Commit 8a377357 authored by Pradat Yoann's avatar Pradat Yoann
Browse files

rm results_old

parent c7717d8c
n_GT n_SS n_TIR n_TAR n_DP n_DP4 n_AD n_depth n_ref_count n_alt_count t_GT t_SS t_TIR t_TAR t_DP t_DP4 t_AD t_depth t_ref_count t_alt_count Variant_Quality Filter_VCF Hugo_Symbol_VCF2MAF Entrez_Gene_Id_VCF2MAF Center_VCF2MAF NCBI_Build_VCF2MAF Chromosome_VCF2MAF Start_Position_VCF2MAF End_Position_VCF2MAF Strand_VCF2MAF Variant_Classification_VCF2MAF Variant_Type_VCF2MAF Reference_Allele_VCF2MAF Tumor_Seq_Allele1_VCF2MAF Tumor_Seq_Allele2_VCF2MAF dbSNP_RS_VCF2MAF dbSNP_Val_Status_VCF2MAF Tumor_Sample_Barcode_VCF2MAF Matched_Norm_Sample_Barcode_VCF2MAF Match_Norm_Seq_Allele1_VCF2MAF Match_Norm_Seq_Allele2_VCF2MAF Tumor_Validation_Allele1_VCF2MAF Tumor_Validation_Allele2_VCF2MAF Match_Norm_Validation_Allele1_VCF2MAF Match_Norm_Validation_Allele2_VCF2MAF Verification_Status_VCF2MAF Validation_Status_VCF2MAF Mutation_Status_VCF2MAF Sequencing_Phase_VCF2MAF Sequence_Source_VCF2MAF Validation_Method_VCF2MAF Score_VCF2MAF BAM_File_VCF2MAF Sequencer_VCF2MAF Tumor_Sample_UUID_VCF2MAF Matched_Norm_Sample_UUID_VCF2MAF HGVSc_VCF2MAF HGVSp_VCF2MAF HGVSp_Short_VCF2MAF Transcript_ID_VCF2MAF Exon_Number_VCF2MAF t_depth_VCF2MAF t_ref_count_VCF2MAF t_alt_count_VCF2MAF n_depth_VCF2MAF n_ref_count_VCF2MAF n_alt_count_VCF2MAF all_effects_VCF2MAF Allele_VCF2MAF Gene_VCF2MAF Feature_VCF2MAF Feature_type_VCF2MAF Consequence_VCF2MAF cDNA_position_VCF2MAF CDS_position_VCF2MAF Protein_position_VCF2MAF Amino_acids_VCF2MAF Codons_VCF2MAF Existing_variation_VCF2MAF ALLELE_NUM_VCF2MAF DISTANCE_VCF2MAF STRAND_VEP_VCF2MAF SYMBOL_VCF2MAF SYMBOL_SOURCE_VCF2MAF HGNC_ID_VCF2MAF BIOTYPE_VCF2MAF CANONICAL_VCF2MAF CCDS_VCF2MAF ENSP_VCF2MAF SWISSPROT_VCF2MAF TREMBL_VCF2MAF UNIPARC_VCF2MAF RefSeq_VCF2MAF SIFT_VCF2MAF PolyPhen_VCF2MAF EXON_VCF2MAF INTRON_VCF2MAF DOMAINS_VCF2MAF AF_VCF2MAF AFR_AF_VCF2MAF AMR_AF_VCF2MAF ASN_AF_VCF2MAF EAS_AF_VCF2MAF EUR_AF_VCF2MAF SAS_AF_VCF2MAF AA_AF_VCF2MAF EA_AF_VCF2MAF CLIN_SIG_VCF2MAF SOMATIC_VCF2MAF PUBMED_VCF2MAF MOTIF_NAME_VCF2MAF MOTIF_POS_VCF2MAF HIGH_INF_POS_VCF2MAF MOTIF_SCORE_CHANGE_VCF2MAF IMPACT_VCF2MAF PICK_VCF2MAF VARIANT_CLASS_VCF2MAF TSL_VCF2MAF HGVS_OFFSET_VCF2MAF PHENO_VCF2MAF MINIMISED_VCF2MAF ExAC_AF_VCF2MAF ExAC_AF_AFR_VCF2MAF ExAC_AF_AMR_VCF2MAF ExAC_AF_EAS_VCF2MAF ExAC_AF_FIN_VCF2MAF ExAC_AF_NFE_VCF2MAF ExAC_AF_OTH_VCF2MAF ExAC_AF_SAS_VCF2MAF GENE_PHENO_VCF2MAF FILTER_VCF2MAF flanking_bps_VCF2MAF vcf_id_VCF2MAF vcf_qual_VCF2MAF ExAC_AF_Adj_VCF2MAF ExAC_AC_AN_Adj_VCF2MAF ExAC_AC_AN_VCF2MAF ExAC_AC_AN_AFR_VCF2MAF ExAC_AC_AN_AMR_VCF2MAF ExAC_AC_AN_EAS_VCF2MAF ExAC_AC_AN_FIN_VCF2MAF ExAC_AC_AN_NFE_VCF2MAF ExAC_AC_AN_OTH_VCF2MAF ExAC_AC_AN_SAS_VCF2MAF ExAC_FILTER_VCF2MAF gnomAD_AF_VCF2MAF gnomAD_AFR_AF_VCF2MAF gnomAD_AMR_AF_VCF2MAF gnomAD_ASJ_AF_VCF2MAF gnomAD_EAS_AF_VCF2MAF gnomAD_FIN_AF_VCF2MAF gnomAD_NFE_AF_VCF2MAF gnomAD_OTH_AF_VCF2MAF gnomAD_SAS_AF_VCF2MAF vcf_pos_VCF2MAF #Uploaded_variation_VEP Location_VEP Allele_VEP Gene_VEP Feature_VEP Feature_type_VEP Consequence_VEP cDNA_position_VEP CDS_position_VEP Protein_position_VEP Amino_acids_VEP Codons_VEP Existing_variation_VEP Extra_VEP IMPACT_VEP STRAND_VEP SYMBOL_VEP SYMBOL_SOURCE_VEP HGNC_ID_VEP BIOTYPE_VEP CANONICAL_VEP CCDS_VEP ENSP_VEP SWISSPROT_VEP UNIPARC_VEP INTRON_VEP HGVSc_VEP AFR_AF_VEP AMR_AF_VEP EAS_AF_VEP EUR_AF_VEP SAS_AF_VEP MAX_AF_VEP MAX_AF_POPS_VEP TREMBL_VEP EXON_VEP HGVSp_VEP gnomAD_AF_VEP gnomAD_AFR_AF_VEP gnomAD_AMR_AF_VEP gnomAD_ASJ_AF_VEP gnomAD_EAS_AF_VEP gnomAD_FIN_AF_VEP gnomAD_NFE_AF_VEP gnomAD_OTH_AF_VEP gnomAD_SAS_AF_VEP HGVS_OFFSET_VEP Tumor_Sample Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Tumor_Sample_Site
0/0 2 11 11,0 11.0 11.0 0.0 0/1 2 6 4,2 6.0 50 PASS FAM131C 348487 . GRCh37 1 16386305 16386306 + Intron INS - - C rs372070031 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 - - c.451+58dup ENST00000375662 FAM131C,intron_variant,,ENST00000375662,NM_182623.2;CLCNKB,downstream_gene_variant,,ENST00000375667,NM_001165945.2;CLCNKB,downstream_gene_variant,,ENST00000375679,NM_000085.4;CLCNKB,downstream_gene_variant,,ENST00000431772,;FAM131C,intron_variant,,ENST00000494078,; C ENSG00000185519 ENST00000375662 Transcript intron_variant rs372070031 1 -1 FAM131C HGNC 26717 protein_coding YES CCDS41270.1 ENSP00000364814 Q96AQ9 UPI000022B016 NM_182623.2 5/6 0.2731 0.3573 0.3581 0.3757 0.5051 MODIFIER 1 insertion PASS GGC rs143272992 50 16386305 rs143272992 1:16386305-16386306 C ENSG00000185519 ENST00000375662.4 Transcript intron_variant - - - - - rs372070031 IMPACT=MODIFIER;STRAND=-1;SYMBOL=FAM131C;SYMBOL_SOURCE=HGNC;HGNC_ID=26717;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS41270.1;ENSP=ENSP00000364814;SWISSPROT=Q96AQ9;UNIPARC=UPI000022B016;INTRON=5/6;HGVSc=ENST00000375662.4:c.451+58dup;AFR_AF=0.2731;AMR_AF=0.3573;EAS_AF=0.3581;EUR_AF=0.3757;SAS_AF=0.5051;MAX_AF=0.5051;MAX_AF_POPS=SAS MODIFIER -1 FAM131C HGNC 26717 protein_coding YES CCDS41270.1 ENSP00000364814 Q96AQ9 UPI000022B016 5/6 ENST00000375662.4:c.451+58dup 0.2731 0.3573 0.3581 0.3757 0.5051 0.5051 SAS TCGA-A1-A0SD TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 01
0/0 2 6 6,0 6.0 6.0 0.0 0/1 2 6 4,2 6.0 50 PASS ZIC4 84107 . GRCh37 3 147121630 147121631 + Intron DEL TC TC - rs142316820 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 TC TC c.135+120_135+121del ENST00000525172 ZIC4,intron_variant,,ENST00000383075,NM_032153.5;ZIC4,intron_variant,,ENST00000425731,NM_001168379.1;ZIC4,intron_variant,,ENST00000462748,;ZIC4,intron_variant,,ENST00000463250,;ZIC4,intron_variant,,ENST00000473123,;ZIC4,intron_variant,,ENST00000484399,;ZIC1,intron_variant,,ENST00000488404,;ZIC4,intron_variant,,ENST00000491672,NM_001243256.1;ZIC4,intron_variant,,ENST00000525172,NM_001168378.1;ZIC4,upstream_gene_variant,,ENST00000484586,;ZIC1,intron_variant,,ENST00000472523,;ZIC4,downstream_gene_variant,,ENST00000464144,; - ENSG00000174963 ENST00000525172 Transcript intron_variant rs142316820 1 -1 ZIC4 HGNC 20393 protein_coding YES CCDS54652.1 ENSP00000435509 Q8N9L1 C9JZU7,C9JD04,C9J6T3,B3KPI4 UPI0001914D88 NM_001168378.1 1/4 MODIFIER 1 deletion 1.0 PASS GATCT . 50 147121629 3_147121630_TC/- 3:147121630-147121631 - ENSG00000174963 ENST00000525172.2 Transcript intron_variant - - - - - rs142316820 IMPACT=MODIFIER;STRAND=-1;SYMBOL=ZIC4;SYMBOL_SOURCE=HGNC;HGNC_ID=20393;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS54652.1;ENSP=ENSP00000435509;SWISSPROT=Q8N9L1;TREMBL=C9JZU7,C9JD04,C9J6T3,B3KPI4;UNIPARC=UPI0001914D88;INTRON=1/4;HGVSc=ENST00000525172.2:c.135+120_135+121del MODIFIER -1 ZIC4 HGNC 20393 protein_coding YES CCDS54652.1 ENSP00000435509 Q8N9L1 UPI0001914D88 1/4 ENST00000525172.2:c.135+120_135+121del C9JZU7,C9JD04,C9J6T3,B3KPI4 TCGA-A1-A0SD TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 01
0/0 2 7 7,0 7.0 7.0 0.0 0/1 2 6 2,4 6.0 50 PASS EIF4G1 1981 . GRCh37 3 184043926 184043927 + Intron DEL AC AC - rs34901174 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 AC AC c.3243+217_3243+218del ENST00000424196 EIF4G1,intron_variant,,ENST00000319274,;EIF4G1,intron_variant,,ENST00000342981,NM_182917.4;EIF4G1,intron_variant,,ENST00000346169,NM_198241.2;EIF4G1,intron_variant,,ENST00000350481,NM_198242.2;EIF4G1,intron_variant,,ENST00000352767,NM_001194947.1;EIF4G1,intron_variant,,ENST00000382330,NM_001194946.1;EIF4G1,intron_variant,,ENST00000392537,NM_198244.2;EIF4G1,intron_variant,,ENST00000411531,;EIF4G1,intron_variant,,ENST00000414031,;EIF4G1,intron_variant,,ENST00000424196,;EIF4G1,intron_variant,,ENST00000427845,;EIF4G1,intron_variant,,ENST00000434061,NM_004953.4;EIF4G1,intron_variant,,ENST00000435046,;EIF4G1,intron_variant,,ENST00000441154,;EIF2B5,intron_variant,,ENST00000444495,;EIF4G1,intron_variant,,ENST00000448284,;EIF4G1,downstream_gene_variant,,ENST00000421110,;EIF4G1,downstream_gene_variant,,ENST00000426123,;EIF4G1,downstream_gene_variant,,ENST00000427607,;EIF4G1,downstream_gene_variant,,ENST00000428387,;EIF4G1,downstream_gene_variant,,ENST00000444134,;EIF4G1,downstream_gene_variant,,ENST00000444861,;EIF4G1,downstream_gene_variant,,ENST00000450424,;EIF4G1,downstream_gene_variant,,ENST00000457456,;SNORD66,downstream_gene_variant,,ENST00000390856,NR_003055.1;EIF4G1,intron_variant,,ENST00000442406,;EIF4G1,intron_variant,,ENST00000466311,;EIF4G1,downstream_gene_variant,,ENST00000413967,;EIF4G1,upstream_gene_variant,,ENST00000422614,;EIF4G1,upstream_gene_variant,,ENST00000460829,;EIF4G1,upstream_gene_variant,,ENST00000464548,;EIF4G1,upstream_gene_variant,,ENST00000475721,;EIF4G1,upstream_gene_variant,,ENST00000482303,;EIF4G1,downstream_gene_variant,,ENST00000484862,;EIF4G1,downstream_gene_variant,,ENST00000493299,; - ENSG00000114867 