Commit 77942e1a authored by Pradat Yoann's avatar Pradat Yoann
Browse files

[dev] successful run example and tag v.0.99

parent e8ab514f
# Project specific
/examples/
/htmlcov/
# Logs
......
name: 3.8_bt_variant
channels:
- anaconda
- defaults
dependencies:
- appnope=0.1.0=py38_1001
- attrs=19.3.0=py_0
- backcall=0.2.0=py_0
- blas=1.0=mkl
- ca-certificates=2020.6.24=0
- certifi=2020.6.20=py38_0
- coverage=5.0=py38h1de35cc_0
- decorator=4.4.2=py_0
- iniconfig=1.0.1=py_0
- intel-openmp=2019.4=233
- ipython=7.17.0=py38h39e3cac_0
- ipython_genutils=0.2.0=py38_0
- jedi=0.17.2=py38_0
- libcxx=10.0.0=1
- libedit=3.1.20191231=h1de35cc_1
- libffi=3.3=hb1e8313_2
- mkl=2019.4=233
- mkl-service=2.3.0=py38hfbe908c_0
- mkl_fft=1.1.0=py38hc64f4ea_0
- mkl_random=1.1.1=py38h959d312_0
- more-itertools=8.4.0=py_0
- ncurses=6.2=h0a44026_1
- numpy=1.19.1=py38h3b9f5b6_0
- numpy-base=1.19.1=py38hcfb5961_0
- openssl=1.1.1g=h1de35cc_0
- packaging=20.4=py_0
- pandas=1.1.0=py38hb1e8313_0
- parso=0.7.0=py_0
- pexpect=4.8.0=py38_1
- pickleshare=0.7.5=py38_1001
- pip=20.2.2=py38_0
- pluggy=0.13.1=py38_0
- prompt-toolkit=3.0.5=py_0
- ptyprocess=0.6.0=py38_0
- py=1.9.0=py_0
- pygments=2.6.1=py_0
- pyparsing=2.4.7=py_0
- pytest=6.0.1=py38_0
- pytest-cov=2.10.0=py_0
- python=3.8.5=h26836e1_0
- python-dateutil=2.8.1=py_0
- pytz=2020.1=py_0
- readline=8.0=h1de35cc_0
- setuptools=49.4.0=py38_0
- six=1.15.0=py_0
- sqlite=3.32.3=hffcf06c_0
- tk=8.6.10=hb0a8c7a_0
- toml=0.10.1=py_0
- traitlets=4.3.3=py38_0
- wcwidth=0.2.5=py_0
- wheel=0.34.2=py38_0
- xz=5.2.5=h1de35cc_0
- zlib=1.2.11=h1de35cc_3
prefix: /usr/local/anaconda3/envs/3.8_bt_variant
##fileformat=VCFv4.1
##fileDate=20160402
##tcgaversion=1.1
##reference=<ID=hg19,source="http://www.broadinstitute.org/ftp/pub//seq/references/Homo_sapiens_assembly19.fasta">
##assembly=.
##center="broad.mit.edu"
##phasing=none
##geneAnno=http://www.gencodegenes.org/
##vcfProcessLog=<InputVCF=<.>,InputVCFSource=<.>,InputVCFVer=<.>,InputVCFParam=<.>,InputVCFgeneAnno=<https://tcga-data.nci.nih.gov/docs/GAF/GAF3.0/>>
##INDIVIDUAL=TCGA-A1-A0SB
##SAMPLE=<ID=NORMAL,SampleTCGABarcode=TCGA-A1-A0SB-10B-01D-A142-09,SampleName=TCGA-A1-A0SB-10B-01D-A142-09,Individual=TCGA-A1-A0SB,Description="Normal sample",Platform=Illumina,Source=dbGaP,Accession=.,softwareName=<muTect,CallIndelsPipeline>,softwareVer=<119,65>,softwareParam=<.>,File=TCGA-A1-A0SB-10B-01D-A142-09,SampleUUID=a3254f8e-3bbd-42fc-abea-a5f25b7648b3,MetadataResource=https://tcga-data.nci.nih.gov/uuid/uuidws/mapping/xml/uuid/a3254f8e-3bbd-42fc-abea-a5f25b7648b3>
##SAMPLE=<ID=PRIMARY,SampleTCGABarcode=TCGA-A1-A0SB-01A-11D-A142-09,SampleName=TCGA-A1-A0SB-01A-11D-A142-09,Individual=TCGA-A1-A0SB,Description="Primary Tumor",Platform=Illumina,Source=dbGaP,Accession=.,softwareName=<muTect,CallIndelsPipeline>,softwareVer=<119,65>,softwareParam=<.>,File=TCGA-A1-A0SB-01A-11D-A142-09,SampleUUID=db9d40fb-bfce-4c3b-a6c2-41c5c88982f1,MetadataResource=https://tcga-data.nci.nih.gov/uuid/uuidws/mapping/xml/uuid/db9d40fb-bfce-4c3b-a6c2-41c5c88982f1>
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Depth of reads supporting alleles 0/1/2/3...">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read depth at this position in the sample">
##FORMAT=<ID=FA,Number=.,Type=Float,Description="Fractions of reads (excluding MQ0 from both ref and alt) supporting each reported alternative allele, per sample">
##FORMAT=<ID=MQ0,Number=1,Type=Integer,Description="Number of Mapping Quality Zero Reads per sample">
##FORMAT=<ID=SS,Number=1,Type=Integer,Description="Variant status relative to non-adjacent Normal,0=wildtype,1=germline,2=somatic,3=LOH,4=post-transcriptional modification,5=unknown">
##FORMAT=<ID=BQ,Number=.,Type=Integer,Description="Average base quality for reads supporting alleles">
##FORMAT=<ID=SSC,Number=1,Type=Integer,Description="Somatic score between 0 and 255">
##INFO=<ID=Gene,Number=1,Type=String,Description="Hugo Gene Symbol">
##INFO=<ID=VT,Number=1,Type=String,Description="Variant type, can be SNP, INS or DEL">
##INFO=<ID=VC,Number=1,Type=String,Description="Somatic variant classification">
##INFO=<ID=SS,Number=1,Type=String,Description="Somatic status of sample">
##INFO=<ID=SOMATIC,Number=0,Type=Flag,Description="Indicates if record is a somatic mutation">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP membership">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth across samples">
##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
##INFO=<ID=TID,Number=1,Type=String,Description="Transcript ID">
##INFO=<ID=VLSC,Number=1,Type=Integer,Description="Final somatic score between 0 and 255 when multiple lines of evidence are available">
##FILTER=<ID=mf1,Description="Filtered out by MuTect v.1">
##FILTER=<ID=oxoG3,Description="Filtered out by OxoG Artifact Filter v3">
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NORMAL PRIMARY
1 16386305 rs143272992 G GC 50 PASS DB;DP=17;Gene=FAM131C;MQ0=0;SOMATIC;SS=Somatic;VC=Intron;VT=INS;TID=ENST00000375662.4;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:11,0:11:0.000:0:.:2:. 0/1:4,2:6:0.333:0:.:2:.
3 147121629 . ATC A 50 PASS DP=12;Gene=ZIC4;MQ0=0;SOMATIC;SS=Somatic;VC=Intron;VT=DEL;TID=ENST00000491672.1;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:6,0:6:0.000:0:.:2:. 0/1:4,2:6:0.333:0:.:2:.
3 184043925 rs112208190 AAC A 50 PASS DB;DP=13;Gene=EIF4G1;MQ0=0;SOMATIC;SS=Somatic;VC=Intron;VT=DEL;TID=ENST00000392537.2;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:7,0:7:0.000:0:.:2:. 0/1:2,4:6:0.667:0:.:2:.
7 22533451 rs116873396 TCA T 50 PASS DB;DP=28;Gene=STEAP1B;MQ0=0;SOMATIC;SS=Somatic;VC=Frame_Shift_Del;VT=DEL;TID=ENST00000404369.4;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:22,0:22:0.000:0:.:2:. 0/1:4,2:6:0.333:0:.:2:.
11 112042479 . CT C 50 PASS DP=37;Gene=TEX12;MQ0=0;SOMATIC;SS=Somatic;VC=Intron;VT=DEL;TID=ENST00000280358.4;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:31,0:31:0.000:0:.:2:. 0/1:4,2:6:0.333:0:.:2:.
12 49431403 . G GT 50 PASS DP=81;Gene=KMT2D;MQ0=0;SOMATIC;SS=Somatic;VC=Frame_Shift_Ins;VT=INS;TID=ENST00000301067.7;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:48,0:48:0.000:0:.:2:. 0/1:26,7:33:0.212:0:.:2:.
13 33332313 . CA C 50 PASS DP=53;Gene=PDS5B;MQ0=0;SOMATIC;SS=Somatic;VC=Frame_Shift_Del;VT=DEL;TID=ENST00000315596.10;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:47,0:47:0.000:0:.:2:. 0/1:4,2:6:0.333:0:.:2:.
17 38712160 . CT C 50 PASS DP=11;Gene=CCR7;MQ0=0;SOMATIC;SS=Somatic;VC=Intron;VT=DEL;TID=ENST00000246657.2;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:5,0:5:0.000:0:.:2:. 0/1:4,2:6:0.333:0:.:2:.
20 50342306 . TTC T 50 PASS DP=37;Gene=ATP9A;MQ0=0;SOMATIC;SS=Somatic;VC=Intron;VT=DEL;TID=ENST00000338821.5;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:22,0:22:0.000:0:.:2:. 0/1:9,6:15:0.400:0:.:2:.
##fileformat=VCFv4.1
##fileDate=20160402
##tcgaversion=1.1
##reference=<ID=hg19,source="http://www.broadinstitute.org/ftp/pub//seq/references/Homo_sapiens_assembly19.fasta">
##assembly=.
##center="broad.mit.edu"
##phasing=none
##geneAnno=http://www.gencodegenes.org/
##vcfProcessLog=<InputVCF=<.>,InputVCFSource=<.>,InputVCFVer=<.>,InputVCFParam=<.>,InputVCFgeneAnno=<https://tcga-data.nci.nih.gov/docs/GAF/GAF3.0/>>
##INDIVIDUAL=TCGA-A1-A0SB
##SAMPLE=<ID=NORMAL,SampleTCGABarcode=TCGA-A1-A0SB-10B-01D-A142-09,SampleName=TCGA-A1-A0SB-10B-01D-A142-09,Individual=TCGA-A1-A0SB,Description="Normal sample",Platform=Illumina,Source=dbGaP,Accession=.,softwareName=<muTect,CallIndelsPipeline>,softwareVer=<119,65>,softwareParam=<.>,File=TCGA-A1-A0SB-10B-01D-A142-09,SampleUUID=a3254f8e-3bbd-42fc-abea-a5f25b7648b3,MetadataResource=https://tcga-data.nci.nih.gov/uuid/uuidws/mapping/xml/uuid/a3254f8e-3bbd-42fc-abea-a5f25b7648b3>
##SAMPLE=<ID=PRIMARY,SampleTCGABarcode=TCGA-A1-A0SB-01A-11D-A142-09,SampleName=TCGA-A1-A0SB-01A-11D-A142-09,Individual=TCGA-A1-A0SB,Description="Primary Tumor",Platform=Illumina,Source=dbGaP,Accession=.,softwareName=<muTect,CallIndelsPipeline>,softwareVer=<119,65>,softwareParam=<.>,File=TCGA-A1-A0SB-01A-11D-A142-09,SampleUUID=db9d40fb-bfce-4c3b-a6c2-41c5c88982f1,MetadataResource=https://tcga-data.nci.nih.gov/uuid/uuidws/mapping/xml/uuid/db9d40fb-bfce-4c3b-a6c2-41c5c88982f1>
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Depth of reads supporting alleles 0/1/2/3...">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read depth at this position in the sample">
##FORMAT=<ID=FA,Number=.,Type=Float,Description="Fractions of reads (excluding MQ0 from both ref and alt) supporting each reported alternative allele, per sample">
##FORMAT=<ID=MQ0,Number=1,Type=Integer,Description="Number of Mapping Quality Zero Reads per sample">
##FORMAT=<ID=SS,Number=1,Type=Integer,Description="Variant status relative to non-adjacent Normal,0=wildtype,1=germline,2=somatic,3=LOH,4=post-transcriptional modification,5=unknown">
##FORMAT=<ID=BQ,Number=.,Type=Integer,Description="Average base quality for reads supporting alleles">
##FORMAT=<ID=SSC,Number=1,Type=Integer,Description="Somatic score between 0 and 255">
##INFO=<ID=Gene,Number=1,Type=String,Description="Hugo Gene Symbol">
##INFO=<ID=VT,Number=1,Type=String,Description="Variant type, can be SNP, INS or DEL">
##INFO=<ID=VC,Number=1,Type=String,Description="Somatic variant classification">
##INFO=<ID=SS,Number=1,Type=String,Description="Somatic status of sample">
##INFO=<ID=SOMATIC,Number=0,Type=Flag,Description="Indicates if record is a somatic mutation">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP membership">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth across samples">
##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
##INFO=<ID=TID,Number=1,Type=String,Description="Transcript ID">
##INFO=<ID=VLSC,Number=1,Type=Integer,Description="Final somatic score between 0 and 255 when multiple lines of evidence are available">
##FILTER=<ID=mf1,Description="Filtered out by MuTect v.1">
##FILTER=<ID=oxoG3,Description="Filtered out by OxoG Artifact Filter v3">
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NORMAL PRIMARY
1 44476442 . C T 43 PASS DP=127;Gene=SLC6A9;MQ0=0;SOMATIC;SS=Somatic;VC=5'UTR;VT=SNP;TID=ENST00000372307.3;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:69,0:69:0.000:0:.:2:. 0/1:42,16:58:0.276:0:31:2:.
1 244583577 . G T 6 PASS DP=113;Gene=ADSS;MQ0=0;SOMATIC;SS=Somatic;VC=Missense_Mutation;VT=SNP;TID=ENST00000366535.3;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:77,0:77:0.000:0:.:2:. 0/1:33,3:36:0.083:0:32:2:.
2 25678299 . C T 24 PASS DP=50;Gene=DTNB;MQ0=0;SOMATIC;SS=Somatic;VC=Missense_Mutation;VT=SNP;TID=ENST00000406818.3;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:33,0:33:0.000:0:.:2:. 0/1:9,8:17:0.471:0:32:2:.
3 85932472 . C T 56 PASS DP=87;Gene=CADM2;MQ0=0;SOMATIC;SS=Somatic;VC=Silent;VT=SNP;TID=ENST00000383699.3;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:50,0:50:0.000:0:.:2:. 0/1:18,19:37:0.514:0:30:2:.
6 7986778 . G A 27 PASS DP=46;Gene=BLOC1S5-TXNDC5;MQ0=0;SOMATIC;SS=Somatic;VC=Intron;VT=SNP;TID=ENST00000539054.1;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:23,0:23:0.000:0:.:2:. 0/1:13,10:23:0.435:0:29:2:.
