94||UPI000006E386|NM_018977.3|1||||||||||||||||||||||||||||||,AA|intron_variant|MODIFIER|MED12|ENSG00000184634|Transcript|ENST00000374080|protein_coding||43/44|ENST00000374080.3:c.6409-81dup|||||||rs371432455|1||1||1|sequence_alteration|HGNC|11957|YES||CCDS43970.1|ENSP00000363193|Q93074|Q7Z2F4&Q7Z2F1&Q7Z2E0|UPI00004257E2||1||||||0.2094|0.2195|0.0419|0.3407|0.1504||||||||||||||||||||,-|intron_variant|MODIFIER|MED12|ENSG00000184634|Transcript|ENST00000374080|protein_coding||43/44|ENST00000374080.3:c.6409-81del|||||||rs371432455|2||1||1|sequence_alteration|HGNC|11957|YES||CCDS43970.1|ENSP00000363193|Q93074|Q7Z2F4&Q7Z2F1&Q7Z2E0|UPI00004257E2||1||||||||||||||||||||||||||||||,AA|intron_variant|MODIFIER|MED12|ENSG00000184634|Transcript|ENST00000374102|protein_coding||43/44|ENST00000374102.1:c.6406-81dup|||||||rs371432455|1||1|||sequence_alteration|HGNC|11957||||ENSP00000363215|Q93074|Q7Z2F4&Q7Z2F1&Q7Z2E0|UPI000021230F||1||||||0.2094|0.2195|0.0419|0.3407|0.1504||||||||||||||||||||,-|intron_variant|MODIFIER|MED12|ENSG00000184634|Transcript|ENST00000374102|protein_coding||43/44|ENST00000374102.1:c.6406-81del|||||||rs371432455|2||1|||sequence_alteration|HGNC|11957||||ENSP00000363215|Q93074|Q7Z2F4&Q7Z2F1&Q7Z2E0|UPI000021230F||1||||||||||||||||||||||||||||||,AA|upstream_gene_variant|MODIFIER|NLGN3|ENSG00000196338|Transcript|ENST00000395855|protein_coding||||||||||rs371432455|1|3041|1|cds_end_NF||sequence_alteration|HGNC|14289||||ENSP00000379196||E7EVK0|UPI000059DB42||1||||||0.2094|0.2195|0.0419|0.3407|0.1504||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|NLGN3|ENSG00000196338|Transcript|ENST00000395855|protein_coding||||||||||rs371432455|2|3041|1|cds_end_NF||sequence_alteration|HGNC|14289||||ENSP00000379196||E7EVK0|UPI000059DB42||1||||||||||||||||||||||||||||||,AA|downstream_gene_variant|MODIFIER|MED12|ENSG00000184634|Transcript|ENST00000444034|protein_coding||||||||||rs371432455|1|1047|1|cds_start_NF&cds_end_NF||sequence_alteration|HGNC|11957||||ENSP00000404373|||UPI000059DB41||1||||||0.2094|0.2195|0.0419|0.3407|0.1504||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|MED12|ENSG00000184634|Transcript|ENST00000444034|protein_coding||||||||||rs371432455|2|1047|1|cds_start_NF&cds_end_NF||sequence_alteration|HGNC|11957||||ENSP00000404373|||UPI000059DB41||1||||||||||||||||||||||||||||||,AA|upstream_gene_variant|MODIFIER|NLGN3|ENSG00000196338|Transcript|ENST00000536169|protein_coding||||||||||rs371432455|1|3029|1|||sequence_alteration|HGNC|14289|||CCDS55442.1|ENSP00000445298||E7EVK0&D3DVV1&B7Z3P8|UPI0000212310|NM_001166660.1|1||||||0.2094|0.2195|0.0419|0.3407|0.1504||||||||||||||||||||,-|upstream_gene_variant|MODIFIER|NLGN3|ENSG00000196338|Transcript|ENST00000536169|protein_coding||||||||||rs371432455|2|3029|1|||sequence_alteration|HGNC|14289|||CCDS55442.1|ENSP00000445298||E7EVK0&D3DVV1&B7Z3P8|UPI0000212310|NM_001166660.1|1||||||||||||||||||||||||||