ENST00000424196 Transcript intron_variant rs34901174 1 1 EIF4G1 HGNC 3296 protein_coding YES CCDS54687.1 ENSP00000416255 Q04637 Q96I65,C9JWW9,C9JWH7,C9JSU8,C9J987,C9J6B6,C9J556 UPI00015E0966 20/31 MODIFIER 1 deletion 1.0 PASS AAACA rs112208190 50 184043925 rs112208190 3:184043926-184043927 - ENSG00000114867 ENST00000424196.1 Transcript intron_variant - - - - - rs34901174 IMPACT=MODIFIER;STRAND=1;SYMBOL=EIF4G1;SYMBOL_SOURCE=HGNC;HGNC_ID=3296;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS54687.1;ENSP=ENSP00000416255;SWISSPROT=Q04637;TREMBL=Q96I65,C9JWW9,C9JWH7,C9JSU8,C9J987,C9J6B6,C9J556;UNIPARC=UPI00015E0966;INTRON=20/31;HGVSc=ENST00000424196.1:c.3243+217_3243+218del MODIFIER 1 EIF4G1 HGNC 3296 protein_coding YES CCDS54687.1 ENSP00000416255 Q04637 UPI00015E0966 20/31 ENST00000424196.1:c.3243+217_3243+218del Q96I65,C9JWW9,C9JWH7,C9JSU8,C9J987,C9J6B6,C9J556 TCGA-A1-A0SD TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 01
0/0 2 22 22,0 22.0 22.0 0.0 0/1 2 6 4,2 6.0 50 PASS STEAP1B 256227 . GRCh37 7 22533452 22533453 + Frame_Shift_Del DEL CA CA - novel TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 CA CA c.87_88del p.His29GlnfsTer24 p.H29Qfs*24 ENST00000404369 3/5 STEAP1B,frameshift_variant,p.His29GlnfsTer24,ENST00000404369,NM_001164460.1;STEAP1B,frameshift_variant,p.His29GlnfsTer24,ENST00000424363,;STEAP1B,frameshift_variant,p.His29GlnfsTer24,ENST00000439708,;STEAP1B,intron_variant,,ENST00000406890,NM_207342.2;STEAP1B,splice_region_variant,,ENST00000483679,; - ENSG00000105889 ENST00000404369 Transcript frameshift_variant,splice_region_variant 503-504/1515 87-88/1029 29-30/342 HE/QX caTGag/caag 1 -1 STEAP1B HGNC 41907 protein_coding YES CCDS56469.1 ENSP00000384370 C9JL51,C9JE84,B5MCI2 UPI000173A267 NM_001164460.1 3/5 PANTHER:PTHR14239:SF3,PANTHER:PTHR14239 HIGH 1 deletion PASS CTCAT rs116873396 50 22533451 rs116873396 7:22533452-22533453 - ENSG00000105889 ENST00000404369.4 Transcript frameshift_variant,splice_region_variant 503-504 87-88 29-30 HE/QX caTGag/caag - IMPACT=HIGH;STRAND=-1;SYMBOL=STEAP1B;SYMBOL_SOURCE=HGNC;HGNC_ID=41907;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS56469.1;ENSP=ENSP00000384370;TREMBL=C9JL51,C9JE84,B5MCI2;UNIPARC=UPI000173A267;EXON=3/5;HGVSc=ENST00000404369.4:c.87_88del;HGVSp=ENSP00000384370.4:p.His29GlnfsTer24 HIGH -1 STEAP1B HGNC 41907 protein_coding YES CCDS56469.1 ENSP00000384370 UPI000173A267 ENST00000404369.4:c.87_88del C9JL51,C9JE84,B5MCI2 3/5 ENSP00000384370.4:p.His29GlnfsTer24 TCGA-A1-A0SD TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 01
0/0 2 31 31,0 31.0 31.0 0.0 0/1 2 6 4,2 6.0 50 PASS TEX12 56158 . GRCh37 11 112042480 112042480 + Intron DEL T T - rs1225064086 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 T T c.228-9del ENST00000280358 TEX12,intron_variant,,ENST00000280358,NM_031275.4;TEX12,intron_variant,,ENST00000530752,;AP002884.3,intron_variant,,ENST00000532612,;BCO2,upstream_gene_variant,,ENST00000357685,;BCO2,upstream_gene_variant,,ENST00000361053,NM_001256398.1;BCO2,upstream_gene_variant,,ENST00000393032,NM_031938.5;BCO2,upstream_gene_variant,,ENST00000438022,;BCO2,upstream_gene_variant,,ENST00000526088,NM_001037290.2,NM_001256397.1;BCO2,upstream_gene_variant,,ENST00000531169,;BCO2,upstream_gene_variant,,ENST00000532593,NM_001256400.1;RP11-356J5.4,intron_variant,,ENST00000527589,;SDHD,intron_variant,,ENST00000525468,;SDHD,intron_variant,,ENST00000525987,;SDHD,intron_variant,,ENST00000531744,;SDHD,intron_variant,,ENST00000532699,;BCO2,upstream_gene_variant,,ENST00000460924,;BCO2,upstream_gene_variant,,ENST00000461480,;BCO2,upstream_gene_variant,,ENST00000494860,;BCO2,upstream_gene_variant,,ENST00000527939,;BCO2,upstream_gene_variant,,ENST00000531003,;BCO2,upstream_gene_variant,,ENST00000534122,;BCO2,upstream_gene_variant,,ENST00000534550,; - ENSG00000150783 ENST00000280358 Transcript intron_variant rs1225064086 1 1 TEX12 HGNC 11734 protein_coding YES CCDS31679.1 ENSP00000280358 Q9BXU0 UPI00001377E3 NM_031275.4 4/4 MODIFIER 1 deletion PASS ACTT . 50 1.711e-05 8.319e-05 8.285e-05 1.133e-05 112042479 11_112042480_T/- 11:112042480 - ENSG00000150783 ENST00000280358.4 Transcript intron_variant - - - - - rs1225064086 IMPACT=MODIFIER;STRAND=1;SYMBOL=TEX12;SYMBOL_SOURCE=HGNC;HGNC_ID=11734;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS31679.1;ENSP=ENSP00000280358;SWISSPROT=Q9BXU0;UNIPARC=UPI00001377E3;INTRON=4/4;HGVSc=ENST00000280358.4:c.228-9del;gnomAD_AF=1.711e-05;gnomAD_AFR_AF=8.319e-05;gnomAD_AMR_AF=0;gnomAD_ASJ_AF=0;gnomAD_EAS_AF=8.285e-05;gnomAD_FIN_AF=0;gnomAD_NFE_AF=1.133e-05;gnomAD_OTH_AF=0;gnomAD_SAS_AF=0;MAX_AF=8.319e-05;MAX_AF_POPS=gnomAD_AFR MODIFIER 1 TEX12 HGNC 11734 protein_coding YES CCDS31679.1 ENSP00000280358 Q9BXU0 UPI00001377E3 4/4 ENST00000280358.4:c.228-9del 8.319e-05 gnomAD_AFR 1.711e-05 8.319e-05 0 0 8.285e-05 0 1.133e-05 0 0 TCGA-A1-A0SD TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 01
0/0 2 48 48,0 48.0 48.0 0.0 0/1 2 33 26,7 33.0 50 PASS KMT2D 8085 . GRCh37 12 49431403 49431404 + Frame_Shift_Ins INS - - T novel TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 - - c.9735dup p.Pro3246ThrfsTer5 p.P3246Tfs*5 ENST00000301067 34/54 KMT2D,frameshift_variant,p.Pro3246ThrfsTer5,ENST00000301067,NM_003482.3;KMT2D,upstream_gene_variant,,ENST00000549743,;KMT2D,downstream_gene_variant,,ENST00000549799,; T ENSG00000167548 ENST00000301067 Transcript frameshift_variant 9735-9736/19419 9735-9736/16614 3245-3246/5537 -/X -/A 1 -1 KMT2D HGNC 7133 protein_coding YES CCDS44873.1 ENSP00000301067 O14686 Q6PIA1,Q59FG6,F8VWW4 UPI0000EE84D6 NM_003482.3 34/54 PANTHER:PTHR22884,PANTHER:PTHR22884:SF324 HIGH 1 insertion 1.0 PASS GGT . 50 49431403 12_49431404_-/T 12:49431403-49431404 T ENSG00000167548 ENST00000301067.7 Transcript frameshift_variant 9735-9736 9735-9736 3245-3246 -/X -/A - IMPACT=HIGH;STRAND=-1;SYMBOL=KMT2D;SYMBOL_SOURCE=HGNC;HGNC_ID=7133;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS44873.1;ENSP=ENSP00000301067;SWISSPROT=O14686;TREMBL=Q6PIA1,Q59FG6,F8VWW4;UNIPARC=UPI0000EE84D6;EXON=34/54;HGVSc=ENST00000301067.7:c.9735dup;HGVSp=ENSP00000301067.7:p.Pro3246ThrfsTer5 HIGH -1 KMT2D HGNC 7133 protein_coding YES CCDS44873.1 ENSP00000301067 O14686 UPI0000EE84D6 ENST00000301067.7:c.9735dup Q6PIA1,Q59FG6,F8VWW4 34/54 ENSP00000301067.7:p.Pro3246ThrfsTer5 TCGA-A1-A0SD TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 01
0/0 2 47 47,0 47.0 47.0 0.0 0/1 2 6 4,2 6.0 50 PASS PDS5B 23047 . GRCh37 13 33332314 33332314 + Frame_Shift_Del DEL A A - novel TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 A A c.3148del p.Thr1050GlnfsTer12 p.T1050Qfs*12 ENST00000315596 27/35 PDS5B,frameshift_variant,p.Thr1050GlnfsTer12,ENST00000315596,NM_015032.3;PDS5B,frameshift_variant,p.Thr4GlnfsTer12,ENST00000447833,;PDS5B,frameshift_variant,p.Thr1050GlnfsTer12,ENST00000450460,; - ENSG00000083642 ENST00000315596 Transcript frameshift_variant 3332/7497 3146/4344 1049/1447 Q/X cAa/ca 1 1 PDS5B HGNC 20418 protein_coding YES CCDS41878.1 ENSP00000313851 Q9NTI5 UPI000006D4A9 NM_015032.3 27/35 PANTHER:PTHR12663,PANTHER:PTHR12663:SF1 HIGH 1 deletion 2.0 PASS ACAA . 50 33332313 13_33332314_A/- 13:33332314 - ENSG00000083642 ENST00000315596.10 Transcript frameshift_variant 3332 3146 1049 Q/X cAa/ca - IMPACT=HIGH;STRAND=1;SYMBOL=PDS5B;SYMBOL_SOURCE=HGNC;HGNC_ID=20418;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS41878.1;ENSP=ENSP00000313851;SWISSPROT=Q9NTI5;UNIPARC=UPI000006D4A9;EXON=27/35;HGVSc=ENST00000315596.10:c.3148del;HGVSp=ENSP00000313851.10:p.Thr1050GlnfsTer12;HGVS_OFFSET=2 HIGH 1 PDS5B HGNC 20418 protein_coding YES CCDS41878.1 ENSP00000313851 Q9NTI5 UPI000006D4A9 ENST00000315596.10:c.3148del 27/35 ENSP00000313851.10:p.Thr1050GlnfsTer12 2 TCGA-A1-A0SD TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 01