7 75609837 . C G 13 PASS DP=19;Gene=POR;MQ0=0;SOMATIC;SS=Somatic;VC=Intron;VT=SNP;TID=ENST00000394893.1;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:8,0:8:0.000:0:.:2:. 0/1:6,5:11:0.455:0:28:2:.
7 149129243 . G A 16 PASS DP=45;Gene=ZNF777;MQ0=0;SOMATIC;SS=Somatic;VC=Missense_Mutation;VT=SNP;TID=ENST00000247930.4;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:18,0:18:0.000:0:.:2:. 0/1:21,6:27:0.222:0:32:2:.
7 150840441 . C T 26 PASS DP=52;Gene=AGAP3;MQ0=0;SOMATIC;SS=Somatic;VC=Missense_Mutation;VT=SNP;TID=ENST00000463381.1;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:28,0:28:0.000:0:.:2:. 0/1:15,9:24:0.375:0:32:2:.
10 116247760 . T C 26 PASS DP=117;Gene=ABLIM1;MQ0=0;SOMATIC;SS=Somatic;VC=Missense_Mutation;VT=SNP;TID=ENST00000392952.3;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:72,0:72:0.000:0:.:2:. 0/1:34,11:45:0.244:0:28:2:.
12 43944926 . T C 44 PASS DP=82;Gene=ADAMTS20;MQ0=0;SOMATIC;SS=Somatic;VC=Missense_Mutation;VT=SNP;TID=ENST00000389420.3;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:50,0:50:0.000:0:.:2:. 0/1:17,15:32:0.469:0:31:2:.
13 50464902 . T C 8 PASS DP=140;Gene=.;MQ0=0;SOMATIC;SS=Somatic;VC=IGR;VT=SNP;TID=.;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:75,0:75:0.000:0:.:2:. 0/1:60,5:65:0.077:0:26:2:.
14 65266493 . T C 20 PASS DP=41;Gene=SPTB;MQ0=0;SOMATIC;SS=Somatic;VC=Missense_Mutation;VT=SNP;TID=ENST00000556626.1;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:21,0:21:0.000:0:.:2:. 0/1:12,8:20:0.400:0:27:2:.
15 91043489 . C T 9 PASS DP=24;Gene=IQGAP1;MQ0=0;SOMATIC;SS=Somatic;VC=3'UTR;VT=SNP;TID=ENST00000268182.5;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:18,0:18:0.000:0:.:2:. 0/1:3,3:6:0.500:0:32:2:.
16 88790292 . T C 20 PASS DP=59;Gene=PIEZO1;MQ0=0;SOMATIC;SS=Somatic;VC=Missense_Mutation;VT=SNP;TID=ENST00000301015.9;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:34,0:34:0.000:0:.:2:. 0/1:18,7:25:0.280:0:33:2:.
17 40272381 . G A 99 PASS DP=96;Gene=KAT2A;MQ0=0;SOMATIC;SS=Somatic;VC=Silent;VT=SNP;TID=ENST00000225916.5;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:35,0:35:0.000:0:.:2:. 0/1:29,32:61:0.525:0:32:2:.
19 42585066 . G A 17 PASS DP=44;Gene=ZNF574;MQ0=0;SOMATIC;SS=Somatic;VC=Missense_Mutation;VT=SNP;TID=ENST00000600245.1;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:19,0:19:0.000:0:.:2:. 0/1:18,7:25:0.280:0:29:2:.
20 16730581 . G A 21 PASS DP=95;Gene=OTOR;MQ0=0;SOMATIC;SS=Somatic;VC=Missense_Mutation;VT=SNP;TID=ENST00000246081.2;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:52,0:52:0.000:0:.:2:. 0/1:35,8:43:0.186:0:33:2:.
22 23040479 . C G 41 PASS DP=48;Gene=IGLV2-23;MQ0=0;SOMATIC;SS=Somatic;VC=RNA;VT=SNP;TID=ENST00000390306.2;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:23,0:23:0.000:0:.:2:. 0/1:12,13:25:0.520:0:33:2:.
X 51076024 rs143435240 G A 6 PASS DB;DP=122;Gene=NUDT10;MQ0=0;SOMATIC;SS=Somatic;VC=Silent;VT=SNP;TID=ENST00000376006.3;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:77,1:78:0.013:0:35:2:. 0/1:41,3:44:0.068:0:32:2:.
X 77160816 . A G 7 PASS DP=74;Gene=COX7B;MQ0=0;SOMATIC;SS=Somatic;VC=3'UTR;VT=SNP;TID=ENST00000481445.1;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:51,0:51:0.000:0:.:2:. 0/1:20,3:23:0.130:0:32:2:.
X 77160852 . T A 7 PASS DP=52;Gene=COX7B;MQ0=0;SOMATIC;SS=Somatic;VC=3'UTR;VT=SNP;TID=ENST00000481445.1;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:35,0:35:0.000:0:.:2:. 0/1:14,3:17:0.176:0:30:2:.
X 78216689 . C T 26 PASS DP=117;Gene=P2RY10;MQ0=0;SOMATIC;SS=Somatic;VC=Silent;VT=SNP;TID=ENST00000171757.2;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:63,0:63:0.000:0:.:2:. 0/1:44,10:54:0.185:0:33:2:.
X 122757148 . A T 6 PASS DP=61;Gene=THOC2;MQ0=0;SOMATIC;SS=Somatic;VC=Intron;VT=SNP;TID=ENST00000245838.8;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:48,0:48:0.000:0:.:2:. 0/1:10,3:13:0.231:0:28:2:.
X 152684244 . T G 6 PASS DP=113;Gene=ZFP92;MQ0=0;SOMATIC;SS=Somatic;VC=Missense_Mutation;VT=SNP;TID=ENST00000338647.5;VLSC=255 GT:AD:DP:FA:MQ0:BQ:SS:SSC 0/0:62,0:62:0.000:0:.:2:. 0/1:48,3:51:0.059:0:34:2:.
tumor_sample normal_sample_barcode tumor_sample_barcode vcf_type present_GA file_id_GA file_name_GA file_size_GA
TCGA-A1-A0SB TCGA-A1-A0SB-10B-01D-A142-09 TCGA-A1-A0SB-01A-11D-A142-09 snv X 36a044b2-f8da-420f-b8a3-e61046755266 TCGA-A1-A0SB_db9d40fb-bfce-4c3b-a6c2-41c5c88982f1_a3254f8e-3bbd-42fc-abea-a5f25b7648b3.oxoG.snp.capture.tcga.vcf 6.53
TCGA-A1-A0SB TCGA-A1-A0SB-10B-01D-A142-09 TCGA-A1-A0SB-01A-11D-A142-09 indel X 5164f318-f4d0-410e-bc44-083e58735c04 TCGA-A1-A0SB_db9d40fb-bfce-4c3b-a6c2-41c5c88982f1_a3254f8e-3bbd-42fc-abea-a5f25b7648b3.indel.capture.tcga.vcf 0.0129
tumor_sample normal_sample_barcode tumor_sample_barcode vcf_type present_HiSeq file_id_HiSeq file_name_HiSeq file_size_HiSeq
TCGA-A1-A0SD TCGA-A1-A0SD-10A-01D-A110-09 TCGA-A1-A0SD-01A-11D-A10Y-09 snv X d23e3a12-207c-4b47-9d36-0977c427ba84 genome.wustl.edu.TCGA-A1-A0SD.snv.0e81f9c986154ce89e59240c3f09534f.vcf.gz 19.1
TCGA-A1-A0SD TCGA-A1-A0SD-10A-01D-A110-09 TCGA-A1-A0SD-01A-11D-A10Y-09 exome
TCGA-A1-A0SD TCGA-A1-A0SD-10A-01D-A110-09 TCGA-A1-A0SD-01A-11D-A10Y-09 indel X 6637f6bc-91a8-4dd8-a315-55d95209afd4 genome.wustl.edu.TCGA-A1-A0SD.indel.0e81f9c986154ce89e59240c3f09534f.vcf.gz 0.94
Hugo_Symbol Entrez_Gene_Id NCBI_Build Chromosome Start_Position End_Position Variant_Quality Filter Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 HGVSc HGVSp HGVSp_Short all_effects Location Gene Feature Feature_type cDNA_position CDS_position Protein_position Amino_acids Codons Existing_variation Consequence IMPACT STRAND SYMBOL_SOURCE HGNC_ID BIOTYPE CCDS ENSP SWISSPROT TREMBL UNIPARC EXON INTRON AF gnomAD_AF MAX_AF MAX_AF_POPS n_GT n_SS n_FA n_DP n_AD t_GT t_SS t_FA t_DP t_AD
FAM131C 348487 GRCh37 1 16386305 16386306 50 PASS Intron INS - - C rs542191066 - - c.451+58dup FAM131C,intron_variant,,ENST00000375662,NM_182623.2;CLCNKB,downstream_gene_variant,,ENST00000375667,NM_001165945.2;CLCNKB,downstream_gene_variant,,ENST00000375679,NM_000085.4;CLCNKB,downstream_gene_variant,,ENST00000431772,;FAM131C,intron_variant,,ENST00000494078,; 1:16386305-16386306 ENSG00000185519 ENST00000375662.4 Transcript - - - - - rs542191066 intron_variant MODIFIER -1 HGNC 26717 protein_coding CCDS41270.1 ENSP00000364814 Q96AQ9 UPI000022B016 5/6 0.3678 0.5051 SAS 0/0 2 0.0 11 11,0 0/1 2 0.33299999999999996 6 4,2
ZIC4 84107 GRCh37 3 147121630 147121631 50 PASS Intron DEL TC TC - rs142316820 TC TC c.135+120_135+121del ZIC4,intron_variant,,ENST00000383075,NM_032153.5;ZIC4,intron_variant,,ENST00000425731,NM_001168379.1;ZIC4,intron_variant,,ENST00000462748,;ZIC4,intron_variant,,ENST00000463250,;ZIC4,intron_variant,,ENST00000473123,;ZIC4,intron_variant,,ENST00000484399,;ZIC1,intron_variant,,ENST00000488404,;ZIC4,intron_variant,,ENST00000491672,NM_001243256.1;ZIC4,intron_variant,,ENST00000525172,NM_001168378.1;ZIC4,upstream_gene_variant,,ENST00000484586,;ZIC1,intron_variant,,ENST00000472523,;ZIC4,downstream_gene_variant,,ENST00000464144,; 3:147121630-147121631 ENSG00000174963 ENST00000525172.2 Transcript - - - - - rs142316820 intron_variant MODIFIER -1 HGNC 20393 protein_coding CCDS54652.1 ENSP00000435509 Q8N9L1 C9JZU7,C9JD04,C9J6T3,B3KPI4 UPI0001914D88 1/4 0/0 2 0.0 6 6,0 0/1 2 0.33299999999999996 6 4,2
EIF4G1 1981 GRCh37 3 184043926 184043927 50 PASS Intron DEL AC AC - rs34901174 AC AC c.3243+217_3243+218del EIF4G1,intron_variant,,ENST00000319274,;EIF4G1,intron_variant,,ENST00000342981,NM_182917.4;EIF4G1,intron_variant,,ENST00000346169,NM_198241.2;EIF4G1,intron_variant,,ENST00000350481,NM_198242.2;EIF4G1,intron_variant,,ENST00000352767,NM_001194947.1;EIF4G1,intron_variant,,ENST00000382330,NM_001194946.1;EIF4G1,intron_variant,,ENST00000392537,NM_198244.2;EIF4G1,intron_variant,,ENST00000411531,;EIF4G1,intron_variant,,ENST00000414031,;EIF4G1,intron_variant,,ENST00000424196,;EIF4G1,intron_variant,,ENST00000427845,;EIF4G1,intron_variant,,ENST00000434061,NM_004953.4;EIF4G1,intron_variant,,ENST00000435046,;EIF4G1,intron_variant,,ENST00000441154,;EIF2B5,intron_variant,,ENST00000444495,;EIF4G1,intron_variant,,ENST00000448284,;EIF4G1,downstream_gene_variant,,ENST00000421110,;EIF4G1,downstream_gene_variant,,ENST00000426123,;EIF4G1,downstream_gene_variant,,ENST00000427607,;EIF4G1,downstream_gene_variant,,ENST00000428387,;EIF4G1,downstream_gene_variant,,ENST00000444134,;EIF4G1,downstream_gene_variant,,ENST00000444861,;EIF4G1,downstream_gene_variant,,ENST00000450424,;EIF4G1,downstream_gene_variant,,ENST00000457456,;SNORD66,downstream_gene_variant,,ENST00000390856,NR_003055.1;EIF4G1,intron_variant,,ENST00000442406,;EIF4G1,intron_variant,,ENST00000466311,;EIF4G1,downstream_gene_variant,,ENST00000413967,;EIF4G1,upstream_gene_variant,,ENST00000422614,;EIF4G1,upstream_gene_variant,,ENST00000460829,;EIF4G1,upstream_gene_variant,,ENST00000464548,;EIF4G1,upstream_gene_variant,,ENST00000475721,;EIF4G1,upstream_gene_variant,,ENST00000482303,;EIF4G1,downstream_gene_variant,,ENST00000484862,;EIF4G1,downstream_gene_variant,,ENST00000493299,; 3:184043926-184043927 ENSG00000114867 ENST00000424196.1 Transcript - - - - - rs34901174 intron_variant MODIFIER 1 HGNC 3296 protein_coding CCDS54687.1 ENSP00000416255 Q04637 Q96I65,C9JWW9,C9JWH7,C9JSU8,C9J987,C9J6B6,C9J556 UPI00015E0966 20/31 0/0 2 0.0 7 7,0 0/1 2 0.667 6 2,4
STEAP1B 256227 GRCh37 7 22533452 22533453 50 PASS Frame_Shift_Del DEL CA CA - novel CA CA c.87_88del p.His29GlnfsTer24 p.H29Qfs*24 STEAP1B,frameshift_variant,p.His29GlnfsTer24,ENST00000404369,NM_001164460.1;STEAP1B,frameshift_variant,p.His29GlnfsTer24,ENST00000424363,;STEAP1B,frameshift_variant,p.His29GlnfsTer24,ENST00000439708,;STEAP1B,intron_variant,,ENST00000406890,NM_207342.2;STEAP1B,splice_region_variant,,ENST00000483679,; 7:22533452-22533453 ENSG00000105889 ENST00000404369.4 Transcript 503-504 87-88 29-30 HE/QX caTGag/caag - frameshift_variant,splice_region_variant HIGH -1 HGNC 41907 protein_coding CCDS56469.1 ENSP00000384370 C9JL51,C9JE84,B5MCI2 UPI000173A267 3/5 0/0 2 0.0 22 22,0 0/1 2 0.33299999999999996 6 4,2
TEX12 56158 GRCh37 11 112042480 112042480 50 PASS Intron DEL T T - rs1225064086 T T c.228-9del TEX12,intron_variant,,ENST00000280358,NM_031275.4;TEX12,intron_variant,,ENST00000530752,;AP002884.3,intron_variant,,ENST00000532612,;BCO2,upstream_gene_variant,,ENST00000357685,;BCO2,upstream_gene_variant,,ENST00000361053,NM_001256398.1;BCO2,upstream_gene_variant,,ENST00000393032,NM_031938.5;BCO2,upstream_gene_variant,,ENST00000438022,;BCO2,upstream_gene_variant,,ENST00000526088,NM_001037290.2,NM_001256397.1;BCO2,upstream_gene_variant,,ENST00000531169,;BCO2,upstream_gene_variant,,ENST00000532593,NM_001256400.1;RP11-356J5.4,intron_variant,,ENST00000527589,;SDHD,intron_variant,,ENST00000525468,;SDHD,intron_variant,,ENST00000525987,;SDHD,intron_variant,,ENST00000531744,;SDHD,intron_variant,,ENST00000532699,;BCO2,upstream_gene_variant,,ENST00000460924,;BCO2,upstream_gene_variant,,ENST00000461480,;BCO2,upstream_gene_variant,,ENST00000494860,;BCO2,upstream_gene_variant,,ENST00000527939,;BCO2,upstream_gene_variant,,ENST00000531003,;BCO2,upstream_gene_variant,,ENST00000534122,;BCO2,upstream_gene_variant,,ENST00000534550,; 11:112042480 ENSG00000150783 ENST00000280358.4 Transcript - - - - - rs1225064086 intron_variant MODIFIER 1 HGNC 11734 protein_coding CCDS31679.1 ENSP00000280358 Q9BXU0 UPI00001377E3 4/4 1.711e-05 8.319e-05 gnomAD_AFR 0/0 2 0.0 31 31,0 0/1 2 0.33299999999999996 6 4,2