||||,AA|downstream_gene_variant|MODIFIER|AL590764.1|ENSG00000265597|Transcript|ENST00000579622|miRNA||||||||||rs371432455|1|496|1|||sequence_alteration|Clone_based_ensembl_gene||YES||||||||||||||0.2094|0.2195|0.0419|0.3407|0.1504||||||||||||||||||||,-|downstream_gene_variant|MODIFIER|AL590764.1|ENSG00000265597|Transcript|ENST00000579622|miRNA||||||||||rs371432455|2|496|1|||sequence_alteration|Clone_based_ensembl_gene||YES||||||||||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:39:.,.,.,.:.:.:PASS:0	0/2:35:38,7,20,2:.:2:PASS:5	0/1:39:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:35:38,7,20,2:.:1:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/2:.:.,.,.,.:.:2:PASS:5	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
X	106461963	.	CA	C	.	.	CSQ=-|intron_variant|MODIFIER|PIH1D3|ENSG00000080572|Transcript|ENST00000336387|protein_coding||3/6|ENST00000336387.4:c.227-121del|||||||rs1234164779|1||1|||deletion|HGNC|28570|||CCDS14528.1|ENSP00000337757|Q9NQM4||UPI0000073CF5||1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|PIH1D3|ENSG00000080572|Transcript|ENST00000372453|protein_coding||3/6|ENST00000372453.3:c.227-121del|||||||rs1234164779|1||1|||deletion|HGNC|28570|||CCDS14528.1|ENSP00000361531|Q9NQM4||UPI0000073CF5|NM_173494.1|1||||||||||||||||||||||||||||||,-|intron_variant|MODIFIER|PIH1D3|ENSG00000080572|Transcript|ENST00000535523|protein_coding||4/7|ENST00000535523.1:c.227-121del|||||||rs1234164779|1||1||1|deletion|HGNC|28570|YES||CCDS14528.1|ENSP00000441930|Q9NQM4||UPI0000073CF5|NM_001169154.1|1||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:23:.,.,.,.:.:.:PASS:0	0/1:13:14,0,3,0:.:2:PASS:3	0/0:23:.,.,.,.:.:.:FalseIndel:.	0/1:13:14,0,3,0:.:2:FalseIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.
X	129203198	.	C	CA	.	.	CSQ=A|intron_variant|MODIFIER|ELF4|ENSG00000102034|Transcript|ENST00000308167|protein_coding||8/8|ENST00000308167.5:c.1187+76dup|||||||rs367640579|1||-1||1|insertion|HGNC|3319|YES||CCDS14617.1|ENSP00000311280|Q99607|B1AL80|UPI0000072B32|NM_001421.3|1||||||||||||||||||||||||||||||,A|intron_variant|MODIFIER|ELF4|ENSG00000102034|Transcript|ENST00000335997|protein_coding||8/8|ENST00000335997.7:c.1187+76dup|||||||rs367640579|1||-1|||insertion|HGNC|3319|||CCDS14617.1|ENSP00000338608|Q99607|B1AL80|UPI0000072B32|NM_001127197.1|1||||||||||||||||||||||||||||||,A|downstream_gene_variant|MODIFIER|ELF4|ENSG00000102034|Transcript|ENST00000434609|protein_coding||||||||||rs367640579|1|4881|-1|cds_end_NF||insertion|HGNC|3319||||ENSP00000407572||B1AL80|UPI00004A3A3E||1||||||||||||||||||||||||||||||	GT:DP:DP4:BQ:SS:FT:AD	0/0:11:.,.,.,.:.:.:PASS:0	0/1:9:12,0,5,0:.:2:PASS:3	0/0:11:.,.,.,.:.:.:VarscanHighConfidenceIndel:.	0/1:9:12,0,5,0:.:2:VarscanHighConfidenceIndel:.	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.	0/0:.:.,.,.,.:.:.:PASS:0	0/1:.:.,.,.,.:.:2:PASS:3	./.:.:.,.,.,.:.:.:.:.	./.:.:.,.,.,.:.:.:.:.