0/0 2 5 5,0 5.0 5.0 0.0 0/1 2 6 4,2 6.0 50 PASS CCR7 1236 . GRCh37 17 38712161 38712161 + Intron DEL T T - rs372297045 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 T T c.61-91del ENST00000246657 CCR7,intron_variant,,ENST00000246657,NM_001838.3;CCR7,intron_variant,,ENST00000578085,;CCR7,intron_variant,,ENST00000579344,; - ENSG00000126353 ENST00000246657 Transcript intron_variant rs372297045 1 -1 CCR7 HGNC 1608 protein_coding YES CCDS11369.1 ENSP00000246657 P32248 J3KTN5,J3KSS9,A0N0Q0 UPI0000001C2F NM_001838.3 2/2 0.004 MODIFIER 1 deletion 1.0 PASS TCTT . 50 38712160 17_38712161_T/- 17:38712161 - ENSG00000126353 ENST00000246657.2 Transcript intron_variant - - - - - rs372297045 IMPACT=MODIFIER;STRAND=-1;SYMBOL=CCR7;SYMBOL_SOURCE=HGNC;HGNC_ID=1608;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS11369.1;ENSP=ENSP00000246657;SWISSPROT=P32248;TREMBL=J3KTN5,J3KSS9,A0N0Q0;UNIPARC=UPI0000001C2F;INTRON=2/2;HGVSc=ENST00000246657.2:c.61-91del;AFR_AF=0;AMR_AF=0;EAS_AF=0.004;EUR_AF=0;SAS_AF=0;MAX_AF=0.004;MAX_AF_POPS=EAS MODIFIER -1 CCR7 HGNC 1608 protein_coding YES CCDS11369.1 ENSP00000246657 P32248 UPI0000001C2F 2/2 ENST00000246657.2:c.61-91del 0 0 0.004 0 0 0.004 EAS J3KTN5,J3KSS9,A0N0Q0 TCGA-A1-A0SD TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 01
0/0 2 22 22,0 22.0 22.0 0.0 0/1 2 15 9,6 15.0 50 PASS ATP9A 10079 . GRCh37 20 50342307 50342308 + Intron DEL TC TC - novel TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 TC TC c.327+50_327+51del ENST00000338821 ATP9A,intron_variant,,ENST00000311637,;ATP9A,intron_variant,,ENST00000338821,NM_006045.1;ATP9A,intron_variant,,ENST00000402822,;ATP9A,downstream_gene_variant,,ENST00000477492,;,regulatory_region_variant,,ENSR00001644001,; - ENSG00000054793 ENST00000338821 Transcript intron_variant 1 -1 ATP9A HGNC 13540 protein_coding YES CCDS33489.1 ENSP00000342481 O75110 Q2NLD0,B4DR18 UPI000004D334 NM_006045.1 3/27 MODIFIER 1 deletion PASS TTTCT . 50 50342306 20_50342307_TC/- 20:50342307-50342308 - ENSG00000054793 ENST00000338821.5 Transcript intron_variant - - - - - - IMPACT=MODIFIER;STRAND=-1;SYMBOL=ATP9A;SYMBOL_SOURCE=HGNC;HGNC_ID=13540;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS33489.1;ENSP=ENSP00000342481;SWISSPROT=O75110;TREMBL=Q2NLD0,B4DR18;UNIPARC=UPI000004D334;INTRON=3/27;HGVSc=ENST00000338821.5:c.327+50_327+51del MODIFIER -1 ATP9A HGNC 13540 protein_coding YES CCDS33489.1 ENSP00000342481 O75110 UPI000004D334 3/27 ENST00000338821.5:c.327+50_327+51del Q2NLD0,B4DR18 TCGA-A1-A0SD TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 01
Chromosome Position dbSNP_RS Tumor_Seq_Allele1 Tumor_Seq_Allele2 Variant_Quality Filter_VCF Hugo_Symbol Variant_Classification Variant_Type Transcript_ID n_GT n_SS n_FA n_DP n_AD t_GT t_SS t_FA t_DP t_AD
1 16386305 rs143272992 G GC 50 PASS FAM131C Intron INS ENST00000375662.4 0/0 2 0.000 11 11,0 0/1 2 0.333 6 4,2
3 147121629 ATC A 50 PASS ZIC4 Intron DEL ENST00000491672.1 0/0 2 0.000 6 6,0 0/1 2 0.333 6 4,2
3 184043925 rs112208190 AAC A 50 PASS EIF4G1 Intron DEL ENST00000392537.2 0/0 2 0.000 7 7,0 0/1 2 0.667 6 2,4
7 22533451 rs116873396 TCA T 50 PASS STEAP1B Frame_Shift_Del DEL ENST00000404369.4 0/0 2 0.000 22 22,0 0/1 2 0.333 6 4,2
11 112042479 CT C 50 PASS TEX12 Intron DEL ENST00000280358.4 0/0 2 0.000 31 31,0 0/1 2 0.333 6 4,2
12 49431403 G GT 50 PASS KMT2D Frame_Shift_Ins INS ENST00000301067.7 0/0 2 0.000 48 48,0 0/1 2 0.212 33 26,7
13 33332313 CA C 50 PASS PDS5B Frame_Shift_Del DEL ENST00000315596.10 0/0 2 0.000 47 47,0 0/1 2 0.333 6 4,2
17 38712160 CT C 50 PASS CCR7 Intron DEL ENST00000246657.2 0/0 2 0.000 5 5,0 0/1 2 0.333 6 4,2
20 50342306 TTC T 50 PASS ATP9A Intron DEL ENST00000338821.5 0/0 2 0.000 22 22,0 0/1 2 0.400 15 9,6
Chromosome Position dbSNP_RS Tumor_Seq_Allele1 Tumor_Seq_Allele2 Variant_Quality Filter_VCF Hugo_Symbol Variant_Classification Variant_Type Transcript_ID n_GT n_SS n_FA n_DP n_AD t_GT t_SS t_FA t_DP t_AD
1 44476442 C T 43 PASS SLC6A9 5'UTR SNP ENST00000372307.3 0/0 2 0.000 69 69,0 0/1 2 0.276 58 42,16
1 244583577 G T 6 PASS ADSS Missense_Mutation SNP ENST00000366535.3 0/0 2 0.000 77 77,0 0/1 2 0.083 36 33,3
2 25678299 C T 24 PASS DTNB Missense_Mutation SNP ENST00000406818.3 0/0 2 0.000 33 33,0 0/1 2 0.471 17 9,8
3 85932472 C T 56 PASS CADM2 Silent SNP ENST00000383699.3 0/0 2 0.000 50 50,0 0/1 2 0.514 37 18,19
6 7986778 G A 27 PASS BLOC1S5-TXNDC5 Intron SNP ENST00000539054.1 0/0 2 0.000 23 23,0 0/1 2 0.435 23 13,10
7 75609837 C G 13 PASS POR Intron SNP ENST00000394893.1 0/0 2 0.000 8 8,0 0/1 2 0.455 11 6,5
7 149129243 G A 16 PASS ZNF777 Missense_Mutation SNP ENST00000247930.4 0/0 2 0.000 18 18,0 0/1 2 0.222 27 21,6
7 150840441 C T 26 PASS AGAP3 Missense_Mutation SNP ENST00000463381.1 0/0 2 0.000 28 28,0 0/1 2 0.375 24 15,9
10 116247760 T C 26 PASS ABLIM1 Missense_Mutation SNP ENST00000392952.3 0/0 2 0.000 72 72,0 0/1 2 0.244 45 34,11
12 43944926 T C 44 PASS ADAMTS20 Missense_Mutation SNP ENST00000389420.3 0/0 2 0.000 50 50,0 0/1 2 0.469 32 17,15
13 50464902 T C 8 PASS IGR SNP 0/0 2 0.000 75 75,0 0/1 2 0.077 65 60,5
14 65266493 T C 20 PASS SPTB Missense_Mutation SNP ENST00000556626.1 0/0 2 0.000 21 21,0 0/1 2 0.400 20 12,8
15 91043489 C T 9 PASS IQGAP1 3'UTR SNP ENST00000268182.5 0/0 2 0.000 18 18,0 0/1 2 0.500 6 3,3
16 88790292 T C 20 PASS PIEZO1 Missense_Mutation SNP ENST00000301015.9 0/0 2 0.000 34 34,0 0/1 2 0.280 25 18,7
17 40272381 G A 99 PASS KAT2A Silent SNP ENST00000225916.5 0/0 2 0.000 35 35,0 0/1 2 0.525 61 29,32
19 42585066 G A 17 PASS ZNF574 Missense_Mutation SNP ENST00000600245.1 0/0 2 0.000 19 19,0 0/1 2 0.280 25 18,7
20 16730581 G A 21 PASS OTOR Missense_Mutation SNP ENST00000246081.2 0/0 2 0.000 52 52,0 0/1 2 0.186 43 35,8
22 23040479 C G 41 PASS IGLV2-23 RNA SNP ENST00000390306.2 0/0 2 0.000 23 23,0 0/1 2 0.520 25 12,13
X 51076024 rs143435240 G A 6 PASS NUDT10 Silent SNP ENST00000376006.3 0/0 2 0.013 78 77,1 0/1 2 0.068 44 41,3
X 77160816 A G 7 PASS COX7B 3'UTR SNP ENST00000481445.1 0/0 2 0.000 51 51,0 0/1 2 0.130 23 20,3
X 77160852 T A 7 PASS COX7B 3'UTR SNP ENST00000481445.1 0/0 2 0.000 35 35,0 0/1 2 0.176 17 14,3
X 78216689 C T 26 PASS P2RY10 Silent SNP ENST00000171757.2 0/0 2 0.000 63 63,0 0/1 2 0.185 54 44,10
X 122757148 A T 6 PASS THOC2 Intron SNP ENST00000245838.8 0/0 2 0.000 48 48,0 0/1 2 0.231 13 10,3
X 152684244 T G 6 PASS ZFP92 Missense_Mutation SNP ENST00000338647.5 0/0 2 0.000 62 62,0 0/1 2 0.059 51 48,3
#version 2.4
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer Tumor_Sample_UUID Matched_Norm_Sample_UUID HGVSc HGVSp HGVSp_Short Transcript_ID Exon_Number t_depth t_ref_count t_alt_count n_depth n_ref_count n_alt_count all_effects Allele Gene Feature Feature_type Consequence cDNA_position CDS_position Protein_position Amino_acids Codons Existing_variation ALLELE_NUM DISTANCE STRAND_VEP SYMBOL SYMBOL_SOURCE HGNC_ID BIOTYPE CANONICAL CCDS ENSP SWISSPROT TREMBL UNIPARC RefSeq SIFT PolyPhen EXON INTRON DOMAINS AF AFR_AF AMR_AF ASN_AF EAS_AF EUR_AF SAS_AF AA_AF EA_AF CLIN_SIG SOMATIC PUBMED MOTIF_NAME MOTIF_POS HIGH_INF_POS MOTIF_SCORE_CHANGE IMPACT PICK VARIANT_CLASS TSL HGVS_OFFSET PHENO MINIMISED ExAC_AF ExAC_AF_AFR ExAC_AF_AMR ExAC_AF_EAS ExAC_AF_FIN ExAC_AF_NFE ExAC_AF_OTH ExAC_AF_SAS GENE_PHENO FILTER flanking_bps vcf_id vcf_qual ExAC_AF_Adj ExAC_AC_AN_Adj ExAC_AC_AN ExAC_AC_AN_AFR ExAC_AC_AN_AMR ExAC_AC_AN_EAS ExAC_AC_AN_FIN ExAC_AC_AN_NFE ExAC_AC_AN_OTH ExAC_AC_AN_SAS ExAC_FILTER gnomAD_AF gnomAD_AFR_AF gnomAD_AMR_AF gnomAD_ASJ_AF gnomAD_EAS_AF gnomAD_FIN_AF gnomAD_NFE_AF gnomAD_OTH_AF gnomAD_SAS_AF vcf_pos
FAM131C 348487 . GRCh37 1 16386305 16386306 + Intron INS - - C rs372070031 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 - - c.451+58dup ENST00000375662 FAM131C,intron_variant,,ENST00000375662,NM_182623.2;CLCNKB,downstream_gene_variant,,ENST00000375667,NM_001165945.2;CLCNKB,downstream_gene_variant,,ENST00000375679,NM_000085.4;CLCNKB,downstream_gene_variant,,ENST00000431772,;FAM131C,intron_variant,,ENST00000494078,; C ENSG00000185519 ENST00000375662 Transcript intron_variant rs372070031 1 -1 FAM131C HGNC 26717 protein_coding YES CCDS41270.1 ENSP00000364814 Q96AQ9 UPI000022B016 NM_182623.2 5/6 0.2731 0.3573 0.3581 0.3757 0.5051 MODIFIER 1 insertion PASS GGC rs143272992 50 16386305