KMT2D 8085 GRCh37 12 49431403 49431404 50 PASS Frame_Shift_Ins INS - - T novel - - c.9735dup p.Pro3246ThrfsTer5 p.P3246Tfs*5 KMT2D,frameshift_variant,p.Pro3246ThrfsTer5,ENST00000301067,NM_003482.3;KMT2D,upstream_gene_variant,,ENST00000549743,;KMT2D,downstream_gene_variant,,ENST00000549799,; 12:49431403-49431404 ENSG00000167548 ENST00000301067.7 Transcript 9735-9736 9735-9736 3245-3246 -/X -/A - frameshift_variant HIGH -1 HGNC 7133 protein_coding CCDS44873.1 ENSP00000301067 O14686 Q6PIA1,Q59FG6,F8VWW4 UPI0000EE84D6 34/54 0/0 2 0.0 48 48,0 0/1 2 0.212 33 26,7
PDS5B 23047 GRCh37 13 33332314 33332314 50 PASS Frame_Shift_Del DEL A A - novel A A c.3148del p.Thr1050GlnfsTer12 p.T1050Qfs*12 PDS5B,frameshift_variant,p.Thr1050GlnfsTer12,ENST00000315596,NM_015032.3;PDS5B,frameshift_variant,p.Thr4GlnfsTer12,ENST00000447833,;PDS5B,frameshift_variant,p.Thr1050GlnfsTer12,ENST00000450460,; 13:33332314 ENSG00000083642 ENST00000315596.10 Transcript 3332 3146 1049 Q/X cAa/ca - frameshift_variant HIGH 1 HGNC 20418 protein_coding CCDS41878.1 ENSP00000313851 Q9NTI5 UPI000006D4A9 27/35 0/0 2 0.0 47 47,0 0/1 2 0.33299999999999996 6 4,2
CCR7 1236 GRCh37 17 38712161 38712161 50 PASS Intron DEL T T - rs532551852 T T c.61-91del CCR7,intron_variant,,ENST00000246657,NM_001838.3;CCR7,intron_variant,,ENST00000578085,;CCR7,intron_variant,,ENST00000579344,; 17:38712161 ENSG00000126353 ENST00000246657.2 Transcript - - - - - rs532551852 intron_variant MODIFIER -1 HGNC 1608 protein_coding CCDS11369.1 ENSP00000246657 P32248 J3KTN5,J3KSS9,A0N0Q0 UPI0000001C2F 2/2 0.0008 0.004 EAS 0/0 2 0.0 5 5,0 0/1 2 0.33299999999999996 6 4,2
ATP9A 10079 GRCh37 20 50342307 50342308 50 PASS Intron DEL TC TC - novel TC TC c.327+50_327+51del ATP9A,intron_variant,,ENST00000311637,;ATP9A,intron_variant,,ENST00000338821,NM_006045.1;ATP9A,intron_variant,,ENST00000402822,;ATP9A,downstream_gene_variant,,ENST00000477492,;,regulatory_region_variant,,ENSR00001225305,; 20:50342307-50342308 ENSG00000054793 ENST00000338821.5 Transcript - - - - - - intron_variant MODIFIER -1 HGNC 13540 protein_coding CCDS33489.1 ENSP00000342481 O75110 Q2NLD0,B4DR18 UPI000004D334 3/27 0/0 2 0.0 22 22,0 0/1 2 0.4 15 9,6
Hugo_Symbol Entrez_Gene_Id NCBI_Build Chromosome Start_Position End_Position Variant_Quality Filter Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 HGVSc HGVSp HGVSp_Short all_effects Location Gene Feature Feature_type cDNA_position CDS_position Protein_position Amino_acids Codons Existing_variation Consequence IMPACT SIFT PolyPhen STRAND SYMBOL_SOURCE HGNC_ID BIOTYPE CCDS ENSP SWISSPROT TREMBL UNIPARC EXON INTRON AF AA_AF EA_AF gnomAD_AF MAX_AF MAX_AF_POPS n_GT n_SS n_FA n_DP n_AD t_GT t_SS t_FA t_DP t_AD
SLC6A9 6536 GRCh37 1 44476442 44476442 43 PASS Missense_Mutation SNP C C T C C c.362G>A p.Gly121Asp p.G121D SLC6A9,missense_variant,p.Gly48Asp,ENST00000372310,NM_001024845.2;SLC6A9,missense_variant,p.Gly121Asp,ENST00000360584,NM_201649.3;SLC6A9,missense_variant,p.Gly67Asp,ENST00000357730,NM_006934.3,NM_001261380.1;SLC6A9,missense_variant,p.Gly48Asp,ENST00000372306,;SLC6A9,missense_variant,p.Gly102Asp,ENST00000466926,;SLC6A9,missense_variant,p.Gly67Asp,ENST00000528803,;SLC6A9,5_prime_UTR_variant,,ENST00000372307,;SLC6A9,intron_variant,,ENST00000475075,;SLC6A9,intron_variant,,ENST00000537678,;SLC6A9,intron_variant,,ENST00000492434,;SLC6A9,downstream_gene_variant,,ENST00000533007,;SLC6A9,non_coding_transcript_exon_variant,,ENST00000489764,; 1:44476442 ENSG00000196517 ENST00000360584.2 Transcript 554 362 121 G/D gGc/gAc COSM3805364,COSM3805365 missense_variant MODERATE deleterious(0) probably_damaging(1) -1 HGNC 11056 protein_coding CCDS41317.1 ENSP00000353791 P48067 B7Z589 UPI000053030B 3/14 0/0 2 0.0 69 69,0 0/1 2 0.276 58 42,16
ADSS 159 GRCh37 1 244583577 244583577 6 PASS Missense_Mutation SNP G G T novel G G c.685C>A p.Pro229Thr p.P229T ADSS,missense_variant,p.Pro229Thr,ENST00000366535,NM_001126.3;ADSS,non_coding_transcript_exon_variant,,ENST00000462358,;ADSS,upstream_gene_variant,,ENST00000468215,; 1:244583577 ENSG00000035687 ENST00000366535.3 Transcript 1002 685 229 P/T Cca/Aca - missense_variant MODERATE deleterious(0.02) probably_damaging(0.983) -1 HGNC 292 protein_coding CCDS1624.1 ENSP00000355493 P30520 UPI0000132AF5 8/13 0/0 2 0.0 77 77,0 0/1 2 0.083 36 33,3
DTNB 1838 GRCh37 2 25678299 25678299 24 PASS Missense_Mutation SNP C C T rs1230449080 C C c.1144G>A p.Val382Met p.V382M DTNB,missense_variant,p.Val382Met,ENST00000406818,NM_001256303.1,NM_021907.4;DTNB,missense_variant,p.Val382Met,ENST00000407661,NM_183360.2,NM_001256304.1;DTNB,missense_variant,p.Val382Met,ENST00000404103,NM_033147.3;DTNB,missense_variant,p.Val382Met,ENST00000288642,;DTNB,missense_variant,p.Val325Met,ENST00000496972,NM_001256308.1;DTNB,missense_variant,p.Val178Met,ENST00000545439,;DTNB,intron_variant,,ENST00000405222,NM_183361.2;DTNB,intron_variant,,ENST00000407038,NM_033148.3;DTNB,intron_variant,,ENST00000407186,;DTNB,intron_variant,,ENST00000481841,;DTNB,intron_variant,,ENST00000486555,;DTNB,intron_variant,,ENST00000489756,;DTNB,3_prime_UTR_variant,,ENST00000398951,;DTNB,non_coding_transcript_exon_variant,,ENST00000485845,;DTNB,non_coding_transcript_exon_variant,,ENST00000479898,;DTNB,intron_variant,,ENST00000356599,;DTNB,intron_variant,,ENST00000482145,; 2:25678299 ENSG00000138101 ENST00000406818.3 Transcript 1394 1144 382 V/M Gtg/Atg rs1230449080,COSM3839175,COSM3839176 missense_variant MODERATE deleterious(0.03) benign(0.379) -1 HGNC 3058 protein_coding CCDS46237.1 ENSP00000384084 O60941 Q53TC8,Q53T51,Q53SF9,Q53QV1,F8W9U0,E9PE76,E7ES64 UPI0000129949 11/21 0/0 2 0.0 33 33,0 0/1 2 0.47100000000000003 17 9,8
CADM2 253559 GRCh37 3 85932472 85932472 56 PASS Silent SNP C C T rs747906551 C C c.249C>T p.Arg83= p.R83= CADM2,synonymous_variant,p.Arg90=,ENST00000383699,NM_001167675.1,NM_001256504.1,NM_001256505.1;CADM2,synonymous_variant,p.Arg81=,ENST00000407528,NM_001167674.1;CADM2,synonymous_variant,p.Arg83=,ENST00000405615,NM_153184.3; 3:85932472 ENSG00000175161 ENST00000405615.2 Transcript 249 249 83 R cgC/cgT rs747906551,COSM1178952,COSM1178953 synonymous_variant LOW 1 HGNC 29849 protein_coding CCDS33792.1 ENSP00000384193 Q8N3J6 G3XHN8 UPI000013F077 3/10 1.595e-05 0.000298 gnomAD_ASJ 0/0 2 0.0 50 50,0 0/1 2 0.514 37 18,19
BLOC1S5-TXNDC5 0 GRCh37 6 7986778 7986778 27 PASS Intron SNP G G A rs1418108697 G G c.372+39822C>T TXNDC5,intron_variant,,ENST00000539054,;BLOC1S5-TXNDC5,intron_variant,,ENST00000439343,;PIP5K1P1,non_coding_transcript_exon_variant,,ENST00000460661,;PIP5K1P1,non_coding_transcript_exon_variant,,ENST00000438779,; 6:7986778 ENSG00000219294 ENST00000460661.1 Transcript 9 - - - - rs1418108697 non_coding_transcript_exon_variant MODIFIER 1 HGNC 28372 processed_pseudogene 1/1 4.655e-06 3.517e-05 gnomAD_SAS 0/0 2 0.0 23 23,0 0/1 2 0.435 23 13,10
POR 5447 GRCh37 7 75609837 75609837 13 PASS Intron SNP C C G rs373201804 C C c.516+31C>G POR,missense_variant,p.Arg156Gly,ENST00000447222,;POR,missense_variant,p.Arg4Gly,ENST00000450476,;POR,intron_variant,,ENST00000394893,;POR,intron_variant,,ENST00000419840,;POR,intron_variant,,ENST00000439963,;POR,intron_variant,,ENST00000461988,NM_000941.2;POR,intron_variant,,ENST00000545601,;POR,downstream_gene_variant,,ENST00000412521,;POR,downstream_gene_variant,,ENST00000414186,;POR,downstream_gene_variant,,ENST00000426184,;POR,downstream_gene_variant,,ENST00000432753,;POR,upstream_gene_variant,,ENST00000439269,;POR,downstream_gene_variant,,ENST00000439297,;POR,downstream_gene_variant,,ENST00000453773,;POR,downstream_gene_variant,,ENST00000475509,;POR,3_prime_UTR_variant,,ENST00000448410,;POR,intron_variant,,ENST00000412064,;POR,intron_variant,,ENST00000454934,;POR,upstream_gene_variant,,ENST00000460892,;POR,downstream_gene_variant,,ENST00000471238,;POR,upstream_gene_variant,,ENST00000487247,;POR,upstream_gene_variant,,ENST00000495770,;POR,upstream_gene_variant,,ENST00000496888,; 7:75609837 ENSG00000127948 ENST00000461988.1 Transcript - - - - - rs373201804 intron_variant MODIFIER 1 HGNC 9208 protein_coding CCDS5579.1 ENSP00000419970 P16435 Q59ED7,E7EMD0,C9JQ78 UPI000013D5F4 5/15 0/0 2 0.0 8 8,0 0/1 2 0.455 11 6,5
ZNF777 27153 GRCh37 7 149129243 149129243 16 PASS Missense_Mutation SNP G G A G G c.2120C>T p.Ser707Leu p.S707L ZNF777,missense_variant,p.Ser707Leu,ENST00000247930,NM_015694.2;,regulatory_region_variant,,ENSR00001414650,; 7:149129243 ENSG00000196453 ENST00000247930.4 Transcript 2444 2120 707 S/L tCg/tTg COSM3832243 missense_variant MODERATE tolerated(0.13) probably_damaging(0.986) -1 HGNC 22213 protein_coding CCDS43675.1 ENSP00000247930 Q9ULD5 Q3KR11 UPI0000E9B152 6/6 0/0 2 0.0 18 18,0 0/1 2 0.222 27 21,6
AGAP3 116988 GRCh37 7 150840441 150840441 26 PASS Missense_Mutation SNP C C T rs372948404 C C c.2287C>T p.Arg763Cys p.R763C AGAP3,missense_variant,p.Arg763Cys,ENST00000397238,NM_031946.5;AGAP3,missense_variant,p.Arg432Cys,ENST00000463381,NM_001281300.1;AGAP3,missense_variant,p.Arg256Cys,ENST00000461065,;AGAP3,non_coding_transcript_exon_variant,,ENST00000473633,;,regulatory_region_variant,,ENSR00001415095,; 7:150840441 ENSG00000133612 ENST00000397238.2 Transcript 2287 2287 763 R/C Cgc/Tgc rs372948404,COSM238722 missense_variant MODERATE deleterious(0.01) possibly_damaging(0.799) 1 HGNC 16923 protein_coding CCDS43681.1 ENSP00000380413 Q96P47 Q96T14,D3DX07 UPI0000DAC777 17/18 0.0002372 0.0001179 6.472e-05 0.0002372 AA 0/0 2 0.0 28 28,0 0/1 2 0.375 24 15,9
ABLIM1 3983 GRCh37 10 116247760 116247760 26 PASS Missense_Mutation SNP T T C T T c.998A>G p.His333Arg p.H333R ABLIM1,missense_variant,p.His273Arg,ENST00000369252,NM_001003408.1,NM_001003407.1;ABLIM1,missense_variant,p.His273Arg,ENST00000533213,;ABLIM1,missense_variant,p.His17Arg,ENST00000392952,NM_006720.3;ABLIM1,missense_variant,p.His17Arg,ENST00000369266,;ABLIM1,missense_variant,p.His333Arg,ENST00000277895,NM_002313.5;ABLIM1,missense_variant,p.His17Arg,ENST00000369253,;ABLIM1,missense_variant,p.His17Arg,ENST00000428430,;ABLIM1,upstream_gene_variant,,ENST00000440467,;ABLIM1,missense_variant,p.His273Arg,ENST00000392955,;ABLIM1,missense_variant,p.His273Arg,ENST00000369256,;,regulatory_region_variant,,ENSR00000990007,; 10:116247760 ENSG00000099204 ENST00000277895.5 Transcript 1096 998 333 H/R cAt/cGt COSM1474373,COSM1474374,COSM1474375,COSM4815293 missense_variant MODERATE deleterious(0) possibly_damaging(0.887) -1 HGNC 78 protein_coding CCDS7590.1 ENSP00000277895 O14639 UPI0000418D06 8/23 0/0 2 0.0 72 72,0 0/1 2 0.244 45 34,11