ZIC4 84107 . GRCh37 3 147121630 147121631 + Intron DEL TC TC - rs142316820 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 TC TC c.135+120_135+121del ENST00000525172 ZIC4,intron_variant,,ENST00000383075,NM_032153.5;ZIC4,intron_variant,,ENST00000425731,NM_001168379.1;ZIC4,intron_variant,,ENST00000462748,;ZIC4,intron_variant,,ENST00000463250,;ZIC4,intron_variant,,ENST00000473123,;ZIC4,intron_variant,,ENST00000484399,;ZIC1,intron_variant,,ENST00000488404,;ZIC4,intron_variant,,ENST00000491672,NM_001243256.1;ZIC4,intron_variant,,ENST00000525172,NM_001168378.1;ZIC4,upstream_gene_variant,,ENST00000484586,;ZIC1,intron_variant,,ENST00000472523,;ZIC4,downstream_gene_variant,,ENST00000464144,; - ENSG00000174963 ENST00000525172 Transcript intron_variant rs142316820 1 -1 ZIC4 HGNC 20393 protein_coding YES CCDS54652.1 ENSP00000435509 Q8N9L1 C9JZU7,C9JD04,C9J6T3,B3KPI4 UPI0001914D88 NM_001168378.1 1/4 MODIFIER 1 deletion 1 PASS GATCT . 50 147121629
EIF4G1 1981 . GRCh37 3 184043926 184043927 + Intron DEL AC AC - rs34901174 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 AC AC c.3243+217_3243+218del ENST00000424196 EIF4G1,intron_variant,,ENST00000319274,;EIF4G1,intron_variant,,ENST00000342981,NM_182917.4;EIF4G1,intron_variant,,ENST00000346169,NM_198241.2;EIF4G1,intron_variant,,ENST00000350481,NM_198242.2;EIF4G1,intron_variant,,ENST00000352767,NM_001194947.1;EIF4G1,intron_variant,,ENST00000382330,NM_001194946.1;EIF4G1,intron_variant,,ENST00000392537,NM_198244.2;EIF4G1,intron_variant,,ENST00000411531,;EIF4G1,intron_variant,,ENST00000414031,;EIF4G1,intron_variant,,ENST00000424196,;EIF4G1,intron_variant,,ENST00000427845,;EIF4G1,intron_variant,,ENST00000434061,NM_004953.4;EIF4G1,intron_variant,,ENST00000435046,;EIF4G1,intron_variant,,ENST00000441154,;EIF2B5,intron_variant,,ENST00000444495,;EIF4G1,intron_variant,,ENST00000448284,;EIF4G1,downstream_gene_variant,,ENST00000421110,;EIF4G1,downstream_gene_variant,,ENST00000426123,;EIF4G1,downstream_gene_variant,,ENST00000427607,;EIF4G1,downstream_gene_variant,,ENST00000428387,;EIF4G1,downstream_gene_variant,,ENST00000444134,;EIF4G1,downstream_gene_variant,,ENST00000444861,;EIF4G1,downstream_gene_variant,,ENST00000450424,;EIF4G1,downstream_gene_variant,,ENST00000457456,;SNORD66,downstream_gene_variant,,ENST00000390856,NR_003055.1;EIF4G1,intron_variant,,ENST00000442406,;EIF4G1,intron_variant,,ENST00000466311,;EIF4G1,downstream_gene_variant,,ENST00000413967,;EIF4G1,upstream_gene_variant,,ENST00000422614,;EIF4G1,upstream_gene_variant,,ENST00000460829,;EIF4G1,upstream_gene_variant,,ENST00000464548,;EIF4G1,upstream_gene_variant,,ENST00000475721,;EIF4G1,upstream_gene_variant,,ENST00000482303,;EIF4G1,downstream_gene_variant,,ENST00000484862,;EIF4G1,downstream_gene_variant,,ENST00000493299,; - ENSG00000114867 ENST00000424196 Transcript intron_variant rs34901174 1 1 EIF4G1 HGNC 3296 protein_coding YES CCDS54687.1 ENSP00000416255 Q04637 Q96I65,C9JWW9,C9JWH7,C9JSU8,C9J987,C9J6B6,C9J556 UPI00015E0966 20/31 MODIFIER 1 deletion 1 PASS AAACA rs112208190 50 184043925
STEAP1B 256227 . GRCh37 7 22533452 22533453 + Frame_Shift_Del DEL CA CA - novel TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 CA CA c.87_88del p.His29GlnfsTer24 p.H29Qfs*24 ENST00000404369 3/5 STEAP1B,frameshift_variant,p.His29GlnfsTer24,ENST00000404369,NM_001164460.1;STEAP1B,frameshift_variant,p.His29GlnfsTer24,ENST00000424363,;STEAP1B,frameshift_variant,p.His29GlnfsTer24,ENST00000439708,;STEAP1B,intron_variant,,ENST00000406890,NM_207342.2;STEAP1B,splice_region_variant,,ENST00000483679,; - ENSG00000105889 ENST00000404369 Transcript frameshift_variant,splice_region_variant 503-504/1515 87-88/1029 29-30/342 HE/QX caTGag/caag 1 -1 STEAP1B HGNC 41907 protein_coding YES CCDS56469.1 ENSP00000384370 C9JL51,C9JE84,B5MCI2 UPI000173A267 NM_001164460.1 3/5 PANTHER:PTHR14239:SF3,PANTHER:PTHR14239 HIGH 1 deletion PASS CTCAT rs116873396 50 22533451
TEX12 56158 . GRCh37 11 112042480 112042480 + Intron DEL T T - rs1225064086 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 T T c.228-9del ENST00000280358 TEX12,intron_variant,,ENST00000280358,NM_031275.4;TEX12,intron_variant,,ENST00000530752,;AP002884.3,intron_variant,,ENST00000532612,;BCO2,upstream_gene_variant,,ENST00000357685,;BCO2,upstream_gene_variant,,ENST00000361053,NM_001256398.1;BCO2,upstream_gene_variant,,ENST00000393032,NM_031938.5;BCO2,upstream_gene_variant,,ENST00000438022,;BCO2,upstream_gene_variant,,ENST00000526088,NM_001037290.2,NM_001256397.1;BCO2,upstream_gene_variant,,ENST00000531169,;BCO2,upstream_gene_variant,,ENST00000532593,NM_001256400.1;RP11-356J5.4,intron_variant,,ENST00000527589,;SDHD,intron_variant,,ENST00000525468,;SDHD,intron_variant,,ENST00000525987,;SDHD,intron_variant,,ENST00000531744,;SDHD,intron_variant,,ENST00000532699,;BCO2,upstream_gene_variant,,ENST00000460924,;BCO2,upstream_gene_variant,,ENST00000461480,;BCO2,upstream_gene_variant,,ENST00000494860,;BCO2,upstream_gene_variant,,ENST00000527939,;BCO2,upstream_gene_variant,,ENST00000531003,;BCO2,upstream_gene_variant,,ENST00000534122,;BCO2,upstream_gene_variant,,ENST00000534550,; - ENSG00000150783 ENST00000280358 Transcript intron_variant rs1225064086 1 1 TEX12 HGNC 11734 protein_coding YES CCDS31679.1 ENSP00000280358 Q9BXU0 UPI00001377E3 NM_031275.4 4/4 MODIFIER 1 deletion PASS ACTT . 50 1.711e-05 8.319e-05 8.285e-05 1.133e-05 112042479
KMT2D 8085 . GRCh37 12 49431403 49431404 + Frame_Shift_Ins INS - - T novel TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 - - c.9735dup p.Pro3246ThrfsTer5 p.P3246Tfs*5 ENST00000301067 34/54 KMT2D,frameshift_variant,p.Pro3246ThrfsTer5,ENST00000301067,NM_003482.3;KMT2D,upstream_gene_variant,,ENST00000549743,;KMT2D,downstream_gene_variant,,ENST00000549799,; T ENSG00000167548 ENST00000301067 Transcript frameshift_variant 9735-9736/19419 9735-9736/16614 3245-3246/5537 -/X -/A 1 -1 KMT2D HGNC 7133 protein_coding YES CCDS44873.1 ENSP00000301067 O14686 Q6PIA1,Q59FG6,F8VWW4 UPI0000EE84D6 NM_003482.3 34/54 PANTHER:PTHR22884,PANTHER:PTHR22884:SF324 HIGH 1 insertion 1 PASS GGT . 50 49431403
PDS5B 23047 . GRCh37 13 33332314 33332314 + Frame_Shift_Del DEL A A - novel TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 A A c.3148del p.Thr1050GlnfsTer12 p.T1050Qfs*12 ENST00000315596 27/35 PDS5B,frameshift_variant,p.Thr1050GlnfsTer12,ENST00000315596,NM_015032.3;PDS5B,frameshift_variant,p.Thr4GlnfsTer12,ENST00000447833,;PDS5B,frameshift_variant,p.Thr1050GlnfsTer12,ENST00000450460,; - ENSG00000083642 ENST00000315596 Transcript frameshift_variant 3332/7497 3146/4344 1049/1447 Q/X cAa/ca 1 1 PDS5B HGNC 20418 protein_coding YES CCDS41878.1 ENSP00000313851 Q9NTI5 UPI000006D4A9 NM_015032.3 27/35 PANTHER:PTHR12663,PANTHER:PTHR12663:SF1 HIGH 1 deletion 2 PASS ACAA . 50 33332313
CCR7 1236 . GRCh37 17 38712161 38712161 + Intron DEL T T - rs372297045 TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 T T c.61-91del ENST00000246657 CCR7,intron_variant,,ENST00000246657,NM_001838.3;CCR7,intron_variant,,ENST00000578085,;CCR7,intron_variant,,ENST00000579344,; - ENSG00000126353 ENST00000246657 Transcript intron_variant rs372297045 1 -1 CCR7 HGNC 1608 protein_coding YES CCDS11369.1 ENSP00000246657 P32248 J3KTN5,J3KSS9,A0N0Q0 UPI0000001C2F NM_001838.3 2/2 0.004 MODIFIER 1 deletion 1 PASS TCTT . 50 38712160
ATP9A 10079 . GRCh37 20 50342307 50342308 + Intron DEL TC TC - novel TCGA-A1-A0SD-01A-11D-A10Y-09 TCGA-A1-A0SD-10A-01D-A110-09 TC TC c.327+50_327+51del ENST00000338821 ATP9A,intron_variant,,ENST00000311637,;ATP9A,intron_variant,,ENST00000338821,NM_006045.1;ATP9A,intron_variant,,ENST00000402822,;ATP9A,downstream_gene_variant,,ENST00000477492,;,regulatory_region_variant,,ENSR00001644001,; - ENSG00000054793 ENST00000338821 Transcript intron_variant 1 -1 ATP9A HGNC 13540 protein_coding YES CCDS33489.1 ENSP00000342481 O75110 Q2NLD0,B4DR18 UPI000004D334 NM_006045.1 3/27 MODIFIER 1 deletion PASS TTTCT . 50 50342306
## ENSEMBL VARIANT EFFECT PREDICTOR v102.0
## Output produced at 2021-02-14 10:37:55
## Using cache in /Users/ypradat/.vep/homo_sapiens/101_GRCh37
## Using API version 101, DB version ?
## ensembl-funcgen version 101.b918a49
## ensembl-variation version 101.851c7e0
## ensembl version 101.856c8e8
## ensembl-io version 101.943b6c2
## COSMIC version 90
## sift version sift5.2.2
## regbuild version 1.0
## polyphen version 2.2.2
## genebuild version 2011-04
## dbSNP version 153
## ESP version 20141103
## assembly version GRCh37.p13
## ClinVar version 201912
## 1000genomes version phase3
## gnomAD version r2.1
## HGMD-PUBLIC version 20194
## gencode version GENCODE 19
## Column descriptions:
## Uploaded_variation : Identifier of uploaded variant
## Location : Location of variant in standard coordinate format (chr:start or chr:start-end)
## Allele : The variant allele used to calculate the consequence
## Gene : Stable ID of affected gene
## Feature : Stable ID of feature
## Feature_type : Type of feature - Transcript, RegulatoryFeature or MotifFeature
## Consequence : Consequence type
## cDNA_position : Relative position of base pair in cDNA sequence
## CDS_position : Relative position of base pair in coding sequence
## Protein_position : Relative position of amino acid in protein
## Amino_acids : Reference and variant amino acids
## Codons : Reference and variant codon sequence
## Existing_variation : Identifier(s) of co-located known variants
## Extra column keys:
## IMPACT : Subjective impact classification of consequence type
## DISTANCE : Shortest distance from variant to transcript
## STRAND : Strand of the feature (1/-1)
## FLAGS : Transcript quality flags
## SYMBOL : Gene symbol (e.g. HGNC)
## SYMBOL_SOURCE : Source of gene symbol
## HGNC_ID : Stable identifer of HGNC gene symbol
## BIOTYPE : Biotype of transcript or regulatory feature
## CANONICAL : Indicates if transcript is canonical for this gene
## MANE : MANE (Matched Annotation by NCBI and EMBL-EBI) Transcript
## TSL : Transcript support level
## APPRIS : Annotates alternatively spliced transcripts as primary or alternate based on a range of computational methods
## CCDS : Indicates if transcript is a CCDS transcript
## ENSP : Protein identifer
## SWISSPROT : UniProtKB/Swiss-Prot accession
## TREMBL : UniProtKB/TrEMBL accession
## UNIPARC : UniParc accession
## UNIPROT_ISOFORM : Direct mappings to UniProtKB isoforms
## SIFT : SIFT prediction and/or score
## PolyPhen : PolyPhen prediction and/or score
## EXON : Exon number(s) / total
## INTRON : Intron number(s) / total
## HGVSc : HGVS coding sequence name
## HGVSp : HGVS protein sequence name
## HGVS_OFFSET : Indicates by how many bases the HGVS notations for this variant have been shifted
## AF : Frequency of existing variant in 1000 Genomes combined population
## AFR_AF : Frequency of existing variant in 1000 Genomes combined African population
## AMR_AF : Frequency of existing variant in 1000 Genomes combined American population
## EAS_AF : Frequency of existing variant in 1000 Genomes combined East Asian population
## EUR_AF : Frequency of existing variant in 1000 Genomes combined European population
## SAS_AF : Frequency of existing variant in 1000 Genomes combined South Asian population
## AA_AF : Frequency of existing variant in NHLBI-ESP African American population
## EA_AF : Frequency of existing variant in NHLBI-ESP European American population
## gnomAD_AF : Frequency of existing variant in gnomAD exomes combined population
## gnomAD_AFR_AF : Frequency of existing variant in gnomAD exomes African/American population
## gnomAD_AMR_AF : Frequency of existing variant in gnomAD exomes American population
## gnomAD_ASJ_AF : Frequency of existing variant in gnomAD exomes Ashkenazi Jewish population
## gnomAD_EAS_AF : Frequency of existing variant in gnomAD exomes East Asian population
## gnomAD_FIN_AF : Frequency of existing variant in gnomAD exomes Finnish population
## gnomAD_NFE_AF : Frequency of existing variant in gnomAD exomes Non-Finnish European population
## gnomAD_OTH_AF : Frequency of existing variant in gnomAD exomes other combined populations
## gnomAD_SAS_AF : Frequency of existing variant in gnomAD exomes South Asian population
## MAX_AF : Maximum observed allele frequency in 1000 Genomes, ESP and ExAC/gnomAD
## MAX_AF_POPS : Populations in which maximum allele frequency was observed
## CLIN_SIG : ClinVar clinical significance of the dbSNP variant
## SOMATIC : Somatic status of existing variant
## PHENO : Indicates if existing variant(s) is associated with a phenotype, disease or trait; multiple values correspond to multiple variants
## PUBMED : Pubmed ID(s) of publications that cite existing variant
## MOTIF_NAME : The stable identifier of a transcription factor binding profile (TFBP) aligned at this position
## MOTIF_POS : The relative position of the variation in the aligned TFBP
## HIGH_INF_POS : A flag indicating if the variant falls in a high information position of the TFBP
## MOTIF_SCORE_CHANGE : The difference in motif score of the reference and variant sequences for the TFBP
## TRANSCRIPTION_FACTORS : List of transcription factors which bind to the transcription factor binding profile
#Uploaded_variation Location Allele Gene Feature Feature_type Consequence cDNA_position CDS_position Protein_position Amino_acids Codons Existing_variation Extra
rs143272992 1:16386305-16386306 C ENSG00000185519 ENST00000375662.4 Transcript intron_variant - - - - - rs372070031 IMPACT=MODIFIER;STRAND=-1;SYMBOL=FAM131C;SYMBOL_SOURCE=HGNC;HGNC_ID=26717;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS41270.1;ENSP=ENSP00000364814;SWISSPROT=Q96AQ9;UNIPARC=UPI000022B016;INTRON=5/6;HGVSc=ENST00000375662.4:c.451+58dup;AFR_AF=0.2731;AMR_AF=0.3573;EAS_AF=0.3581;EUR_AF=0.3757;SAS_AF=0.5051;MAX_AF=0.5051;MAX_AF_POPS=SAS
3_147121630_TC/- 3:147121630-147121631 - ENSG00000174963 ENST00000525172.2 Transcript intron_variant - - - - - rs142316820 IMPACT=MODIFIER;STRAND=-1;SYMBOL=ZIC4;SYMBOL_SOURCE=HGNC;HGNC_ID=20393;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS54652.1;ENSP=ENSP00000435509;SWISSPROT=Q8N9L1;TREMBL=C9JZU7,C9JD04,C9J6T3,B3KPI4;UNIPARC=UPI0001914D88;INTRON=1/4;HGVSc=ENST00000525172.2:c.135+120_135+121del
rs112208190 3:184043926-184043927 - ENSG00000114867 ENST00000424196.1 Transcript intron_variant - - - - - rs34901174 IMPACT=MODIFIER;STRAND=1;SYMBOL=EIF4G1;SYMBOL_SOURCE=HGNC;HGNC_ID=3296;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS54687.1;ENSP=ENSP00000416255;SWISSPROT=Q04637;TREMBL=Q96I65,C9JWW9,C9JWH7,C9JSU8,C9J987,C9J6B6,C9J556;UNIPARC=UPI00015E0966;INTRON=20/31;HGVSc=ENST00000424196.1:c.3243+217_3243+218del
rs116873396 7:22533452-22533453 - ENSG00000105889 ENST00000404369.4 Transcript frameshift_variant,splice_region_variant 503-504 87-88 29-30 HE/QX caTGag/caag - IMPACT=HIGH;STRAND=-1;SYMBOL=STEAP1B;SYMBOL_SOURCE=HGNC;HGNC_ID=41907;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS56469.1;ENSP=ENSP00000384370;TREMBL=C9JL51,C9JE84,B5MCI2;UNIPARC=UPI000173A267;EXON=3/5;HGVSc=ENST00000404369.4:c.87_88del;HGVSp=ENSP00000384370.4:p.His29GlnfsTer24
11_112042480_T/- 11:112042480 - ENSG00000150783 ENST00000280358.4 Transcript intron_variant - - - - - rs1225064086 IMPACT=MODIFIER;STRAND=1;SYMBOL=TEX12;SYMBOL_SOURCE=HGNC;HGNC_ID=11734;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS31679.1;ENSP=ENSP00000280358;SWISSPROT=Q9BXU0;UNIPARC=UPI00001377E3;INTRON=4/4;HGVSc=ENST00000280358.4:c.228-9del;gnomAD_AF=1.711e-05;gnomAD_AFR_AF=8.319e-05;gnomAD_AMR_AF=0;gnomAD_ASJ_AF=0;gnomAD_EAS_AF=8.285e-05;gnomAD_FIN_AF=0;gnomAD_NFE_AF=1.133e-05;gnomAD_OTH_AF=0;gnomAD_SAS_AF=0;MAX_AF=8.319e-05;MAX_AF_POPS=gnomAD_AFR
12_49431404_-/T 12:49431403-49431404 T ENSG00000167548 ENST00000301067.7 Transcript frameshift_variant 9735-9736 9735-9736 3245-3246 -/X -/A - IMPACT=HIGH;STRAND=-1;SYMBOL=KMT2D;SYMBOL_SOURCE=HGNC;HGNC_ID=7133;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS44873.1;ENSP=ENSP00000301067;SWISSPROT=O14686;TREMBL=Q6PIA1,Q59FG6,F8VWW4;UNIPARC=UPI0000EE84D6;EXON=34/54;HGVSc=ENST00000301067.7:c.9735dup;HGVSp=ENSP00000301067.7:p.Pro3246ThrfsTer5
13_33332314_A/- 13:33332314 - ENSG00000083642 ENST00000315596.10 Transcript frameshift_variant 3332 3146 1049 Q/X cAa/ca - IMPACT=HIGH;STRAND=1;SYMBOL=PDS5B;SYMBOL_SOURCE=HGNC;HGNC_ID=20418;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS41878.1;ENSP=ENSP00000313851;SWISSPROT=Q9NTI5;UNIPARC=UPI000006D4A9;EXON=27/35;HGVSc=ENST00000315596.10:c.3148del;HGVSp=ENSP00000313851.10:p.Thr1050GlnfsTer12;HGVS_OFFSET=2
17_38712161_T/- 17:38712161 - ENSG00000126353 ENST00000246657.2 Transcript intron_variant - - - - - rs372297045 IMPACT=MODIFIER;STRAND=-1;SYMBOL=CCR7;SYMBOL_SOURCE=HGNC;HGNC_ID=1608;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS11369.1;ENSP=ENSP00000246657;SWISSPROT=P32248;TREMBL=J3KTN5,J3KSS9,A0N0Q0;UNIPARC=UPI0000001C2F;INTRON=2/2;HGVSc=ENST00000246657.2:c.61-91del;AFR_AF=0;AMR_AF=0;EAS_AF=0.004;EUR_AF=0;SAS_AF=0;MAX_AF=0.004;MAX_AF_POPS=EAS
20_50342307_TC/- 20:50342307-50342308 - ENSG00000054793 ENST00000338821.5 Transcript intron_variant - - - - - - IMPACT=MODIFIER;STRAND=-1;SYMBOL=ATP9A;SYMBOL_SOURCE=HGNC;HGNC_ID=13540;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS33489.1;ENSP=ENSP00000342481;SWISSPROT=O75110;TREMBL=Q2NLD0,B4DR18;UNIPARC=UPI000004D334;INTRON=3/27;HGVSc=ENST00000338821.5:c.327+50_327+51del