ADAMTS20 80070 GRCh37 12 43944926 43944926 44 PASS Missense_Mutation SNP T T C T T c.239A>G p.Tyr80Cys p.Y80C ADAMTS20,missense_variant,p.Tyr80Cys,ENST00000389420,NM_025003.3;ADAMTS20,missense_variant,p.Tyr80Cys,ENST00000553158,;,regulatory_region_variant,,ENSR00001029344,; 12:43944926 ENSG00000173157 ENST00000389420.3 Transcript 239 239 80 Y/C tAt/tGt COSM1476551,COSM1476552,COSM4815292 missense_variant MODERATE deleterious(0) probably_damaging(0.986) -1 HGNC 17178 protein_coding CCDS31778.2 ENSP00000374071 P59510 UPI00004565F4 2/39 0/0 2 0.0 50 50,0 0/1 2 0.469 32 17,15
RNY4P30 0 GRCh37 13 50464902 50464902 8 PASS 5'Flank SNP T T C novel T T RNY4P30,upstream_gene_variant,,ENST00000410216,;CTAGE10P,non_coding_transcript_exon_variant,,ENST00000318353,; 13:50464902 ENSG00000181358 ENST00000318353.2 Transcript 176 - - - - - non_coding_transcript_exon_variant MODIFIER 1 HGNC 37288 processed_pseudogene 1/1 0/0 2 0.0 75 75,0 0/1 2 0.077 65 60,5
SPTB 6710 GRCh37 14 65266493 65266493 20 PASS Missense_Mutation SNP T T C T T c.1036A>G p.Thr346Ala p.T346A SPTB,missense_variant,p.Thr346Ala,ENST00000389722,NM_001024858.2;SPTB,missense_variant,p.Thr346Ala,ENST00000556626,;SPTB,missense_variant,p.Thr346Ala,ENST00000542895,;SPTB,missense_variant,p.Thr346Ala,ENST00000389721,NM_000347.5;SPTB,missense_variant,p.Thr346Ala,ENST00000389720,;,regulatory_region_variant,,ENSR00000274939,; 14:65266493 ENSG00000070182 ENST00000389722.3 Transcript 1090 1036 346 T/A Acc/Gcc COSM1477699,COSM1477700 missense_variant MODERATE tolerated(0.28) benign(0.074) -1 HGNC 11274 protein_coding CCDS32099.1 ENSP00000374372 P11277 Q71VG2,Q71VG1,Q71VG0,Q71VF9,Q71VF8,Q59FP5,O14726,O14725 UPI000053030D 8/35 0/0 2 0.0 21 21,0 0/1 2 0.4 20 12,8
IQGAP1 8826 GRCh37 15 91043489 91043489 9 PASS 3'UTR SNP C C T rs922590103 C C c.*149C>T IQGAP1,3_prime_UTR_variant,,ENST00000268182,NM_003870.3;IQGAP1,3_prime_UTR_variant,,ENST00000560738,;IQGAP1,non_coding_transcript_exon_variant,,ENST00000561086,;IQGAP1,non_coding_transcript_exon_variant,,ENST00000558957,; 15:91043489 ENSG00000140575 ENST00000268182.5 Transcript 5247 - - - - rs922590103 3_prime_UTR_variant MODIFIER 1 HGNC 6110 protein_coding CCDS10362.1 ENSP00000268182 P46940 H0YKA5 UPI000012D863 38/38 0/0 2 0.0 18 18,0 0/1 2 0.5 6 3,3
PIEZO1 9780 GRCh37 16 88790292 88790292 20 PASS Missense_Mutation SNP T T C T T c.4322A>G p.Gln1441Arg p.Q1441R PIEZO1,missense_variant,p.Gln1441Arg,ENST00000301015,NM_001142864.2;PIEZO1,missense_variant,p.Gln115Arg,ENST00000474606,;PIEZO1,upstream_gene_variant,,ENST00000327397,;PIEZO1,upstream_gene_variant,,ENST00000466823,;RP5-1142A6.9,downstream_gene_variant,,ENST00000564984,;PIEZO1,non_coding_transcript_exon_variant,,ENST00000566414,;PIEZO1,upstream_gene_variant,,ENST00000419505,;PIEZO1,downstream_gene_variant,,ENST00000475586,;PIEZO1,downstream_gene_variant,,ENST00000491917,;PIEZO1,upstream_gene_variant,,ENST00000495568,;PIEZO1,upstream_gene_variant,,ENST00000497793,; 16:88790292 ENSG00000103335 ENST00000301015.9 Transcript 4569 4322 1441 Q/R cAg/cGg COSM1479166 missense_variant MODERATE tolerated(0.25) possibly_damaging(0.78) -1 HGNC 28993 protein_coding CCDS54058.1 ENSP00000301015 Q92508 UPI0001B300F3 31/51 0/0 2 0.0 34 34,0 0/1 2 0.28 25 18,7
KAT2A 2648 GRCh37 17 40272381 40272381 99 PASS Silent SNP G G A rs536716483 G G c.471C>T p.His157= p.H157= KAT2A,synonymous_variant,p.His157=,ENST00000225916,NM_021078.2;CTD-2132N18.3,synonymous_variant,p.His191=,ENST00000592574,;RAB5C,downstream_gene_variant,,ENST00000346213,NM_004583.3;HSPB9,upstream_gene_variant,,ENST00000355067,NM_033194.2;RAB5C,downstream_gene_variant,,ENST00000393860,NM_201434.2;CTD-2132N18.3,missense_variant,p.Thr150Met,ENST00000592248,;KAT2A,synonymous_variant,p.His75=,ENST00000465682,;CTD-2132N18.3,3_prime_UTR_variant,,ENST00000585562,;KAT2A,upstream_gene_variant,,ENST00000588759,;KAT2A,upstream_gene_variant,,ENST00000592310,;,regulatory_region_variant,,ENSR00000094340,; 17:40272381 ENSG00000108773 ENST00000225916.5 Transcript 525 471 157 H caC/caT rs536716483,COSM1479581 synonymous_variant LOW -1 HGNC 4201 protein_coding CCDS11417.1 ENSP00000225916 Q92830 K7ERS6 UPI000000D978 3/18 0.0002 2.386e-05 0.001 EAS 0/0 2 0.0 35 35,0 0/1 2 0.525 61 29,32
ZNF574 64763 GRCh37 19 42585066 42585066 17 PASS Missense_Mutation SNP G G A G G c.2308G>A p.Asp770Asn p.D770N ZNF574,missense_variant,p.Asp770Asn,ENST00000600245,;ZNF574,missense_variant,p.Asp860Asn,ENST00000222339,;ZNF574,missense_variant,p.Asp770Asn,ENST00000359044,NM_022752.5;ZNF574,downstream_gene_variant,,ENST00000597391,;CTB-59C6.3,upstream_gene_variant,,ENST00000594531,; 19:42585066 ENSG00000105732 ENST00000600245.1 Transcript 2963 2308 770 D/N Gac/Aac COSM1481127,COSM4410014,COSM4410015,COSM4881823,COSM4881824,COSM5192241 missense_variant MODERATE deleterious(0.01) probably_damaging(0.917) 1 HGNC 26166 protein_coding CCDS12596.1 ENSP00000469029 Q6ZN55 Q9NT61,M0R133 UPI00001AE536 2/2 0/0 2 0.0 19 19,0 0/1 2 0.28 25 18,7
OTOR 56914 GRCh37 20 16730581 16730581 21 PASS Missense_Mutation SNP G G A rs776130394 G G c.289G>A p.Val97Met p.V97M OTOR,missense_variant,p.Val97Met,ENST00000246081,NM_020157.3;OTOR,non_coding_transcript_exon_variant,,ENST00000486129,;OTOR,intron_variant,,ENST00000490148,;,regulatory_region_variant,,ENSR00000297515,; 20:16730581 ENSG00000125879 ENST00000246081.2 Transcript 333 289 97 V/M Gtg/Atg rs776130394,COSM1410526 missense_variant MODERATE deleterious(0) probably_damaging(0.961) 1 HGNC 8517 protein_coding CCDS13124.1 ENSP00000246081 Q9NRC9 UPI0000047809 3/4 1.593e-05 0.000109 gnomAD_EAS 0/0 2 0.0 52 52,0 0/1 2 0.18600000000000003 43 35,8
IGLV2-23 0 GRCh37 22 23040479 23040479 41 PASS Missense_Mutation SNP C C G novel C C c.44C>G p.Thr15Arg p.T15R IGLV2-23,missense_variant,p.Thr15Arg,ENST00000390306,;D86994.1,non_coding_transcript_exon_variant,,ENST00000385095,;LL22NC03-102D1.18,upstream_gene_variant,,ENST00000438185,;,regulatory_region_variant,,ENSR00001237978,;,regulatory_region_variant,,ENSR00001237979,;IGLV3-24,downstream_gene_variant,,ENST00000517477,;IGLVVI-22-1,upstream_gene_variant,,ENST00000521183,;,TF_binding_site_variant,,ENSM00525174790,;,TF_binding_site_variant,,ENSM00528768476,; 22:23040479 ENSG00000211660 ENST00000390306.2 Transcript 206 44 15 T/R aCa/aGa - missense_variant,splice_region_variant MODERATE deleterious_low_confidence(0) possibly_damaging(0.852) 1 HGNC 5890 IG_V_gene ENSP00000374841 UPI000173A2CA 1/2 0/0 2 0.0 23 23,0 0/1 2 0.52 25 12,13
NUDT10 170685 GRCh37 X 51076024 51076024 6 PASS Silent SNP G G A rs2801626 G G c.207G>A p.Glu69= p.E69= NUDT10,synonymous_variant,p.Glu69=,ENST00000376006,NM_153183.2;NUDT10,synonymous_variant,p.Glu69=,ENST00000356450,;,regulatory_region_variant,,ENSR00000423420,;,regulatory_region_variant,,ENSR00001478162,; X:51076024 ENSG00000122824 ENST00000376006.3 Transcript 427 207 69 E gaG/gaA COSM378841 synonymous_variant LOW 1 HGNC 17621 protein_coding CCDS35278.1 ENSP00000365174 Q8NFP7 UPI000006D69E 2/3 0/0 2 0.013000000000000001 78 77,1 0/1 2 0.068 44 41,3
COX7B 1349 GRCh37 X 77160816 77160816 7 PASS 3'UTR SNP A A G rs782235659 A A c.*58A>G COX7B,3_prime_UTR_variant,,ENST00000481445,NM_001866.2;COX7B,downstream_gene_variant,,ENST00000373335,;COX7B,downstream_gene_variant,,ENST00000475465,; X:77160816 ENSG00000131174 ENST00000481445.1 Transcript 417 - - - - - 3_prime_UTR_variant MODIFIER 1 HGNC 2291 protein_coding CCDS14437.1 ENSP00000417656 P24311 UPI0000049C75 3/3 0/0 2 0.0 51 51,0 0/1 2 0.13 23 20,3
COX7B 1349 GRCh37 X 77160852 77160852 7 PASS 3'UTR SNP T T A novel T T c.*94T>A COX7B,3_prime_UTR_variant,,ENST00000481445,NM_001866.2;COX7B,downstream_gene_variant,,ENST00000373335,;COX7B,downstream_gene_variant,,ENST00000475465,; X:77160852 ENSG00000131174 ENST00000481445.1 Transcript 453 - - - - - 3_prime_UTR_variant MODIFIER 1 HGNC 2291 protein_coding CCDS14437.1 ENSP00000417656 P24311 UPI0000049C75 3/3 0/0 2 0.0 35 35,0 0/1 2 0.17600000000000002 17 14,3
P2RY10 27334 GRCh37 X 78216689 78216689 26 PASS Silent SNP C C T rs866278031 C C c.672C>T p.Ser224= p.S224= P2RY10,synonymous_variant,p.Ser224=,ENST00000171757,NM_014499.2;P2RY10,synonymous_variant,p.Ser224=,ENST00000544091,NM_198333.1;P2RY10,downstream_gene_variant,,ENST00000461541,;P2RY10,downstream_gene_variant,,ENST00000475374,; X:78216689 ENSG00000078589 ENST00000171757.2 Transcript 952 672 224 S tcC/tcT rs866278031,COSM1491292,COSM3563627 synonymous_variant LOW 1 HGNC 19906 protein_coding CCDS14442.1 ENSP00000171757 O00398 UPI0000050471 4/4 0/0 2 0.0 63 63,0 0/1 2 0.185 54 44,10
THOC2 57187 GRCh37 X 122757148 122757148 6 PASS Intron SNP A A T novel A A c.3504-14T>A THOC2,intron_variant,,ENST00000245838,NM_001081550.1;THOC2,intron_variant,,ENST00000355725,;THOC2,intron_variant,,ENST00000438358,;THOC2,intron_variant,,ENST00000491737,;THOC2,upstream_gene_variant,,ENST00000416618,;THOC2,upstream_gene_variant,,ENST00000441692,;THOC2,upstream_gene_variant,,ENST00000448128,;THOC2,upstream_gene_variant,,ENST00000497887,;THOC2,non_coding_transcript_exon_variant,,ENST00000459945,;THOC2,upstream_gene_variant,,ENST00000432353,;THOC2,downstream_gene_variant,,ENST00000464161,;THOC2,upstream_gene_variant,,ENST00000464604,;THOC2,upstream_gene_variant,,ENST00000464982,;THOC2,upstream_gene_variant,,ENST00000464992,;THOC2,upstream_gene_variant,,ENST00000496830,; X:122757148 ENSG00000125676 ENST00000245838.8 Transcript - - - - - - intron_variant MODIFIER -1 HGNC 19073 protein_coding CCDS43988.1 ENSP00000245838 Q8NI27 UPI00001D7C42 28/38 0/0 2 0.0 48 48,0 0/1 2 0.231 13 10,3
ZFP92 139735 GRCh37 X 152684244 152684244 6 PASS Missense_Mutation SNP T T G novel T T c.147T>G p.His49Gln p.H49Q ZFP92,missense_variant,p.His49Gln,ENST00000338647,NM_001136273.1;U82695.10,upstream_gene_variant,,ENST00000569962,; X:152684244 ENSG00000189420 ENST00000338647.5 Transcript 148 147 49 H/Q caT/caG - missense_variant MODERATE deleterious(0.03) probably_damaging(0.913) 1 HGNC 12865 protein_coding CCDS59177.1 ENSP00000462054 A6NM28 UPI000052B478 2/4 0/0 2 0.0 62 62,0 0/1 2 0.059000000000000004 51 48,3
Chromosome Position dbSNP_RS Tumor_Seq_Allele1 Tumor_Seq_Allele2 Variant_Quality Filter Hugo_Symbol Variant_Classification Variant_Type Transcript_ID n_GT n_SS n_FA n_DP n_AD t_GT t_SS t_FA t_DP t_AD
1 16386305 rs143272992 G GC 50 PASS FAM131C Intron INS ENST00000375662.4 0/0 2 0.000 11 11,0 0/1 2 0.333 6 4,2
3 147121629 ATC A 50 PASS ZIC4 Intron DEL ENST00000491672.1 0/0 2 0.000 6 6,0 0/1 2 0.333 6 4,2
3 184043925 rs112208190 AAC A 50 PASS EIF4G1 Intron DEL ENST00000392537.2 0/0 2 0.000 7 7,0 0/1 2 0.667 6 2,4
7 22533451 rs116873396 TCA T 50 PASS STEAP1B Frame_Shift_Del DEL ENST00000404369.4 0/0 2 0.000 22 22,0 0/1 2 0.333 6 4,2
11 112042479 CT C 50 PASS TEX12 Intron DEL ENST00000280358.4 0/0 2 0.000 31 31,0 0/1 2 0.333 6 4,2
12 49431403 G GT 50 PASS KMT2D Frame_Shift_Ins INS ENST00000301067.7 0/0 2 0.000 48 48,0 0/1 2 0.212 33 26,7
13 33332313 CA C 50 PASS PDS5B Frame_Shift_Del DEL ENST00000315596.10 0/0 2 0.000 47 47,0 0/1 2 0.333 6 4,2