## ENSEMBL VARIANT EFFECT PREDICTOR v101.0
## Output produced at 2020-08-28 09:53:17
## Using cache in /Users/ypradat/.vep/homo_sapiens/101_GRCh37
## Using API version 101, DB version ?
## ensembl-io version 101.943b6c2
## ensembl version 101.856c8e8
## ensembl-variation version 101.50e7372
## ensembl-funcgen version 101.b918a49
## polyphen version 2.2.2
## gencode version GENCODE 19
## genebuild version 2011-04
## dbSNP version 153
## 1000genomes version phase3
## ESP version 20141103
## gnomAD version r2.1
## assembly version GRCh37.p13
## sift version sift5.2.2
## regbuild version 1.0
## ClinVar version 201912
## COSMIC version 90
## HGMD-PUBLIC version 20194
## Column descriptions:
## Uploaded_variation : Identifier of uploaded variant
## Location : Location of variant in standard coordinate format (chr:start or chr:start-end)
## Allele : The variant allele used to calculate the consequence
## Gene : Stable ID of affected gene
## Feature : Stable ID of feature
## Feature_type : Type of feature - Transcript, RegulatoryFeature or MotifFeature
## Consequence : Consequence type
## cDNA_position : Relative position of base pair in cDNA sequence
## CDS_position : Relative position of base pair in coding sequence
## Protein_position : Relative position of amino acid in protein
## Amino_acids : Reference and variant amino acids
## Codons : Reference and variant codon sequence
## Existing_variation : Identifier(s) of co-located known variants
## Extra column keys:
## IMPACT : Subjective impact classification of consequence type
## DISTANCE : Shortest distance from variant to transcript
## STRAND : Strand of the feature (1/-1)
## FLAGS : Transcript quality flags
## SYMBOL : Gene symbol (e.g. HGNC)
## SYMBOL_SOURCE : Source of gene symbol
## HGNC_ID : Stable identifer of HGNC gene symbol
## BIOTYPE : Biotype of transcript or regulatory feature
## CANONICAL : Indicates if transcript is canonical for this gene
## MANE : MANE (Matched Annotation by NCBI and EMBL-EBI) Transcript
## TSL : Transcript support level
## APPRIS : Annotates alternatively spliced transcripts as primary or alternate based on a range of computational methods
## CCDS : Indicates if transcript is a CCDS transcript
## ENSP : Protein identifer
## SWISSPROT : UniProtKB/Swiss-Prot accession
## TREMBL : UniProtKB/TrEMBL accession
## UNIPARC : UniParc accession
## SIFT : SIFT prediction and/or score
## PolyPhen : PolyPhen prediction and/or score
## EXON : Exon number(s) / total
## INTRON : Intron number(s) / total
## HGVSc : HGVS coding sequence name
## HGVSp : HGVS protein sequence name
## HGVS_OFFSET : Indicates by how many bases the HGVS notations for this variant have been shifted
## AF : Frequency of existing variant in 1000 Genomes combined population
## AFR_AF : Frequency of existing variant in 1000 Genomes combined African population
## AMR_AF : Frequency of existing variant in 1000 Genomes combined American population
## EAS_AF : Frequency of existing variant in 1000 Genomes combined East Asian population
## EUR_AF : Frequency of existing variant in 1000 Genomes combined European population
## SAS_AF : Frequency of existing variant in 1000 Genomes combined South Asian population
## AA_AF : Frequency of existing variant in NHLBI-ESP African American population
## EA_AF : Frequency of existing variant in NHLBI-ESP European American population
## gnomAD_AF : Frequency of existing variant in gnomAD exomes combined population
## gnomAD_AFR_AF : Frequency of existing variant in gnomAD exomes African/American population
## gnomAD_AMR_AF : Frequency of existing variant in gnomAD exomes American population
## gnomAD_ASJ_AF : Frequency of existing variant in gnomAD exomes Ashkenazi Jewish population
## gnomAD_EAS_AF : Frequency of existing variant in gnomAD exomes East Asian population
## gnomAD_FIN_AF : Frequency of existing variant in gnomAD exomes Finnish population
## gnomAD_NFE_AF : Frequency of existing variant in gnomAD exomes Non-Finnish European population
## gnomAD_OTH_AF : Frequency of existing variant in gnomAD exomes other combined populations
## gnomAD_SAS_AF : Frequency of existing variant in gnomAD exomes South Asian population
## MAX_AF : Maximum observed allele frequency in 1000 Genomes, ESP and ExAC/gnomAD
## MAX_AF_POPS : Populations in which maximum allele frequency was observed
## CLIN_SIG : ClinVar clinical significance of the dbSNP variant
## SOMATIC : Somatic status of existing variant
## PHENO : Indicates if existing variant(s) is associated with a phenotype, disease or trait; multiple values correspond to multiple variants
## PUBMED : Pubmed ID(s) of publications that cite existing variant
## MOTIF_NAME : The stable identifier of a transcription factor binding profile (TFBP) aligned at this position
## MOTIF_POS : The relative position of the variation in the aligned TFBP
## HIGH_INF_POS : A flag indicating if the variant falls in a high information position of the TFBP
## MOTIF_SCORE_CHANGE : The difference in motif score of the reference and variant sequences for the TFBP
## TRANSCRIPTION_FACTORS : List of transcription factors which bind to the transcription factor binding profile
#Uploaded_variation Location Allele Gene Feature Feature_type Consequence cDNA_position CDS_position Protein_position Amino_acids Codons Existing_variation Extra
1_44476442_C/T 1:44476442 T ENSG00000196517 ENST00000360584.2 Transcript missense_variant 554 362 121 G/D gGc/gAc COSV62211565 IMPACT=MODERATE;STRAND=-1;SYMBOL=SLC6A9;SYMBOL_SOURCE=HGNC;HGNC_ID=11056;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS41317.1;ENSP=ENSP00000353791;SWISSPROT=P48067;TREMBL=B7Z589;UNIPARC=UPI000053030B;SIFT=deleterious(0);PolyPhen=probably_damaging(1);EXON=3/14;HGVSc=ENST00000360584.2:c.362G>A;HGVSp=ENSP00000353791.2:p.Gly121Asp;SOMATIC=1;PHENO=1
1_244583577_G/T 1:244583577 T ENSG00000035687 ENST00000366535.3 Transcript missense_variant 1002 685 229 P/T Cca/Aca - IMPACT=MODERATE;STRAND=-1;SYMBOL=ADSS;SYMBOL_SOURCE=HGNC;HGNC_ID=292;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS1624.1;ENSP=ENSP00000355493;SWISSPROT=P30520;UNIPARC=UPI0000132AF5;SIFT=deleterious(0.02);PolyPhen=probably_damaging(0.983);EXON=8/13;HGVSc=ENST00000366535.3:c.685C>A;HGVSp=ENSP00000355493.3:p.Pro229Thr
2_25678299_C/T 2:25678299 T ENSG00000138101 ENST00000406818.3 Transcript missense_variant 1394 1144 382 V/M Gtg/Atg rs1230449080,COSV56481440 IMPACT=MODERATE;STRAND=-1;SYMBOL=DTNB;SYMBOL_SOURCE=HGNC;HGNC_ID=3058;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS46237.1;ENSP=ENSP00000384084;SWISSPROT=O60941;TREMBL=Q53TC8,Q53T51,Q53SF9,Q53QV1,F8W9U0,E9PE76,E7ES64;UNIPARC=UPI0000129949;SIFT=deleterious(0.03);PolyPhen=benign(0.379);EXON=11/21;HGVSc=ENST00000406818.3:c.1144G>A;HGVSp=ENSP00000384084.3:p.Val382Met;SOMATIC=0,1;PHENO=0,1
3_85932472_C/T 3:85932472 T ENSG00000175161 ENST00000405615.2 Transcript synonymous_variant 249 249 83 R cgC/cgT rs747906551,COSV67367857 IMPACT=LOW;STRAND=1;SYMBOL=CADM2;SYMBOL_SOURCE=HGNC;HGNC_ID=29849;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS33792.1;ENSP=ENSP00000384193;SWISSPROT=Q8N3J6;TREMBL=G3XHN8;UNIPARC=UPI000013F077;EXON=3/10;HGVSc=ENST00000405615.2:c.249C>T;HGVSp=ENSP00000384193.2:p.Arg83%3D;gnomAD_AF=1.595e-05;gnomAD_AFR_AF=0;gnomAD_AMR_AF=0;gnomAD_ASJ_AF=0.000298;gnomAD_EAS_AF=0;gnomAD_FIN_AF=0;gnomAD_NFE_AF=8.821e-06;gnomAD_OTH_AF=0;gnomAD_SAS_AF=0;MAX_AF=0.000298;MAX_AF_POPS=gnomAD_ASJ;SOMATIC=0,1;PHENO=0,1
6_7986778_G/A 6:7986778 A ENSG00000219294 ENST00000460661.1 Transcript non_coding_transcript_exon_variant 9 - - - - rs1418108697 IMPACT=MODIFIER;STRAND=1;SYMBOL=PIP5K1P1;SYMBOL_SOURCE=HGNC;HGNC_ID=28372;BIOTYPE=processed_pseudogene;CANONICAL=YES;EXON=1/1;HGVSc=ENST00000460661.1:n.9G>A;gnomAD_AF=4.655e-06;gnomAD_AFR_AF=0;gnomAD_AMR_AF=0;gnomAD_ASJ_AF=0;gnomAD_EAS_AF=0;gnomAD_FIN_AF=0;gnomAD_NFE_AF=0;gnomAD_OTH_AF=0;gnomAD_SAS_AF=3.517e-05;MAX_AF=3.517e-05;MAX_AF_POPS=gnomAD_SAS
7_75609837_C/G 7:75609837 G ENSG00000127948 ENST00000461988.1 Transcript intron_variant - - - - - rs373201804 IMPACT=MODIFIER;STRAND=1;SYMBOL=POR;SYMBOL_SOURCE=HGNC;HGNC_ID=9208;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS5579.1;ENSP=ENSP00000419970;SWISSPROT=P16435;TREMBL=Q59ED7,E7EMD0,C9JQ78;UNIPARC=UPI000013D5F4;INTRON=5/15;HGVSc=ENST00000461988.1:c.516+31C>G
7_149129243_G/A 7:149129243 A ENSG00000196453 ENST00000247930.4 Transcript missense_variant 2444 2120 707 S/L tCg/tTg COSV56098152 IMPACT=MODERATE;STRAND=-1;SYMBOL=ZNF777;SYMBOL_SOURCE=HGNC;HGNC_ID=22213;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS43675.1;ENSP=ENSP00000247930;SWISSPROT=Q9ULD5;TREMBL=Q3KR11;UNIPARC=UPI0000E9B152;SIFT=tolerated(0.13);PolyPhen=probably_damaging(0.986);EXON=6/6;HGVSc=ENST00000247930.4:c.2120C>T;HGVSp=ENSP00000247930.4:p.Ser707Leu;SOMATIC=1;PHENO=1
7_150840441_C/T 7:150840441 T ENSG00000133612 ENST00000397238.2 Transcript missense_variant 2287 2287 763 R/C Cgc/Tgc rs372948404 IMPACT=MODERATE;STRAND=1;SYMBOL=AGAP3;SYMBOL_SOURCE=HGNC;HGNC_ID=16923;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS43681.1;ENSP=ENSP00000380413;SWISSPROT=Q96P47;TREMBL=Q96T14,D3DX07;UNIPARC=UPI0000DAC777;SIFT=deleterious(0.01);PolyPhen=possibly_damaging(0.799);EXON=17/18;HGVSc=ENST00000397238.2:c.2287C>T;HGVSp=ENSP00000380413.2:p.Arg763Cys;AA_AF=0.0002372;EA_AF=0.0001179;gnomAD_AF=6.472e-05;gnomAD_AFR_AF=0.0001292;gnomAD_AMR_AF=0;gnomAD_ASJ_AF=0;gnomAD_EAS_AF=5.565e-05;gnomAD_FIN_AF=0;gnomAD_NFE_AF=5.372e-05;gnomAD_OTH_AF=0.0001668;gnomAD_SAS_AF=0.0001977;MAX_AF=0.0002372;MAX_AF_POPS=AA
10_116247760_T/C 10:116247760 C ENSG00000099204 ENST00000277895.5 Transcript missense_variant 1096 998 333 H/R cAt/cGt COSV53311631 IMPACT=MODERATE;STRAND=-1;SYMBOL=ABLIM1;SYMBOL_SOURCE=HGNC;HGNC_ID=78;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS7590.1;ENSP=ENSP00000277895;SWISSPROT=O14639;UNIPARC=UPI0000418D06;SIFT=deleterious(0);PolyPhen=possibly_damaging(0.887);EXON=8/23;HGVSc=ENST00000277895.5:c.998A>G;HGVSp=ENSP00000277895.5:p.His333Arg;SOMATIC=1;PHENO=1
12_43944926_T/C 12:43944926 C ENSG00000173157 ENST00000389420.3 Transcript missense_variant 239 239 80 Y/C tAt/tGt COSV67136109 IMPACT=MODERATE;STRAND=-1;SYMBOL=ADAMTS20;SYMBOL_SOURCE=HGNC;HGNC_ID=17178;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS31778.2;ENSP=ENSP00000374071;SWISSPROT=P59510;UNIPARC=UPI00004565F4;SIFT=deleterious(0);PolyPhen=probably_damaging(0.986);EXON=2/39;HGVSc=ENST00000389420.3:c.239A>G;HGVSp=ENSP00000374071.3:p.Tyr80Cys;SOMATIC=1;PHENO=1
13_50464902_T/C 13:50464902 C ENSG00000181358 ENST00000318353.2 Transcript non_coding_transcript_exon_variant 176 - - - - - IMPACT=MODIFIER;STRAND=1;SYMBOL=CTAGE10P;SYMBOL_SOURCE=HGNC;HGNC_ID=37288;BIOTYPE=processed_pseudogene;CANONICAL=YES;EXON=1/1;HGVSc=ENST00000318353.2:n.176T>C
14_65266493_T/C 14:65266493 C ENSG00000070182 ENST00000389722.3 Transcript missense_variant 1090 1036 346 T/A Acc/Gcc COSV67633870 IMPACT=MODERATE;STRAND=-1;SYMBOL=SPTB;SYMBOL_SOURCE=HGNC;HGNC_ID=11274;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS32099.1;ENSP=ENSP00000374372;SWISSPROT=P11277;TREMBL=Q71VG2,Q71VG1,Q71VG0,Q71VF9,Q71VF8,Q59FP5,O14726,O14725;UNIPARC=UPI000053030D;SIFT=tolerated(0.28);PolyPhen=benign(0.074);EXON=8/35;HGVSc=ENST00000389722.3:c.1036A>G;HGVSp=ENSP00000374372.3:p.Thr346Ala;SOMATIC=1;PHENO=1
15_91043489_C/T 15:91043489 T ENSG00000140575 ENST00000268182.5 Transcript 3_prime_UTR_variant 5247 - - - - rs922590103 IMPACT=MODIFIER;STRAND=1;SYMBOL=IQGAP1;SYMBOL_SOURCE=HGNC;HGNC_ID=6110;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS10362.1;ENSP=ENSP00000268182;SWISSPROT=P46940;TREMBL=H0YKA5;UNIPARC=UPI000012D863;EXON=38/38;HGVSc=ENST00000268182.5:c.*149C>T
16_88790292_T/C 16:88790292 C ENSG00000103335 ENST00000301015.9 Transcript missense_variant 4569 4322 1441 Q/R cAg/cGg COSV56341017 IMPACT=MODERATE;STRAND=-1;SYMBOL=PIEZO1;SYMBOL_SOURCE=HGNC;HGNC_ID=28993;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS54058.1;ENSP=ENSP00000301015;SWISSPROT=Q92508;UNIPARC=UPI0001B300F3;SIFT=tolerated(0.25);PolyPhen=possibly_damaging(0.78);EXON=31/51;HGVSc=ENST00000301015.9:c.4322A>G;HGVSp=ENSP00000301015.9:p.Gln1441Arg;SOMATIC=1;PHENO=1
17_40272381_G/A 17:40272381 A ENSG00000108773 ENST00000225916.5 Transcript synonymous_variant 525 471 157 H caC/caT rs536716483,COSV56792144 IMPACT=LOW;STRAND=-1;SYMBOL=KAT2A;SYMBOL_SOURCE=HGNC;HGNC_ID=4201;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS11417.1;ENSP=ENSP00000225916;SWISSPROT=Q92830;TREMBL=K7ERS6;UNIPARC=UPI000000D978;EXON=3/18;HGVSc=ENST00000225916.5:c.471C>T;HGVSp=ENSP00000225916.5:p.His157%3D;AF=0.0002;AFR_AF=0;AMR_AF=0;EAS_AF=0.001;EUR_AF=0;SAS_AF=0;gnomAD_AF=2.386e-05;gnomAD_AFR_AF=0;gnomAD_AMR_AF=2.892e-05;gnomAD_ASJ_AF=0;gnomAD_EAS_AF=0.0001087;gnomAD_FIN_AF=0;gnomAD_NFE_AF=2.638e-05;gnomAD_OTH_AF=0;gnomAD_SAS_AF=0;MAX_AF=0.001;MAX_AF_POPS=EAS;SOMATIC=0,1;PHENO=0,1
19_42585066_G/A 19:42585066 A ENSG00000105732 ENST00000600245.1 Transcript missense_variant 2963 2308 770 D/N Gac/Aac COSV55905712,COSV55906893,COSV55907568 IMPACT=MODERATE;STRAND=1;SYMBOL=ZNF574;SYMBOL_SOURCE=HGNC;HGNC_ID=26166;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS12596.1;ENSP=ENSP00000469029;SWISSPROT=Q6ZN55;TREMBL=Q9NT61,M0R133;UNIPARC=UPI00001AE536;SIFT=deleterious(0.01);PolyPhen=probably_damaging(0.917);EXON=2/2;HGVSc=ENST00000600245.1:c.2308G>A;HGVSp=ENSP00000469029.1:p.Asp770Asn;SOMATIC=1,1,1;PHENO=1,1,1
20_16730581_G/A 20:16730581 A ENSG00000125879 ENST00000246081.2 Transcript missense_variant 333 289 97 V/M Gtg/Atg rs776130394,COSV55722123 IMPACT=MODERATE;STRAND=1;SYMBOL=OTOR;SYMBOL_SOURCE=HGNC;HGNC_ID=8517;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS13124.1;ENSP=ENSP00000246081;SWISSPROT=Q9NRC9;UNIPARC=UPI0000047809;SIFT=deleterious(0);PolyPhen=probably_damaging(0.961);EXON=3/4;HGVSc=ENST00000246081.2:c.289G>A;HGVSp=ENSP00000246081.2:p.Val97Met;gnomAD_AF=1.593e-05;gnomAD_AFR_AF=0;gnomAD_AMR_AF=0;gnomAD_ASJ_AF=0;gnomAD_EAS_AF=0.000109;gnomAD_FIN_AF=0;gnomAD_NFE_AF=1.761e-05;gnomAD_OTH_AF=0;gnomAD_SAS_AF=0;MAX_AF=0.000109;MAX_AF_POPS=gnomAD_EAS;SOMATIC=0,1;PHENO=0,1
22_23040479_C/G 22:23040479 G ENSG00000211660 ENST00000390306.2 Transcript missense_variant,splice_region_variant 206 44 15 T/R aCa/aGa - IMPACT=MODERATE;STRAND=1;FLAGS=cds_end_NF;SYMBOL=IGLV2-23;SYMBOL_SOURCE=HGNC;HGNC_ID=5890;BIOTYPE=IG_V_gene;CANONICAL=YES;ENSP=ENSP00000374841;UNIPARC=UPI000173A2CA;SIFT=deleterious_low_confidence(0);PolyPhen=possibly_damaging(0.852);EXON=1/2;HGVSc=ENST00000390306.2:c.44C>G;HGVSp=ENSP00000374841.2:p.Thr15Arg
rs143435240 X:51076024 A ENSG00000122824 ENST00000376006.3 Transcript synonymous_variant 427 207 69 E gaG/gaA rs2801626,COSV62853869 IMPACT=LOW;STRAND=1;SYMBOL=NUDT10;SYMBOL_SOURCE=HGNC;HGNC_ID=17621;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS35278.1;ENSP=ENSP00000365174;SWISSPROT=Q8NFP7;UNIPARC=UPI000006D69E;EXON=2/3;HGVSc=ENST00000376006.3:c.207G>A;HGVSp=ENSP00000365174.3:p.Glu69%3D;gnomAD_AF=0.000682;gnomAD_AFR_AF=0.0004641;gnomAD_AMR_AF=3.658e-05;gnomAD_ASJ_AF=0;gnomAD_EAS_AF=0.0007976;gnomAD_FIN_AF=0.0002512;gnomAD_NFE_AF=0.001234;gnomAD_OTH_AF=0.0004457;gnomAD_SAS_AF=0;MAX_AF=0.001234;MAX_AF_POPS=gnomAD_NFE;SOMATIC=0,1;PHENO=0,1
X_77160816_A/G X:77160816 G ENSG00000131174 ENST00000481445.1 Transcript 3_prime_UTR_variant 417 - - - - rs782235659,COSV64864574 IMPACT=MODIFIER;STRAND=1;SYMBOL=COX7B;SYMBOL_SOURCE=HGNC;HGNC_ID=2291;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS14437.1;ENSP=ENSP00000417656;SWISSPROT=P24311;UNIPARC=UPI0000049C75;EXON=3/3;HGVSc=ENST00000481445.1:c.*58A>G;SOMATIC=0,1;PHENO=0,1
X_77160852_T/A X:77160852 A ENSG00000131174 ENST00000481445.1 Transcript 3_prime_UTR_variant 453 - - - - rs1557221045 IMPACT=MODIFIER;STRAND=1;SYMBOL=COX7B;SYMBOL_SOURCE=HGNC;HGNC_ID=2291;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS14437.1;ENSP=ENSP00000417656;SWISSPROT=P24311;UNIPARC=UPI0000049C75;EXON=3/3;HGVSc=ENST00000481445.1:c.*94T>A
X_78216689_C/T X:78216689 T ENSG00000078589 ENST00000171757.2 Transcript synonymous_variant 952 672 224 S tcC/tcT rs866278031,COSV50681285,COSV50683757 IMPACT=LOW;STRAND=1;SYMBOL=P2RY10;SYMBOL_SOURCE=HGNC;HGNC_ID=19906;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS14442.1;ENSP=ENSP00000171757;SWISSPROT=O00398;UNIPARC=UPI0000050471;EXON=4/4;HGVSc=ENST00000171757.2:c.672C>T;HGVSp=ENSP00000171757.2:p.Ser224%3D;SOMATIC=0,1,1;PHENO=0,1,1
X_122757148_A/T X:122757148 T ENSG00000125676 ENST00000245838.8 Transcript intron_variant - - - - - - IMPACT=MODIFIER;STRAND=-1;SYMBOL=THOC2;SYMBOL_SOURCE=HGNC;HGNC_ID=19073;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS43988.1;ENSP=ENSP00000245838;SWISSPROT=Q8NI27;UNIPARC=UPI00001D7C42;INTRON=28/38;HGVSc=ENST00000245838.8:c.3504-14T>A
X_152684244_T/G X:152684244 G ENSG00000189420 ENST00000338647.5 Transcript missense_variant 148 147 49 H/Q caT/caG - IMPACT=MODERATE;STRAND=1;SYMBOL=ZFP92;SYMBOL_SOURCE=HGNC;HGNC_ID=12865;BIOTYPE=protein_coding;CANONICAL=YES;CCDS=CCDS59177.1;ENSP=ENSP00000462054;SWISSPROT=A6NM28;UNIPARC=UPI000052B478;SIFT=deleterious(0.03);PolyPhen=probably_damaging(0.913);EXON=2/4;HGVSc=ENST00000338647.5:c.147T>G;HGVSp=ENSP00000462054.1:p.His49Gln
Chromosome Position dbSNP_RS Tumor_Seq_Allele1 Tumor_Seq_Allele2 Variant_Quality Filter_VCF n_GT n_SS n_TIR n_TAR n_DP n_DP4 n_AD n_depth n_ref_count n_alt_count t_GT t_SS t_TIR t_TAR t_DP t_DP4 t_AD t_depth t_ref_count t_alt_count
1 24486218 T TTTG 0/0 24 24.0 24.0 0.0 0/1 2 22 0,22,0,6 22.0 22.0 6.0
1 27107272 CGT C 0/0 0,0 21,21 26 0 26.0 21.0 0.0 0/1 2 3,3 14,14 18 4,14,2,1 4 18.0 14.0 3.0
1 117122285 G GTCC 0/0 8 8.0 8.0 0.0 0/1 2 16 4,12,1,6 16.0 16.0 7.0
1 171607569 CAG C 0/0 0,0 12,12 15 12 15.0 12.0 0.0 0/1 2 4,4 7,7 11 10,1,3,1 7 11.0 7.0 4.0
1 175116046 C CT,CTT 0/0 38 0 38.0 38.0 0.0 0/2 2 56 57,2,11,1 7 56.0 59.0 12.0
1 201981005 C CA 0/0 0 0.0 0/1 2 3
1 223284687 G GA 0/0 0,0 91,91 93 91 93.0 91.0 0.0 0/1 2 37,37 35,36 78 32,46,18,19 35 78.0 35.0 37.0
1 226553491 AAAC A,AAACA 0/0 12 12,0,0,0 12.0 12.0 0.0 0/1 2 9 4,0,5,0 9.0 4.0 5.0
2 11273407 GTC G,GTCTC 0/0 9 0 9.0 9.0 0.0 0/2 2 23 24,2,7,1 4 23.0 26.0 8.0
2 42996759 AAGAG A 0/0 5 5.0 5.0 0.0 0/1 2 11 11,0,7,0 11.0 11.0 7.0
2 55181022 TA TAA,T 0/0 20 0 20.0 20.0 0.0 0/2 2 20 25,0,4,0 3 20.0 25.0 4.0
2 153471255 T TCAAAA,TCAAAACAAAACAAAACAAAA 0/0 8 0 8.0 8.0 0.0 0/2 2 8 8,0,3,0 4 8.0 8.0 3.0
2 176988290 C CGCA 0/0 0 0.0 0/1 2 12