17 38712160 CT C 50 PASS CCR7 Intron DEL ENST00000246657.2 0/0 2 0.000 5 5,0 0/1 2 0.333 6 4,2
20 50342306 TTC T 50 PASS ATP9A Intron DEL ENST00000338821.5 0/0 2 0.000 22 22,0 0/1 2 0.400 15 9,6
Chromosome Position dbSNP_RS Tumor_Seq_Allele1 Tumor_Seq_Allele2 Variant_Quality Filter Hugo_Symbol Variant_Classification Variant_Type Transcript_ID n_GT n_SS n_FA n_DP n_AD t_GT t_SS t_FA t_DP t_AD
1 44476442 C T 43 PASS SLC6A9 5'UTR SNP ENST00000372307.3 0/0 2 0.000 69 69,0 0/1 2 0.276 58 42,16
1 244583577 G T 6 PASS ADSS Missense_Mutation SNP ENST00000366535.3 0/0 2 0.000 77 77,0 0/1 2 0.083 36 33,3
2 25678299 C T 24 PASS DTNB Missense_Mutation SNP ENST00000406818.3 0/0 2 0.000 33 33,0 0/1 2 0.471 17 9,8
3 85932472 C T 56 PASS CADM2 Silent SNP ENST00000383699.3 0/0 2 0.000 50 50,0 0/1 2 0.514 37 18,19
6 7986778 G A 27 PASS BLOC1S5-TXNDC5 Intron SNP ENST00000539054.1 0/0 2 0.000 23 23,0 0/1 2 0.435 23 13,10
7 75609837 C G 13 PASS POR Intron SNP ENST00000394893.1 0/0 2 0.000 8 8,0 0/1 2 0.455 11 6,5
7 149129243 G A 16 PASS ZNF777 Missense_Mutation SNP ENST00000247930.4 0/0 2 0.000 18 18,0 0/1 2 0.222 27 21,6
7 150840441 C T 26 PASS AGAP3 Missense_Mutation SNP ENST00000463381.1 0/0 2 0.000 28 28,0 0/1 2 0.375 24 15,9
10 116247760 T C 26 PASS ABLIM1 Missense_Mutation SNP ENST00000392952.3 0/0 2 0.000 72 72,0 0/1 2 0.244 45 34,11
12 43944926 T C 44 PASS ADAMTS20 Missense_Mutation SNP ENST00000389420.3 0/0 2 0.000 50 50,0 0/1 2 0.469 32 17,15
13 50464902 T C 8 PASS IGR SNP 0/0 2 0.000 75 75,0 0/1 2 0.077 65 60,5
14 65266493 T C 20 PASS SPTB Missense_Mutation SNP ENST00000556626.1 0/0 2 0.000 21 21,0 0/1 2 0.400 20 12,8
15 91043489 C T 9 PASS IQGAP1 3'UTR SNP ENST00000268182.5 0/0 2 0.000 18 18,0 0/1 2 0.500 6 3,3
16 88790292 T C 20 PASS PIEZO1 Missense_Mutation SNP ENST00000301015.9 0/0 2 0.000 34 34,0 0/1 2 0.280 25 18,7
17 40272381 G A 99 PASS KAT2A Silent SNP ENST00000225916.5 0/0 2 0.000 35 35,0 0/1 2 0.525 61 29,32
19 42585066 G A 17 PASS ZNF574 Missense_Mutation SNP ENST00000600245.1 0/0 2 0.000 19 19,0 0/1 2 0.280 25 18,7
20 16730581 G A 21 PASS OTOR Missense_Mutation SNP ENST00000246081.2 0/0 2 0.000 52 52,0 0/1 2 0.186 43 35,8
22 23040479 C G 41 PASS IGLV2-23 RNA SNP ENST00000390306.2 0/0 2 0.000 23 23,0 0/1 2 0.520 25 12,13
X 51076024 rs143435240 G A 6 PASS NUDT10 Silent SNP ENST00000376006.3 0/0 2 0.013 78 77,1 0/1 2 0.068 44 41,3
X 77160816 A G 7 PASS COX7B 3'UTR SNP ENST00000481445.1 0/0 2 0.000 51 51,0 0/1 2 0.130 23 20,3
X 77160852 T A 7 PASS COX7B 3'UTR SNP ENST00000481445.1 0/0 2 0.000 35 35,0 0/1 2 0.176 17 14,3
X 78216689 C T 26 PASS P2RY10 Silent SNP ENST00000171757.2 0/0 2 0.000 63 63,0 0/1 2 0.185 54 44,10
X 122757148 A T 6 PASS THOC2 Intron SNP ENST00000245838.8 0/0 2 0.000 48 48,0 0/1 2 0.231 13 10,3
X 152684244 T G 6 PASS ZFP92 Missense_Mutation SNP ENST00000338647.5 0/0 2 0.000 62 62,0 0/1 2 0.059 51 48,3
#version 2.4
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer Tumor_Sample_UUID Matched_Norm_Sample_UUID HGVSc HGVSp HGVSp_Short Transcript_ID Exon_Number t_depth t_ref_count t_alt_count n_depth n_ref_count n_alt_count all_effects Allele Gene Feature Feature_type Consequence cDNA_position CDS_position Protein_position Amino_acids Codons Existing_variation ALLELE_NUM DISTANCE STRAND_VEP SYMBOL SYMBOL_SOURCE HGNC_ID BIOTYPE CANONICAL CCDS ENSP SWISSPROT TREMBL UNIPARC RefSeq SIFT PolyPhen EXON INTRON DOMAINS AF AFR_AF AMR_AF ASN_AF EAS_AF EUR_AF SAS_AF AA_AF EA_AF CLIN_SIG SOMATIC PUBMED MOTIF_NAME MOTIF_POS HIGH_INF_POS MOTIF_SCORE_CHANGE IMPACT PICK VARIANT_CLASS TSL HGVS_OFFSET PHENO MINIMISED ExAC_AF ExAC_AF_AFR ExAC_AF_AMR ExAC_AF_EAS ExAC_AF_FIN ExAC_AF_NFE ExAC_AF_OTH ExAC_AF_SAS GENE_PHENO FILTER flanking_bps vcf_id vcf_qual ExAC_AF_Adj ExAC_AC_AN_Adj ExAC_AC_AN ExAC_AC_AN_AFR ExAC_AC_AN_AMR ExAC_AC_AN_EAS ExAC_AC_AN_FIN ExAC_AC_AN_NFE ExAC_AC_AN_OTH ExAC_AC_AN_SAS ExAC_FILTER gnomAD_AF gnomAD_AFR_AF gnomAD_AMR_AF gnomAD_ASJ_AF gnomAD_EAS_AF gnomAD_FIN_AF gnomAD_NFE_AF gnomAD_OTH_AF gnomAD_SAS_AF vcf_pos
FAM131C 348487 . GRCh37 1 16386305 16386306 + Intron INS - - C rs542191066 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 - - c.451+58dup ENST00000375662 FAM131C,intron_variant,,ENST00000375662,NM_182623.2;CLCNKB,downstream_gene_variant,,ENST00000375667,NM_001165945.2;CLCNKB,downstream_gene_variant,,ENST00000375679,NM_000085.4;CLCNKB,downstream_gene_variant,,ENST00000431772,;FAM131C,intron_variant,,ENST00000494078,; C ENSG00000185519 ENST00000375662 Transcript intron_variant rs542191066 1 -1 FAM131C HGNC 26717 protein_coding YES CCDS41270.1 ENSP00000364814 Q96AQ9 UPI000022B016 NM_182623.2 5/6 0.3678 0.2731 0.3573 0.3581 0.3757 0.5051 MODIFIER 1 insertion PASS GGC rs143272992 50 16386305
ZIC4 84107 . GRCh37 3 147121630 147121631 + Intron DEL TC TC - rs142316820 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 TC TC c.135+120_135+121del ENST00000525172 ZIC4,intron_variant,,ENST00000383075,NM_032153.5;ZIC4,intron_variant,,ENST00000425731,NM_001168379.1;ZIC4,intron_variant,,ENST00000462748,;ZIC4,intron_variant,,ENST00000463250,;ZIC4,intron_variant,,ENST00000473123,;ZIC4,intron_variant,,ENST00000484399,;ZIC1,intron_variant,,ENST00000488404,;ZIC4,intron_variant,,ENST00000491672,NM_001243256.1;ZIC4,intron_variant,,ENST00000525172,NM_001168378.1;ZIC4,upstream_gene_variant,,ENST00000484586,;ZIC1,intron_variant,,ENST00000472523,;ZIC4,downstream_gene_variant,,ENST00000464144,; - ENSG00000174963 ENST00000525172 Transcript intron_variant rs142316820 1 -1 ZIC4 HGNC 20393 protein_coding YES CCDS54652.1 ENSP00000435509 Q8N9L1 C9JZU7,C9JD04,C9J6T3,B3KPI4 UPI0001914D88 NM_001168378.1 1/4 MODIFIER 1 deletion 1 PASS GATCT . 50 147121629
EIF4G1 1981 . GRCh37 3 184043926 184043927 + Intron DEL AC AC - rs34901174 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 AC AC c.3243+217_3243+218del ENST00000424196 EIF4G1,intron_variant,,ENST00000319274,;EIF4G1,intron_variant,,ENST00000342981,NM_182917.4;EIF4G1,intron_variant,,ENST00000346169,NM_198241.2;EIF4G1,intron_variant,,ENST00000350481,NM_198242.2;EIF4G1,intron_variant,,ENST00000352767,NM_001194947.1;EIF4G1,intron_variant,,ENST00000382330,NM_001194946.1;EIF4G1,intron_variant,,ENST00000392537,NM_198244.2;EIF4G1,intron_variant,,ENST00000411531,;EIF4G1,intron_variant,,ENST00000414031,;EIF4G1,intron_variant,,ENST00000424196,;EIF4G1,intron_variant,,ENST00000427845,;EIF4G1,intron_variant,,ENST00000434061,NM_004953.4;EIF4G1,intron_variant,,ENST00000435046,;EIF4G1,intron_variant,,ENST00000441154,;EIF2B5,intron_variant,,ENST00000444495,;EIF4G1,intron_variant,,ENST00000448284,;EIF4G1,downstream_gene_variant,,ENST00000421110,;EIF4G1,downstream_gene_variant,,ENST00000426123,;EIF4G1,downstream_gene_variant,,ENST00000427607,;EIF4G1,downstream_gene_variant,,ENST00000428387,;EIF4G1,downstream_gene_variant,,ENST00000444134,;EIF4G1,downstream_gene_variant,,ENST00000444861,;EIF4G1,downstream_gene_variant,,ENST00000450424,;EIF4G1,downstream_gene_variant,,ENST00000457456,;SNORD66,downstream_gene_variant,,ENST00000390856,NR_003055.1;EIF4G1,intron_variant,,ENST00000442406,;EIF4G1,intron_variant,,ENST00000466311,;EIF4G1,downstream_gene_variant,,ENST00000413967,;EIF4G1,upstream_gene_variant,,ENST00000422614,;EIF4G1,upstream_gene_variant,,ENST00000460829,;EIF4G1,upstream_gene_variant,,ENST00000464548,;EIF4G1,upstream_gene_variant,,ENST00000475721,;EIF4G1,upstream_gene_variant,,ENST00000482303,;EIF4G1,downstream_gene_variant,,ENST00000484862,;EIF4G1,downstream_gene_variant,,ENST00000493299,; - ENSG00000114867 ENST00000424196 Transcript intron_variant rs34901174 1 1 EIF4G1 HGNC 3296 protein_coding YES CCDS54687.1 ENSP00000416255 Q04637 Q96I65,C9JWW9,C9JWH7,C9JSU8,C9J987,C9J6B6,C9J556 UPI00015E0966 20/31 MODIFIER 1 deletion 30 1 PASS AAACA rs112208190 50 184043925
STEAP1B 256227 . GRCh37 7 22533452 22533453 + Frame_Shift_Del DEL CA CA - novel TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 CA CA c.87_88del p.His29GlnfsTer24 p.H29Qfs*24 ENST00000404369 3/5 STEAP1B,frameshift_variant,p.His29GlnfsTer24,ENST00000404369,NM_001164460.1;STEAP1B,frameshift_variant,p.His29GlnfsTer24,ENST00000424363,;STEAP1B,frameshift_variant,p.His29GlnfsTer24,ENST00000439708,;STEAP1B,intron_variant,,ENST00000406890,NM_207342.2;STEAP1B,splice_region_variant,,ENST00000483679,; - ENSG00000105889 ENST00000404369 Transcript frameshift_variant,splice_region_variant 503-504/1515 87-88/1029 29-30/342 HE/QX caTGag/caag 1 -1 STEAP1B HGNC 41907 protein_coding YES CCDS56469.1 ENSP00000384370 C9JL51,C9JE84,B5MCI2 UPI000173A267 NM_001164460.1 3/5 hmmpanther:PTHR14239:SF3,hmmpanther:PTHR14239 HIGH 1 deletion PASS CTCAT rs116873396 50 22533451
TEX12 56158 . GRCh37 11 112042480 112042480 + Intron DEL T T - rs1225064086 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 T T c.228-9del ENST00000280358 TEX12,intron_variant,,ENST00000280358,NM_031275.4;TEX12,intron_variant,,ENST00000530752,;AP002884.3,intron_variant,,ENST00000532612,;BCO2,upstream_gene_variant,,ENST00000357685,;BCO2,upstream_gene_variant,,ENST00000361053,NM_001256398.1;BCO2,upstream_gene_variant,,ENST00000393032,NM_031938.5;BCO2,upstream_gene_variant,,ENST00000438022,;BCO2,upstream_gene_variant,,ENST00000526088,NM_001037290.2,NM_001256397.1;BCO2,upstream_gene_variant,,ENST00000531169,;BCO2,upstream_gene_variant,,ENST00000532593,NM_001256400.1;RP11-356J5.4,intron_variant,,ENST00000527589,;SDHD,intron_variant,,ENST00000525468,;SDHD,intron_variant,,ENST00000525987,;SDHD,intron_variant,,ENST00000531744,;SDHD,intron_variant,,ENST00000532699,;BCO2,upstream_gene_variant,,ENST00000460924,;BCO2,upstream_gene_variant,,ENST00000461480,;BCO2,upstream_gene_variant,,ENST00000494860,;BCO2,upstream_gene_variant,,ENST00000527939,;BCO2,upstream_gene_variant,,ENST00000531003,;BCO2,upstream_gene_variant,,ENST00000534122,;BCO2,upstream_gene_variant,,ENST00000534550,; - ENSG00000150783 ENST00000280358 Transcript intron_variant rs1225064086 1 1 TEX12 HGNC 11734 protein_coding YES CCDS31679.1 ENSP00000280358 Q9BXU0 UPI00001377E3 NM_031275.4 4/4 MODIFIER 1 deletion 6 PASS ACTT . 50 1.711e-05 8.319e-05 8.285e-05 1.133e-05 112042479
KMT2D 8085 . GRCh37 12 49431403 49431404 + Frame_Shift_Ins INS - - T novel TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 - - c.9735dup p.Pro3246ThrfsTer5 p.P3246Tfs*5 ENST00000301067 34/54 KMT2D,frameshift_variant,p.Pro3246ThrfsTer5,ENST00000301067,NM_003482.3;KMT2D,upstream_gene_variant,,ENST00000549743,;KMT2D,downstream_gene_variant,,ENST00000549799,; T ENSG00000167548 ENST00000301067 Transcript frameshift_variant 9735-9736/19419 9735-9736/16614 3245-3246/5537 -/X -/A 1 -1 KMT2D HGNC 7133 protein_coding YES CCDS44873.1 ENSP00000301067 O14686 Q6PIA1,Q59FG6,F8VWW4 UPI0000EE84D6 NM_003482.3 34/54 hmmpanther:PTHR22884,hmmpanther:PTHR22884:SF324 HIGH 1 insertion 1 PASS GGT . 50 49431403
PDS5B 23047 . GRCh37 13 33332314 33332314 + Frame_Shift_Del DEL A A - novel TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 A A c.3148del p.Thr1050GlnfsTer12 p.T1050Qfs*12 ENST00000315596 27/35 PDS5B,frameshift_variant,p.Thr1050GlnfsTer12,ENST00000315596,NM_015032.3;PDS5B,frameshift_variant,p.Thr4GlnfsTer12,ENST00000447833,;PDS5B,frameshift_variant,p.Thr1050GlnfsTer12,ENST00000450460,; - ENSG00000083642 ENST00000315596 Transcript frameshift_variant 3332/7497 3146/4344 1049/1447 Q/X cAa/ca 1 1 PDS5B HGNC 20418 protein_coding YES CCDS41878.1 ENSP00000313851 Q9NTI5 UPI000006D4A9 NM_015032.3 27/35 hmmpanther:PTHR12663,hmmpanther:PTHR12663:SF1 HIGH 1 deletion 2 PASS ACAA . 50 33332313
CCR7 1236 . GRCh37 17 38712161 38712161 + Intron DEL T T - rs532551852 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 T T c.61-91del ENST00000246657 CCR7,intron_variant,,ENST00000246657,NM_001838.3;CCR7,intron_variant,,ENST00000578085,;CCR7,intron_variant,,ENST00000579344,; - ENSG00000126353 ENST00000246657 Transcript intron_variant rs532551852 1 -1 CCR7 HGNC 1608 protein_coding YES CCDS11369.1 ENSP00000246657 P32248 J3KTN5,J3KSS9,A0N0Q0 UPI0000001C2F NM_001838.3 2/2 0.0008 0.004 MODIFIER 1 deletion 1 PASS TCTT . 50 38712160
ATP9A 10079 . GRCh37 20 50342307 50342308 + Intron DEL TC TC - novel TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 TC TC c.327+50_327+51del ENST00000338821 ATP9A,intron_variant,,ENST00000311637,;ATP9A,intron_variant,,ENST00000338821,NM_006045.1;ATP9A,intron_variant,,ENST00000402822,;ATP9A,downstream_gene_variant,,ENST00000477492,;,regulatory_region_variant,,ENSR00001225305,; - ENSG00000054793 ENST00000338821 Transcript intron_variant 1 -1 ATP9A HGNC 13540 protein_coding YES CCDS33489.1 ENSP00000342481 O75110 Q2NLD0,B4DR18 UPI000004D334 NM_006045.1 3/27 MODIFIER 1 deletion PASS TTTCT . 50 50342306
## ENSEMBL VARIANT EFFECT PREDICTOR v99.2
## Output produced at 2020-08-13 17:08:23
## Using cache in /Users/ypradat/.vep/homo_sapiens/99_GRCh37
## Using API version 99, DB version ?
## ensembl-io version 99.441b05b
## ensembl-funcgen version 99.0832337
## ensembl version 99.d3e7d31
## ensembl-variation version 99.a7f8736
## assembly version GRCh37.p13
## dbSNP version 151
## sift version sift5.2.2
## gnomAD version r2.1
## genebuild version 2011-04
## ClinVar version 201810
## regbuild version 1.0
## gencode version GENCODE 19
## polyphen version 2.2.2
## 1000genomes version phase3
## HGMD-PUBLIC version 20174
## ESP version 20141103
## COSMIC version 86
## Column descriptions:
## Uploaded_variation : Identifier of uploaded variant
## Location : Location of variant in standard coordinate format (chr:start or chr:start-end)
## Allele : The variant allele used to calculate the consequence
## Gene : Stable ID of affected gene
## Feature : Stable ID of feature
## Feature_type : Type of feature - Transcript, RegulatoryFeature or MotifFeature
## Consequence : Consequence type
## cDNA_position : Relative position of base pair in cDNA sequence
## CDS_position : Relative position of base pair in coding sequence
## Protein_position : Relative position of amino acid in protein
## Amino_acids : Reference and variant amino acids
## Codons : Reference and variant codon sequence
## Existing_variation : Identifier(s) of co-located known variants
## Extra column keys:
## IMPACT : Subjective impact classification of consequence type
## DISTANCE : Shortest distance from variant to transcript
## STRAND : Strand of the feature (1/-1)
## FLAGS : Transcript quality flags
## SYMBOL : Gene symbol (e.g. HGNC)
## SYMBOL_SOURCE : Source of gene symbol
## HGNC_ID : Stable identifer of HGNC gene symbol
## BIOTYPE : Biotype of transcript or regulatory feature
## CANONICAL : Indicates if transcript is canonical for this gene
## MANE : MANE (Matched Annotation by NCBI and EMBL-EBI) Transcript
## TSL : Transcript support level
## APPRIS : Annotates alternatively spliced transcripts as primary or alternate based on a range of computational methods
## CCDS : Indicates if transcript is a CCDS transcript
## ENSP : Protein identifer
## SWISSPROT : UniProtKB/Swiss-Prot accession
## TREMBL : UniProtKB/TrEMBL accession
## UNIPARC : UniParc accession
## SIFT : SIFT prediction and/or score
## PolyPhen : PolyPhen prediction and/or score
## EXON : Exon number(s) / total
## INTRON : Intron number(s) / total
## HGVSc : HGVS coding sequence name
## HGVSp : HGVS protein sequence name
## HGVS_OFFSET : Indicates by how many bases the HGVS notations for this variant have been shifted
## AF : Frequency of existing variant in 1000 Genomes combined population
## AFR_AF : Frequency of existing variant in 1000 Genomes combined African population
## AMR_AF : Frequency of existing variant in 1000 Genomes combined American population
## EAS_AF : Frequency of existing variant in 1000 Genomes combined East Asian population
## EUR_AF : Frequency of existing variant in 1000 Genomes combined European population
## SAS_AF : Frequency of existing variant in 1000 Genomes combined South Asian population
## AA_AF : Frequency of existing variant in NHLBI-ESP African American population
## EA_AF : Frequency of existing variant in NHLBI-ESP European American population
## gnomAD_AF : Frequency of existing variant in gnomAD exomes combined population
## gnomAD_AFR_AF : Frequency of existing variant in gnomAD exomes African/American population
## gnomAD_AMR_AF : Frequency of existing variant in gnomAD exomes American population
## gnomAD_ASJ_AF : Frequency of existing variant in gnomAD exomes Ashkenazi Jewish population
## gnomAD_EAS_AF : Frequency of existing variant in gnomAD exomes East Asian population
## gnomAD_FIN_AF : Frequency of existing variant in gnomAD exomes Finnish population
## gnomAD_NFE_AF : Frequency of existing variant in gnomAD exomes Non-Finnish European population
## gnomAD_OTH_AF : Frequency of existing variant in gnomAD exomes other combined populations
## gnomAD_SAS_AF : Frequency of existing variant in gnomAD exomes South Asian population
## MAX_AF : Maximum observed allele frequency in 1000 Genomes, ESP and ExAC/gnomAD
## MAX_AF_POPS : Populations in which maximum allele frequency was observed
## CLIN_SIG : ClinVar clinical significance of the dbSNP variant
## SOMATIC : Somatic status of existing variant
## PHENO : Indicates if existing variant(s) is associated with a phenotype, disease or trait; multiple values correspond to multiple variants
## PUBMED : Pubmed ID(s) of publications that cite existing variant
## MOTIF_NAME : The source and identifier of a transcription factor binding profile (TFBP) aligned at this position
## MOTIF_POS : The relative position of the variation in the aligned TFBP
## HIGH_INF_POS : A flag indicating if the variant falls in a high information position of the TFBP
## MOTIF_SCORE_CHANGE : The difference in motif score of the reference and variant sequences for the TFBP
#Uploaded_variation Location Allele Gene Feature Feature_type Consequence cDNA_position CDS_position Protein_position Amino_acids Codons Existing_variation Extra
rs143272992 1:16386305-16386306 C ENSG00000185519 ENST00000375662.4 Transcript intron_variant - - - - - rs542191066 IMPACT=MODIFIER;STRAND=-1;SYMBOL=FAM131C;SYMBOL_SOURCE=HGNC;HGNC_ID=26717;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS41270.1;ENSP=ENSP00000364814;SWISSPROT=Q96AQ9;UNIPARC=UPI000022B016;INTRON=5/6;HGVSc=ENST00000375662.4:c.451+58dup;AF=0.3678;AFR_AF=0.2731;AMR_AF=0.3573;EAS_AF=0.3581;EUR_AF=0.3757;SAS_AF=0.5051;MAX_AF=0.5051;MAX_AF_POPS=SAS
3_147121630_TC/- 3:147121630-147121631 - ENSG00000174963 ENST00000525172.2 Transcript intron_variant - - - - - rs142316820 IMPACT=MODIFIER;STRAND=-1;SYMBOL=ZIC4;SYMBOL_SOURCE=HGNC;HGNC_ID=20393;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS54652.1;ENSP=ENSP00000435509;SWISSPROT=Q8N9L1;TREMBL=C9JZU7,C9JD04,C9J6T3,B3KPI4;UNIPARC=UPI0001914D88;INTRON=1/4;HGVSc=ENST00000525172.2:c.135+120_135+121del
rs112208190 3:184043926-184043927 - ENSG00000114867 ENST00000424196.1 Transcript intron_variant - - - - - rs34901174 IMPACT=MODIFIER;STRAND=1;SYMBOL=EIF4G1;SYMBOL_SOURCE=HGNC;HGNC_ID=3296;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS54687.1;ENSP=ENSP00000416255;SWISSPROT=Q04637;TREMBL=Q96I65,C9JWW9,C9JWH7,C9JSU8,C9J987,C9J6B6,C9J556;UNIPARC=UPI00015E0966;INTRON=20/31;HGVSc=ENST00000424196.1:c.3243+217_3243+218del;HGVS_OFFSET=30
rs116873396 7:22533452-22533453 - ENSG00000105889 ENST00000404369.4 Transcript frameshift_variant,splice_region_variant 503-504 87-88 29-30 HE/QX caTGag/caag - IMPACT=HIGH;STRAND=-1;SYMBOL=STEAP1B;SYMBOL_SOURCE=HGNC;HGNC_ID=41907;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS56469.1;ENSP=ENSP00000384370;TREMBL=C9JL51,C9JE84,B5MCI2;UNIPARC=UPI000173A267;EXON=3/5;HGVSc=ENST00000404369.4:c.87_88del;HGVSp=ENSP00000384370.4:p.His29GlnfsTer24
11_112042480_T/- 11:112042480 - ENSG00000150783 ENST00000280358.4 Transcript intron_variant - - - - - rs1225064086 IMPACT=MODIFIER;STRAND=1;SYMBOL=TEX12;SYMBOL_SOURCE=HGNC;HGNC_ID=11734;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS31679.1;ENSP=ENSP00000280358;SWISSPROT=Q9BXU0;UNIPARC=UPI00001377E3;INTRON=4/4;HGVSc=ENST00000280358.4:c.228-9del;HGVS_OFFSET=6;gnomAD_AF=1.711e-05;gnomAD_AFR_AF=8.319e-05;gnomAD_AMR_AF=0;gnomAD_ASJ_AF=0;gnomAD_EAS_AF=8.285e-05;gnomAD_FIN_AF=0;gnomAD_NFE_AF=1.133e-05;gnomAD_OTH_AF=0;gnomAD_SAS_AF=0;MAX_AF=8.319e-05;MAX_AF_POPS=gnomAD_AFR
12_49431404_-/T 12:49431403-49431404 T ENSG00000167548 ENST00000301067.7 Transcript frameshift_variant 9735-9736 9735-9736 3245-3246 -/X -/A - IMPACT=HIGH;STRAND=-1;SYMBOL=KMT2D;SYMBOL_SOURCE=HGNC;HGNC_ID=7133;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS44873.1;ENSP=ENSP00000301067;SWISSPROT=O14686;TREMBL=Q6PIA1,Q59FG6,F8VWW4;UNIPARC=UPI0000EE84D6;EXON=34/54;HGVSc=ENST00000301067.7:c.9735dup;HGVSp=ENSP00000301067.7:p.Pro3246ThrfsTer5
13_33332314_A/- 13:33332314 - ENSG00000083642 ENST00000315596.10 Transcript frameshift_variant 3332 3146 1049 Q/X cAa/ca - IMPACT=HIGH;STRAND=1;SYMBOL=PDS5B;SYMBOL_SOURCE=HGNC;HGNC_ID=20418;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS41878.1;ENSP=ENSP00000313851;SWISSPROT=Q9NTI5;UNIPARC=UPI000006D4A9;EXON=27/35;HGVSc=ENST00000315596.10:c.3148del;HGVSp=ENSP00000313851.10:p.Thr1050GlnfsTer12;HGVS_OFFSET=2
17_38712161_T/- 17:38712161 - ENSG00000126353 ENST00000246657.2 Transcript intron_variant - - - - - rs532551852 IMPACT=MODIFIER;STRAND=-1;SYMBOL=CCR7;SYMBOL_SOURCE=HGNC;HGNC_ID=1608;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS11369.1;ENSP=ENSP00000246657;SWISSPROT=P32248;TREMBL=J3KTN5,J3KSS9,A0N0Q0;UNIPARC=UPI0000001C2F;INTRON=2/2;HGVSc=ENST00000246657.2:c.61-91del;AF=0.0008;AFR_AF=0;AMR_AF=0;EAS_AF=0.004;EUR_AF=0;SAS_AF=0;MAX_AF=0.004;MAX_AF_POPS=EAS
20_50342307_TC/- 20:50342307-50342308 - ENSG00000054793 ENST00000338821.5 Transcript intron_variant - - - - - - IMPACT=MODIFIER;STRAND=-1;SYMBOL=ATP9A;SYMBOL_SOURCE=HGNC;HGNC_ID=13540;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS33489.1;ENSP=ENSP00000342481;SWISSPROT=O75110;TREMBL=Q2NLD0,B4DR18;UNIPARC=UPI000004D334;INTRON=3/27;HGVSc=ENST00000338821.5:c.327+50_327+51del
## ENSEMBL VARIANT EFFECT PREDICTOR v99.2
## Output produced at 2020-08-13 17:08:44
## Using cache in /Users/ypradat/.vep/homo_sapiens/99_GRCh37
## Using API version 99, DB version ?
## ensembl-funcgen version 99.0832337
## ensembl-io version 99.441b05b
## ensembl version 99.d3e7d31
## ensembl-variation version 99.a7f8736
## 1000genomes version phase3
## dbSNP version 151
## ClinVar version 201810
## gencode version GENCODE 19
## sift version sift5.2.2
## assembly version GRCh37.p13
## gnomAD version r2.1
## polyphen version 2.2.2
## ESP version 20141103
## regbuild version 1.0
## genebuild version 2011-04
## COSMIC version 86
## HGMD-PUBLIC version 20174
## Column descriptions:
## Uploaded_variation : Identifier of uploaded variant
## Location : Location of variant in standard coordinate format (chr:start or chr:start-end)
## Allele : The variant allele used to calculate the consequence
## Gene : Stable ID of affected gene
## Feature : Stable ID of feature
## Feature_type : Type of feature - Transcript, RegulatoryFeature or MotifFeature
## Consequence : Consequence type
## cDNA_position : Relative position of base pair in cDNA sequence
## CDS_position : Relative position of base pair in coding sequence
## Protein_position : Relative position of amino acid in protein
## Amino_acids : Reference and variant amino acids
## Codons : Reference and variant codon sequence
## Existing_variation : Identifier(s) of co-located known variants
## Extra column keys:
## IMPACT : Subjective impact classification of consequence type
## DISTANCE : Shortest distance from variant to transcript
## STRAND : Strand of the feature (1/-1)
## FLAGS : Transcript quality flags
## SYMBOL : Gene symbol (e.g. HGNC)
## SYMBOL_SOURCE : Source of gene symbol
## HGNC_ID : Stable identifer of HGNC gene symbol
## BIOTYPE : Biotype of transcript or regulatory feature
## CANONICAL : Indicates if transcript is canonical for this gene
## MANE : MANE (Matched Annotation by NCBI and EMBL-EBI) Transcript
## TSL : Transcript support level
## APPRIS : Annotates alternatively spliced transcripts as primary or alternate based on a range of computational methods
## CCDS : Indicates if transcript is a CCDS transcript
## ENSP : Protein identifer
## SWISSPROT : UniProtKB/Swiss-Prot accession
## TREMBL : UniProtKB/TrEMBL accession
## UNIPARC : UniParc accession
## SIFT : SIFT prediction and/or score
## PolyPhen : PolyPhen prediction and/or score
## EXON : Exon number(s) / total
## INTRON : Intron number(s) / total
## HGVSc : HGVS coding sequence name
## HGVSp : HGVS protein sequence name
## HGVS_OFFSET : Indicates by how many bases the HGVS notations for this variant have been shifted
## AF : Frequency of existing variant in 1000 Genomes combined population
## AFR_AF : Frequency of existing variant in 1000 Genomes combined African population
## AMR_AF : Frequency of existing variant in 1000 Genomes combined American population
## EAS_AF : Frequency of existing variant in 1000 Genomes combined East Asian population
## EUR_AF : Frequency of existing variant in 1000 Genomes combined European population
## SAS_AF : Frequency of existing variant in 1000 Genomes combined South Asian population
## AA_AF : Frequency of existing variant in NHLBI-ESP African American population
## EA_AF : Frequency of existing variant in NHLBI-ESP European American population
## gnomAD_AF : Frequency of existing variant in gnomAD exomes combined population
## gnomAD_AFR_AF : Frequency of existing variant in gnomAD exomes African/American population
## gnomAD_AMR_AF : Frequency of existing variant in gnomAD exomes American population
## gnomAD_ASJ_AF : Frequency of existing variant in gnomAD exomes Ashkenazi Jewish population
## gnomAD_EAS_AF : Frequency of existing variant in gnomAD exomes East Asian population
## gnomAD_FIN_AF : Frequency of existing variant in gnomAD exomes Finnish population
## gnomAD_NFE_AF : Frequency of existing variant in gnomAD exomes Non-Finnish European population
## gnomAD_OTH_AF : Frequency of existing variant in gnomAD exomes other combined populations
## gnomAD_SAS_AF : Frequency of existing variant in gnomAD exomes South Asian population
## MAX_AF : Maximum observed allele frequency in 1000 Genomes, ESP and ExAC/gnomAD
## MAX_AF_POPS : Populations in which maximum allele frequency was observed
## CLIN_SIG : ClinVar clinical significance of the dbSNP variant
## SOMATIC : Somatic status of existing variant
## PHENO : Indicates if existing variant(s) is associated with a phenotype, disease or trait; multiple values correspond to multiple variants
## PUBMED : Pubmed ID(s) of publications that cite existing variant
## MOTIF_NAME : The source and identifier of a transcription factor binding profile (TFBP) aligned at this position
## MOTIF_POS : The relative position of the variation in the aligned TFBP
## HIGH_INF_POS : A flag indicating if the variant falls in a high information position of the TFBP
## MOTIF_SCORE_CHANGE : The difference in motif score of the reference and variant sequences for the TFBP
#Uploaded_variation Location Allele Gene Feature Feature_type Consequence cDNA_position CDS_position Protein_position Amino_acids Codons Existing_variation Extra
1_44476442_C/T 1:44476442 T ENSG00000196517 ENST00000360584.2 Transcript missense_variant 554 362 121 G/D gGc/gAc COSM3805364,COSM3805365 IMPACT=MODERATE;STRAND=-1;SYMBOL=SLC6A9;SYMBOL_SOURCE=HGNC;HGNC_ID=11056;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS41317.1;ENSP=ENSP00000353791;SWISSPROT=P48067;TREMBL=B7Z589;UNIPARC=UPI000053030B;SIFT=deleterious(0);PolyPhen=probably_damaging(1);EXON=3/14;HGVSc=ENST00000360584.2:c.362G>A;HGVSp=ENSP00000353791.2:p.Gly121Asp;SOMATIC=1,1;PHENO=1,1
1_244583577_G/T 1:244583577 T ENSG00000035687 ENST00000366535.3 Transcript missense_variant 1002 685 229 P/T Cca/Aca - IMPACT=MODERATE;STRAND=-1;SYMBOL=ADSS;SYMBOL_SOURCE=HGNC;HGNC_ID=292;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS1624.1;ENSP=ENSP00000355493;SWISSPROT=P30520;UNIPARC=UPI0000132AF5;SIFT=deleterious(0.02);PolyPhen=probably_damaging(0.983);EXON=8/13;HGVSc=ENST00000366535.3:c.685C>A;HGVSp=ENSP00000355493.3:p.Pro229Thr
2_25678299_C/T 2:25678299 T ENSG00000138101 ENST00000406818.3 Transcript missense_variant 1394 1144 382 V/M Gtg/Atg rs1230449080,COSM3839175,COSM3839176 IMPACT=MODERATE;STRAND=-1;SYMBOL=DTNB;SYMBOL_SOURCE=HGNC;HGNC_ID=3058;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS46237.1;ENSP=ENSP00000384084;SWISSPROT=O60941;TREMBL=Q53TC8,Q53T51,Q53SF9,Q53QV1,F8W9U0,E9PE76,E7ES64;UNIPARC=UPI0000129949;SIFT=deleterious(0.03);PolyPhen=benign(0.379);EXON=11/21;HGVSc=ENST00000406818.3:c.1144G>A;HGVSp=ENSP00000384084.3:p.Val382Met;SOMATIC=0,1,1;PHENO=0,1,1
3_85932472_C/T 3:85932472 T ENSG00000175161 ENST00000405615.2 Transcript synonymous_variant 249 249 83 R cgC/cgT rs747906551,COSM1178952,COSM1178953 IMPACT=LOW;STRAND=1;SYMBOL=CADM2;SYMBOL_SOURCE=HGNC;HGNC_ID=29849;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS33792.1;ENSP=ENSP00000384193;SWISSPROT=Q8N3J6;TREMBL=G3XHN8;UNIPARC=UPI000013F077;EXON=3/10;HGVSc=ENST00000405615.2:c.249C>T;HGVSp=ENSP00000384193.2:p.Arg83%3D;gnomAD_AF=1.595e-05;gnomAD_AFR_AF=0;gnomAD_AMR_AF=0;gnomAD_ASJ_AF=0.000298;gnomAD_EAS_AF=0;gnomAD_FIN_AF=0;gnomAD_NFE_AF=8.821e-06;gnomAD_OTH_AF=0;gnomAD_SAS_AF=0;MAX_AF=0.000298;MAX_AF_POPS=gnomAD_ASJ;SOMATIC=0,1,1;PHENO=0,1,1
6_7986778_G/A 6:7986778 A ENSG00000219294 ENST00000460661.1 Transcript non_coding_transcript_exon_variant 9 - - - - rs1418108697 IMPACT=MODIFIER;STRAND=1;SYMBOL=PIP5K1P1;SYMBOL_SOURCE=HGNC;HGNC_ID=28372;BIOTYPE=processed_pseudogene;CANONICAL=YES;EXON=1/1;HGVSc=ENST00000460661.1:n.9G>A;gnomAD_AF=4.655e-06;gnomAD_AFR_AF=0;gnomAD_AMR_AF=0;gnomAD_ASJ_AF=0;gnomAD_EAS_AF=0;gnomAD_FIN_AF=0;gnomAD_NFE_AF=0;gnomAD_OTH_AF=0;gnomAD_SAS_AF=3.517e-05;MAX_AF=3.517e-05;MAX_AF_POPS=gnomAD_SAS
7_75609837_C/G 7:75609837 G ENSG00000127948 ENST00000461988.1 Transcript intron_variant - - - - - rs373201804 IMPACT=MODIFIER;STRAND=1;SYMBOL=POR;SYMBOL_SOURCE=HGNC;HGNC_ID=9208;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS5579.1;ENSP=ENSP00000419970;SWISSPROT=P16435;TREMBL=Q59ED7,E7EMD0,C9JQ78;UNIPARC=UPI000013D5F4;INTRON=5/15;HGVSc=ENST00000461988.1:c.516+31C>G
7_149129243_G/A 7:149129243 A ENSG00000196453 ENST00000247930.4 Transcript missense_variant 2444 2120 707 S/L tCg/tTg COSM3832243 IMPACT=MODERATE;STRAND=-1;SYMBOL=ZNF777;SYMBOL_SOURCE=HGNC;HGNC_ID=22213;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS43675.1;ENSP=ENSP00000247930;SWISSPROT=Q9ULD5;TREMBL=Q3KR11;UNIPARC=UPI0000E9B152;SIFT=tolerated(0.13);PolyPhen=probably_damaging(0.986);EXON=6/6;HGVSc=ENST00000247930.4:c.2120C>T;HGVSp=ENSP00000247930.4:p.Ser707Leu;SOMATIC=1;PHENO=1
7_150840441_C/T 7:150840441 T ENSG00000133612 ENST00000397238.2 Transcript missense_variant 2287 2287 763 R/C Cgc/Tgc rs372948404,COSM238722 IMPACT=MODERATE;STRAND=1;SYMBOL=AGAP3;SYMBOL_SOURCE=HGNC;HGNC_ID=16923;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS43681.1;ENSP=ENSP00000380413;SWISSPROT=Q96P47;TREMBL=Q96T14,D3DX07;UNIPARC=UPI0000DAC777;SIFT=deleterious(0.01);PolyPhen=possibly_damaging(0.799);EXON=17/18;HGVSc=ENST00000397238.2:c.2287C>T;HGVSp=ENSP00000380413.2:p.Arg763Cys;AA_AF=0.0002372;EA_AF=0.0001179;gnomAD_AF=6.472e-05;gnomAD_AFR_AF=0.0001292;gnomAD_AMR_AF=0;gnomAD_ASJ_AF=0;gnomAD_EAS_AF=5.565e-05;gnomAD_FIN_AF=0;gnomAD_NFE_AF=5.372e-05;gnomAD_OTH_AF=0.0001668;gnomAD_SAS_AF=0.0001977;MAX_AF=0.0002372;MAX_AF_POPS=AA;SOMATIC=0,1;PHENO=0,1
10_116247760_T/C 10:116247760 C ENSG00000099204 ENST00000277895.5 Transcript missense_variant 1096 998 333 H/R cAt/cGt COSM1474373,COSM1474374,COSM1474375,COSM4815293 IMPACT=MODERATE;STRAND=-1;SYMBOL=ABLIM1;SYMBOL_SOURCE=HGNC;HGNC_ID=78;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS7590.1;ENSP=ENSP00000277895;SWISSPROT=O14639;UNIPARC=UPI0000418D06;SIFT=deleterious(0);PolyPhen=possibly_damaging(0.887);EXON=8/23;HGVSc=ENST00000277895.5:c.998A>G;HGVSp=ENSP00000277895.5:p.His333Arg;SOMATIC=1,1,1,1;PHENO=1,1,1,1
12_43944926_T/C 12:43944926 C ENSG00000173157 ENST00000389420.3 Transcript missense_variant 239 239 80 Y/C tAt/tGt COSM1476551,COSM1476552,COSM4815292 IMPACT=MODERATE;STRAND=-1;SYMBOL=ADAMTS20;SYMBOL_SOURCE=HGNC;HGNC_ID=17178;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS31778.2;ENSP=ENSP00000374071;SWISSPROT=P59510;UNIPARC=UPI00004565F4;SIFT=deleterious(0);PolyPhen=probably_damaging(0.986);EXON=2/39;HGVSc=ENST00000389420.3:c.239A>G;HGVSp=ENSP00000374071.3:p.Tyr80Cys;SOMATIC=1,1,1;PHENO=1,1,1
13_50464902_T/C 13:50464902 C ENSG00000181358 ENST00000318353.2 Transcript non_coding_transcript_exon_variant 176 - - - - - IMPACT=MODIFIER;STRAND=1;SYMBOL=CTAGE10P;SYMBOL_SOURCE=HGNC;HGNC_ID=37288;BIOTYPE=processed_pseudogene;CANONICAL=YES;EXON=1/1;HGVSc=ENST00000318353.2:n.176T>C
14_65266493_T/C 14:65266493 C ENSG00000070182 ENST00000389722.3 Transcript missense_variant 1090 1036 346 T/A Acc/Gcc COSM1477699,COSM1477700 IMPACT=MODERATE;STRAND=-1;SYMBOL=SPTB;SYMBOL_SOURCE=HGNC;HGNC_ID=11274;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS32099.1;ENSP=ENSP00000374372;SWISSPROT=P11277;TREMBL=Q71VG2,Q71VG1,Q71VG0,Q71VF9,Q71VF8,Q59FP5,O14726,O14725;UNIPARC=UPI000053030D;SIFT=tolerated(0.28);PolyPhen=benign(0.074);EXON=8/35;HGVSc=ENST00000389722.3:c.1036A>G;HGVSp=ENSP00000374372.3:p.Thr346Ala;SOMATIC=1,1;PHENO=1,1
15_91043489_C/T 15:91043489 T ENSG00000140575 ENST00000268182.5 Transcript 3_prime_UTR_variant 5247 - - - - rs922590103 IMPACT=MODIFIER;STRAND=1;SYMBOL=IQGAP1;SYMBOL_SOURCE=HGNC;HGNC_ID=6110;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS10362.1;ENSP=ENSP00000268182;SWISSPROT=P46940;TREMBL=H0YKA5;UNIPARC=UPI000012D863;EXON=38/38;HGVSc=ENST00000268182.5:c.*149C>T
16_88790292_T/C 16:88790292 C ENSG00000103335 ENST00000301015.9 Transcript missense_variant 4569 4322 1441 Q/R cAg/cGg COSM1479166 IMPACT=MODERATE;STRAND=-1;SYMBOL=PIEZO1;SYMBOL_SOURCE=HGNC;HGNC_ID=28993;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS54058.1;ENSP=ENSP00000301015;SWISSPROT=Q92508;UNIPARC=UPI0001B300F3;SIFT=tolerated(0.25);PolyPhen=possibly_damaging(0.78);EXON=31/51;HGVSc=ENST00000301015.9:c.4322A>G;HGVSp=ENSP00000301015.9:p.Gln1441Arg;SOMATIC=1;PHENO=1
17_40272381_G/A 17:40272381 A ENSG00000108773 ENST00000225916.5 Transcript synonymous_variant 525 471 157 H caC/caT rs536716483,COSM1479581 IMPACT=LOW;STRAND=-1;SYMBOL=KAT2A;SYMBOL_SOURCE=HGNC;HGNC_ID=4201;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS11417.1;ENSP=ENSP00000225916;SWISSPROT=Q92830;TREMBL=K7ERS6;UNIPARC=UPI000000D978;EXON=3/18;HGVSc=ENST00000225916.5:c.471C>T;HGVSp=ENSP00000225916.5:p.His157%3D;AF=0.0002;AFR_AF=0;AMR_AF=0;EAS_AF=0.001;EUR_AF=0;SAS_AF=0;gnomAD_AF=2.386e-05;gnomAD_AFR_AF=0;gnomAD_AMR_AF=2.892e-05;gnomAD_ASJ_AF=0;gnomAD_EAS_AF=0.0001087;gnomAD_FIN_AF=0;gnomAD_NFE_AF=2.638e-05;gnomAD_OTH_AF=0;gnomAD_SAS_AF=0;MAX_AF=0.001;MAX_AF_POPS=EAS;SOMATIC=0,1;PHENO=0,1
19_42585066_G/A 19:42585066 A ENSG00000105732 ENST00000600245.1 Transcript missense_variant 2963 2308 770 D/N Gac/Aac COSM1481127,COSM4410014,COSM4410015,COSM4881823,COSM4881824,COSM5192241 IMPACT=MODERATE;STRAND=1;SYMBOL=ZNF574;SYMBOL_SOURCE=HGNC;HGNC_ID=26166;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS12596.1;ENSP=ENSP00000469029;SWISSPROT=Q6ZN55;TREMBL=Q9NT61,M0R133;UNIPARC=UPI00001AE536;SIFT=deleterious(0.01);PolyPhen=probably_damaging(0.917);EXON=2/2;HGVSc=ENST00000600245.1:c.2308G>A;HGVSp=ENSP00000469029.1:p.Asp770Asn;SOMATIC=1,1,1,1,1,1;PHENO=1,1,1,1,1,1
20_16730581_G/A 20:16730581 A ENSG00000125879 ENST00000246081.2 Transcript missense_variant 333 289 97 V/M Gtg/Atg rs776130394,COSM1410526 IMPACT=MODERATE;STRAND=1;SYMBOL=OTOR;SYMBOL_SOURCE=HGNC;HGNC_ID=8517;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS13124.1;ENSP=ENSP00000246081;SWISSPROT=Q9NRC9;UNIPARC=UPI0000047809;SIFT=deleterious(0);PolyPhen=probably_damaging(0.961);EXON=3/4;HGVSc=ENST00000246081.2:c.289G>A;HGVSp=ENSP00000246081.2:p.Val97Met;gnomAD_AF=1.593e-05;gnomAD_AFR_AF=0;gnomAD_AMR_AF=0;gnomAD_ASJ_AF=0;gnomAD_EAS_AF=0.000109;gnomAD_FIN_AF=0;gnomAD_NFE_AF=1.761e-05;gnomAD_OTH_AF=0;gnomAD_SAS_AF=0;MAX_AF=0.000109;MAX_AF_POPS=gnomAD_EAS;SOMATIC=0,1;PHENO=0,1
22_23040479_C/G 22:23040479 G ENSG00000211660 ENST00000390306.2 Transcript missense_variant,splice_region_variant 206 44 15 T/R aCa/aGa - IMPACT=MODERATE;STRAND=1;FLAGS=cds_end_NF;SYMBOL=IGLV2-23;SYMBOL_SOURCE=HGNC;HGNC_ID=5890;BIOTYPE=IG_V_gene;CANONICAL=YES;ENSP=ENSP00000374841;UNIPARC=UPI000173A2CA;SIFT=deleterious_low_confidence(0);PolyPhen=possibly_damaging(0.852);EXON=1/2;HGVSc=ENST00000390306.2:c.44C>G;HGVSp=ENSP00000374841.2:p.Thr15Arg
rs143435240 X:51076024 A ENSG00000122824 ENST00000376006.3 Transcript synonymous_variant 427 207 69 E gaG/gaA COSM378841 IMPACT=LOW;STRAND=1;SYMBOL=NUDT10;SYMBOL_SOURCE=HGNC;HGNC_ID=17621;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS35278.1;ENSP=ENSP00000365174;SWISSPROT=Q8NFP7;UNIPARC=UPI000006D69E;EXON=2/3;HGVSc=ENST00000376006.3:c.207G>A;HGVSp=ENSP00000365174.3:p.Glu69%3D;SOMATIC=1;PHENO=1
X_77160816_A/G X:77160816 G ENSG00000131174 ENST00000481445.1 Transcript 3_prime_UTR_variant 417 - - - - - IMPACT=MODIFIER;STRAND=1;SYMBOL=COX7B;SYMBOL_SOURCE=HGNC;HGNC_ID=2291;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS14437.1;ENSP=ENSP00000417656;SWISSPROT=P24311;UNIPARC=UPI0000049C75;EXON=3/3;HGVSc=ENST00000481445.1:c.*58A>G
X_77160852_T/A X:77160852 A ENSG00000131174 ENST00000481445.1 Transcript 3_prime_UTR_variant 453 - - - - - IMPACT=MODIFIER;STRAND=1;SYMBOL=COX7B;SYMBOL_SOURCE=HGNC;HGNC_ID=2291;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS14437.1;ENSP=ENSP00000417656;SWISSPROT=P24311;UNIPARC=UPI0000049C75;EXON=3/3;HGVSc=ENST00000481445.1:c.*94T>A
X_78216689_C/T X:78216689 T ENSG00000078589 ENST00000171757.2 Transcript synonymous_variant 952 672 224 S tcC/tcT rs866278031,COSM1491292,COSM3563627 IMPACT=LOW;STRAND=1;SYMBOL=P2RY10;SYMBOL_SOURCE=HGNC;HGNC_ID=19906;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS14442.1;ENSP=ENSP00000171757;SWISSPROT=O00398;UNIPARC=UPI0000050471;EXON=4/4;HGVSc=ENST00000171757.2:c.672C>T;HGVSp=ENSP00000171757.2:p.Ser224%3D;SOMATIC=0,1,1;PHENO=0,1,1
X_122757148_A/T X:122757148 T ENSG00000125676 ENST00000245838.8 Transcript intron_variant - - - - - - IMPACT=MODIFIER;STRAND=-1;SYMBOL=THOC2;SYMBOL_SOURCE=HGNC;HGNC_ID=19073;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS43988.1;ENSP=ENSP00000245838;SWISSPROT=Q8NI27;UNIPARC=UPI00001D7C42;INTRON=28/38;HGVSc=ENST00000245838.8:c.3504-14T>A
X_152684244_T/G X:152684244 G ENSG00000189420 ENST00000338647.5 Transcript missense_variant 148 147 49 H/Q caT/caG - IMPACT=MODERATE;STRAND=1;SYMBOL=ZFP92;SYMBOL_SOURCE=HGNC;HGNC_ID=12865;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS59177.1;ENSP=ENSP00000462054;SWISSPROT=A6NM28;UNIPARC=UPI000052B478;SIFT=deleterious(0.03);PolyPhen=probably_damaging(0.913);EXON=2/4;HGVSc=ENST00000338647.5:c.147T>G;HGVSp=ENSP00000462054.1:p.His49Gln
Chromosome Position dbSNP_RS Tumor_Seq_Allele1 Tumor_Seq_Allele2 Variant_Quality Filter n_GT n_SS n_TIR n_TAR n_DP n_DP4 n_AD n_depth n_ref_count n_alt_count t_GT t_SS t_TIR t_TAR t_DP t_DP4 t_AD t_depth t_ref_count t_alt_count
1 24486218 T TTTG 0/0 24 24.0 24.0 0.0 0/1 2 22 0,22,0,6 22.0 22.0 6.0
1 27107272 CGT C 0/0 0,0 21,21 26 0 26.0 21.0 0.0 0/1 2 3,3 14,14 18 4,14,2,1 4 18.0 14.0 3.0
1 117122285 G GTCC 0/0 8 8.0 8.0 0.0 0/1 2 16 4,12,1,6 16.0 16.0 7.0
1 171607569 CAG C 0/0 0,0 12,12 15 12 15.0 12.0 0.0 0/1 2 4,4 7,7 11 10,1,3,1 7 11.0 7.0 4.0
1 175116046 C CT,CTT 0/0 38 0 38.0 38.0 0.0 0/2 2 56 57,2,11,1 7 56.0 59.0 12.0
1 201981005 C CA 0/0 0 0.0 0/1 2 3
1 223284687 G GA 0/0 0,0 91,91 93 91 93.0 91.0 0.0 0/1 2 37,37 35,36 78 32,46,18,19 35 78.0 35.0 37.0
1 226553491 AAAC A,AAACA 0/0 12 12,0,0,0 12.0 12.0 0.0 0/1 2 9 4,0,5,0 9.0 4.0 5.0
2 11273407 GTC G,GTCTC 0/0 9 0 9.0 9.0 0.0 0/2 2 23 24,2,7,1 4 23.0 26.0 8.0
2 42996759 AAGAG A 0/0 5 5.0 5.0 0.0 0/1 2 11 11,0,7,0 11.0 11.0 7.0
2 55181022 TA TAA,T 0/0 20 0 20.0 20.0 0.0 0/2 2 20 25,0,4,0 3 20.0 25.0 4.0
2 153471255 T TCAAAA,TCAAAACAAAACAAAACAAAA 0/0 8 0 8.0 8.0 0.0 0/2 2 8 8,0,3,0 4 8.0 8.0 3.0
2 176988290 C CGCA 0/0 0 0.0 0/1 2 12
3 38355176 T TGCGCGCGCGCGC,TGCGCGCGTGTGTGTGTGTGTGTGCGCGC 0/0 20 1 20.0 20.0 0.0 0/1 2 18 18,2,5,0 8 18.0 20.0 5.0
3 148711906 G GT 0/0 26 0 26.0 26.0 0.0 0/1 2 22 21,2,1,1 4 22.0 23.0 2.0
3 164776647 T TACACAC,TACAC,TACACACAC 0/0 44 0 44.0 44.0 0.0 0/2 2 19 25,0,9,0 3 19.0 25.0 9.0
3 195792288 CGGGG C 0/0 7 0 7.0 7.0 0.0 0/1 2 11 11,0,5,0 5 11.0 11.0 5.0
3 195956726 AAG A 0/0 50 0 50.0 50.0 0.0 0/1 2 75 70,5,9,1 8 75.0 75.0 10.0
4 100472247 T TA 0/0 10 0,10,0,0 10.0 10.0 0.0 0/1 2 16 0,11,0,5 16.0 11.0 5.0
4 108608100 CTCTAACACT C 0/0 8 34 8.0 8.0 0.0 1/1 2 48 48,0,39,0 42 48.0 48.0 39.0
4 121739411 GCACA G 0/0 0 0.0 0/1 2 4
5 1093609 G GGGGCGGGGACT 0/0 0 0.0 0/1 2 18
5 174940299 TAAAAAAAAAAAAA T 0/0 0 0.0 0/1 2 3
6 32487441 A AC 0/0 4 4.0 4.0 0.0 1/1 2 20 2,18,2,18 20.0 20.0 20.0
6 32548732 C CT 0/0 31 31.0 31.0 0.0 0/1 2 106 1,87,0,18 106.0 88.0 18.0
6 32557600 T TC 0/0 42 42.0 42.0 0.0 0/1 2 68 1,57,0,10 68.0 58.0 10.0