3 38355176 T TGCGCGCGCGCGC,TGCGCGCGTGTGTGTGTGTGTGTGCGCGC 0/0 20 1 20.0 20.0 0.0 0/1 2 18 18,2,5,0 8 18.0 20.0 5.0
3 148711906 G GT 0/0 26 0 26.0 26.0 0.0 0/1 2 22 21,2,1,1 4 22.0 23.0 2.0
3 164776647 T TACACAC,TACAC,TACACACAC 0/0 44 0 44.0 44.0 0.0 0/2 2 19 25,0,9,0 3 19.0 25.0 9.0
3 195792288 CGGGG C 0/0 7 0 7.0 7.0 0.0 0/1 2 11 11,0,5,0 5 11.0 11.0 5.0
3 195956726 AAG A 0/0 50 0 50.0 50.0 0.0 0/1 2 75 70,5,9,1 8 75.0 75.0 10.0
4 100472247 T TA 0/0 10 0,10,0,0 10.0 10.0 0.0 0/1 2 16 0,11,0,5 16.0 11.0 5.0
4 108608100 CTCTAACACT C 0/0 8 34 8.0 8.0 0.0 1/1 2 48 48,0,39,0 42 48.0 48.0 39.0
4 121739411 GCACA G 0/0 0 0.0 0/1 2 4
5 1093609 G GGGGCGGGGACT 0/0 0 0.0 0/1 2 18
5 174940299 TAAAAAAAAAAAAA T 0/0 0 0.0 0/1 2 3
6 32487441 A AC 0/0 4 4.0 4.0 0.0 1/1 2 20 2,18,2,18 20.0 20.0 20.0
6 32548732 C CT 0/0 31 31.0 31.0 0.0 0/1 2 106 1,87,0,18 106.0 88.0 18.0
6 32557600 T TC 0/0 42 42.0 42.0 0.0 0/1 2 68 1,57,0,10 68.0 58.0 10.0
6 64289938 ATT AT,ATTT,A 0/0 36 0 36.0 36.0 0.0 0/3 2 22 29,2,4,1 3 22.0 31.0 5.0
6 75950109 TA TAA,T,TAAA 0/0 45 0 45.0 45.0 0.0 0/2 2 27 6,32,1,6 5 27.0 38.0 7.0
6 90577711 TCTTTGCCCAGACATGGA T 0/0 36 36.0 36.0 0.0 0/1 2 71 18,37,3,13 71.0 55.0 16.0
6 105300084 G GTT 0/0 6 9 6.0 6.0 0.0 1/1 2 30 26,3,20,3 8 30.0 29.0 23.0
6 117631463 T TTAA 0/0 21 1 21.0 21.0 0.0 0/1 2 25 5,20,2,5 5 25.0 25.0 7.0
6 152765726 GA GAA,G 0/0 0 0.0 0/1 2 5
6 158484691 CAAAAAAAAAAA C 0/0 0 0.0 0/1 2 3
6 163899794 CT CTT,C 0/0 36 0 36.0 36.0 0.0 0/2 2 22 24,2,3,0 3 22.0 26.0 3.0
7 122269207 CT C 0/0 0 0.0 0/1 2 4
7 135099044 TA T,TAA 0/0 0 0.0 0/1 2 9
7 144532829 A AG 0/0 0 0.0 0/1 2 3
7 150937074 CT C 0/0 0 0.0 0/1 2 3
8 55542730 CTTTGAAATGCTTGGTCAA C 0/0 0,0 73,73 58 73 58.0 73.0 0.0 0/1 2 7,7 27,27 30 21,9,3,4 27 30.0 27.0 7.0
8 124382376 TA T 0/0 0 0.0 0/1 2 3
9 37305829 GAT G 0/0 7 0 7.0 7.0 0.0 0/1 2 12 0,12,0,2 3 12.0 12.0 2.0
9 95039956 TA T 0/0 6 0 6.0 6.0 0.0 0/1 2 6 6,0,2,0 3 6.0 6.0 2.0
9 130950344 ACCC A 0/0 7 0,7,0,0 7.0 7.0 0.0 0/1 2 7 0,4,0,3 7.0 4.0 3.0
9 136249406 GATAATG GATG,GATATATG,GATA 0/0 21 21.0 21.0 0.0 0/1 2 14 12,0,8,0 14.0 12.0 8.0
9 140161631 TGTGGGGCTGAG T,TGTGGAG 0/0 15 0 15.0 15.0 0.0 0/2 2 20 7,11,1,4 4 20.0 18.0 5.0
10 8115955 A ACC 0/0 0,0 58,58 69 58 69.0 58.0 0.0 0/1 2 30,30 65,66 107 24,72,8,20 65 107.0 65.0 30.0
10 36811687 G GGT 0/0 77 0 77.0 77.0 0.0 0/1 2 95 97,3,24,0 11 95.0 100.0 24.0
10 75672607 C CA,CAA 0/0 16 0 16.0 16.0 0.0 0/2 2 13 14,2,9,2 4 13.0 16.0 11.0
10 78839127 A AGT,AGTGT 0/0 0 0.0 0/2 2 7
11 120348771 G GT 0/0 0 0.0 0/1 2 3
12 58187016 CT C 0/0 24 0 24.0 24.0 0.0 0/1 2 19 1,19,0,3 3 19.0 20.0 3.0
12 75893478 CA C 0/0 0 0.0 0/1 2 3
12 100930180 CT C 0/0 21 0 21.0 21.0 0.0 0/1 2 16 16,0,3,0 3 16.0 16.0 3.0
12 110463769 C CT 0/0 0 0.0 0/1 2 3
13 95227137 AAAAG A,AA 0/0 18 3 18.0 18.0 0.0 0/2 2 44 3,31,2,8 0 44.0 34.0 10.0
14 35515606 TGG T 0/0 4 0 4.0 4.0 0.0 0/1 2 7 6,0,6,0 4 7.0 6.0 6.0
14 72941206 G GA 0/0 9 9.0 9.0 0.0 0/1 2 105 67,1,39,1 105.0 68.0 40.0
14 92563254 AT ATT,A 0/0 24 0 24.0 24.0 0.0 0/2 2 32 0,35,0,6 3 32.0 35.0 6.0
15 28473275 T TA 0/0 0 0.0 0/1 2 3
15 81187286 TA T,TAA 0/0 0 0.0 0/2 2 4
15 88690736 CCTTCTTCTTCTTCTTCTTCTT C 0/0 0,0 12,12 18 0 18.0 12.0 0.0 0/1 2 5,5 5,6 27 0,28,0,4 4 27.0 5.0 5.0
16 460578 CT C 0/0 0 0.0 0/1 2 3
16 628994 TGGGC T 0/0 17 0 17.0 17.0 0.0 0/1 2 41 0,41,0,19 7 41.0 41.0 19.0
16 4700318 CA C 0/0 15 0 15.0 15.0 0.0 0/1 2 17 18,2,7,0 3 17.0 20.0 7.0
16 58200464 ACT A 0/0 142 7 142.0 142.0 0.0 0/1 2 126 96,30,9,4 13 126.0 126.0 13.0
16 84230067 GCAACCCCTTCGCT G 0/0 0 0.0 0/1 2 4
16 84230082 AACCCCTTC A 0/0 10 10.0 10.0 0.0 0/1 2 12 8,0,4,0 12.0 8.0 4.0
16 84230091 GCTCAA G 0/0 12 12.0 12.0 0.0 0/1 2 11 7,0,4,0 11.0 7.0 4.0
16 89167075 C CCCCAGGAGGCTCCCGGGAG 0/0 0 0.0 0/1 2 3
17 1264611 TA T 0/0 26 0 26.0 26.0 0.0 0/1 2 32 4,28,1,9 5 32.0 32.0 10.0
17 2297571 GCA G 0/0 0 0.0 0/1 2 7
17 3352494 C CA 0/0 26 0 26.0 26.0 0.0 0/1 2 20 0,20,0,11 3 20.0 20.0 11.0
17 4802255 GGCCTCTGCCTCGCTCCACCC G 0/0 5 0 5.0 5.0 0.0 0/1 2 13 4,9,1,3 6 13.0 13.0 4.0
17 55075670 CA CAA,C 0/0 31 0 31.0 31.0 0.0 0/2 2 36 41,0,7,0 8 36.0 41.0 7.0
17 58525216 GA G 0/0 0 0.0 0/1 2 3
17 67101527 TC T 0/0 0 0.0 0/1 2 3
17 76456454 GAGTGTA G,GAGTGTGCA 0/0 34 34.0 34.0 0.0 0/2 2 38 0,37,0,7 38.0 37.0 7.0
18 43666280 TAGTTAATATATTAATACCTTAAGA T,TAGTTAATATATTAATACCTTAAGAT 0/0 25 36 25.0 25.0 0.0 0/2 2 15 4,6,3,2 35 15.0 10.0 5.0
19 2901114 CGCCGAAGTCT C 0/0 4 0 4.0 4.0 0.0 0/1 2 18 2,16,1,5 5 18.0 18.0 6.0
19 4199809 C CA 0/0 0,0 3,3 3 0 3.0 3.0 0.0 0/1 2 7,7 1,1 8 5,2,5,2 5 8.0 1.0 7.0
19 16513357 CT C 0/0 0 0.0 0/1 2 4
19 41062902 AC A 0/0 0,0 13,13 20 0 20.0 13.0 0.0 0/1 2 13,13 14,14 46 9 46.0 14.0 13.0
20 17928175 CCTG C 0/0 0,0 249,249 255 249 255.0 249.0 0.0 0/1 2 69,70 239,239 330 240,90,49,17 239 330.0 239.0 69.0
20 30060720 GCA G 0/0 0,0 37,37 40 37 40.0 37.0 0.0 0/1 2 9,9 40,41 54 49,5,7,1 40 54.0 40.0 9.0
20 30354257 GGT GGTGT,G 0/0 48 1 48.0 48.0 0.0 0/1 2 41 48,0,9,0 3 41.0 48.0 9.0
20 46279833 GCAA G 0/0 70 70.0 70.0 0.0 0/1 2 108 82,25,8,3 108.0 107.0 11.0
21 30338153 C CA 0/0 0 0.0 0/1 2 3
21 34726106 A AT 0/0 0,0 191,191 229 191 229.0 191.0 0.0 0/1 2 57,57 148,148 253 47,204,14,36 148 253.0 148.0 57.0
21 41384834 C CTT 0/0 4 0 4.0 4.0 0.0 0/1 2 6 6,0,2,0 3 6.0 6.0 2.0
21 45712357 AC A 0/0 3 0 3.0 3.0 0.0 0/1 2 8 0,7,0,4 4 8.0 7.0 4.0
22 31301792 A AGCCACC 0/0 0 0.0 0/1 2 4
22 41918653 GT G 0/0 0,0 2,2 2 0 2.0 2.0 0.0 0/1 2 4,4 0,0 4 4 4.0 0.0 4.0
X 23724675 CAAA C,CA 0/0 28 0 28.0 28.0 0.0 0/1 2 20 26,0,3,0 3 20.0 26.0 3.0
X 54972154 C CGT 0/0 13 13.0 13.0 0.0 0/1 2 5 0,6,0,2 5.0 6.0 2.0
X 55027964 AT A 0/0 0 0.0 0/1 2 5
X 70361651 CA CAA,C 0/0 39 0 39.0 39.0 0.0 0/2 2 35 38,7,20,2 5 35.0 45.0 22.0
X 106461963 CA C 0/0 23 0 23.0 23.0 0.0 0/1 2 13 14,0,3,0 3 13.0 14.0 3.0
X 129203198 C CA 0/0 11 0 11.0 11.0 0.0 0/1 2 9 12,0,5,0 3 9.0 12.0 5.0
Chromosome Position dbSNP_RS Tumor_Seq_Allele1 Tumor_Seq_Allele2 Variant_Quality Filter_VCF n_GT n_SS n_FA n_DP n_DP4 n_AD n_depth n_ref_count n_alt_count t_GT t_SS t_FA t_DP t_DP4 t_AD t_depth t_ref_count t_alt_count
1 2520302 T C 0/0 0 5 5.0 5.0 0.0 0/1 2 0.5556 9 2,2,3,2 4,5 9.0 4.0 5.0
1 8421092 C T 0/0 0 0 6 6,0,0,0 6.0 6.0 0.0 0/1 2 0.636 11 3,0,7,1 3,7 11.0 3.0 7.0
1 16386416 G A 0/0 0 0 8 8.0 8.0 0.0 0/1 2 0.6207 29 7,4,11,7 11,19 29.0 11.0 19.0
1 16464673 G A 0/0 0 6 6.0 6.0 0.0 0/1 2 0.5714 7 1,2,1,3 3,12 7.0 3.0 12.0
1 16974869 G C 0/0 0 0 4 4,0,0,0 4.0 4.0 0.0 0/1 2 0.353 17 7,3,5,1 11,6 17.0 11.0 6.0
1 26504108 A T 0/0 0 0 219 60,158,1,0 216,1 219.0 216.0 1.0 0/1 2 0.23 183 40,101,9,33 141,42 183.0 141.0 42.0
1 39796854 T C 0/0 0 19 19.0 19.0 0.0 0/1 2 0.375 8 5,0,3,0 11,4 8.0 11.0 4.0
1 55505732 A G 0/0 0 0 4 2,2,0,0 4.0 4.0 0.0 0/1 2 0.714 14 0,4,2,8 4,10 14.0 4.0 10.0
1 93599238 G T 0/0 0 47 47,0 47.0 47.0 0.0 0/1 2 0.1034 29 26,0,2,1 26,3 29.0 26.0 3.0
1 95293148 G A 0/0 0 0 176 102,74,0,0 176,0 176.0 176.0 0.0 0/1 2 0.259 266 99,99,37,32 197,69 266.0 197.0 69.0
1 112305406 T A 0/0 194 184,7 194.0 184.0 7.0 0/1 2 147 134,9 147.0 134.0 9.0
1 116268198 A G 0/0 63 63,0 63.0 63.0 0.0 0/1 2 61 56,5 61.0 56.0 5.0
1 120296069 C T 0/0 0 30 0,30,0,0 30.0 30.0 0.0 0/1 2 0.263 19 0,14,2,3 14,5 19.0 14.0 5.0
1 144994654 G A 0/0 0 0.1111 168 83,65,13,7 168.0 148.0 20.0 0/1 2 0.159 347 148,143,27,30 291,55 347.0 291.0 55.0
1 144994861 C T 1/1 1 0.9556 47 0,2,1,44 47.0 2.0 45.0 0/1 2 0.854 41 0,6,2,33 6,35 41.0 6.0 35.0
1 145273431 A G 0/0 0 0.089 385 91,259,9,26 385.0 350.0 35.0 0/1 2 0.132 960 257,576,37,89 833,127 960.0 833.0 127.0
1 150230424 T G 0/0 129 128,0 129.0 128.0 0.0 0/1 2 247 240,7 247.0 240.0 7.0
1 152777901 G A 0/0 112 112,0 112.0 112.0 0.0 0/1 2 241 219,22 241.0 219.0 22.0
1 152777903 G C 0/0 112 112,0 112.0 112.0 0.0 0/1 2 234 214,20 234.0 214.0 20.0
1 158054332 G A 0/0 0 0 41 13,28,0,0 41,0 41.0 41.0 0.0 0/1 2 0.296 159 29,83,11,36 112,47 159.0 112.0 47.0
1 158943328 T C 0/0 0 19 19.0 19.0 0.0 0/1 2 0.25 16 12,0,4,0 13,14 16.0 13.0 14.0
1 159019487 C A 0/0 0 0 134 1,133,0,0 134,0 134.0 134.0 0.0 0/1 2 0.358 148 0,92,0,53 95,53 148.0 95.0 53.0
1 160210108 C T 0/0 0 0 63 12,51,0,0 60,0 63.0 60.0 0.0 0/1 2 0.2 125 22,78,3,22 100,25 125.0 100.0 25.0
1 182544815 T C 0/1 1 0.4091 24 1,12,0,11 24.0 13.0 11.0 1/1 3 1 16 0,0,1,15 0,16 16.0 0.0 16.0
1 204125468 A T 0/0 0 0 37 24,0 37.0 24.0 0.0 0/1 2 0.1562 32 4,23,1,4 14,5 32.0 14.0 5.0
1 248085124 G A 0/1 1 0.586 163 57,11,61,35 163.0 68.0 96.0 1/1 3 0.799 303 32,7,130,84 61,242 303.0 61.0 242.0
1 248814126 G A 0/1 1 0.7873 235 7,46,35,148 235.0 53.0 183.0 1/1 3 0.859 276 8,32,51,197 39,237 276.0 39.0 237.0
2 1546414 T C 0/0 0 0 90 4,86,0,0 90,0 90.0 90.0 0.0 0/1 2 0.25 64 3,45,2,14 48,16 64.0 48.0 16.0
2 10132119 T A 0/0 104 103,1 104.0 103.0 1.0 0/1 2 123 116,6 123.0 116.0 6.0
2 27324340 G A 0/0 0 44 20,22,1,1 44.0 42.0 2.0 0/1 2 0.244 78 33,26,6,13 59,19 78.0 59.0 19.0
2 27708021 G A 0/0 206 203,3 206.0 203.0 3.0 0/1 2 243 236,7 243.0 236.0 7.0
2 61462928 G A 0/0 96 95,0 96.0 95.0 0.0 0/1 2 131 126,5 131.0 126.0 5.0
2 75114839 A G 0/0 0 0 4 4,0,0,0 4.0 4.0 0.0 0/1 2 0.556 9 4,0,5,0 4,5 9.0 4.0 5.0
2 85890293 T C 0/0 0 0 4 4,0,0,0 4.0 4.0 0.0 0/1 2 0.75 8 2,0,4,2 2,6 8.0 2.0 6.0
2 118771566 C A 0/1 1 0.6667 10 1,1,4,4 10.0 2.0 8.0 1/1 3 1 36 0,0,10,26 0,36 36.0 0.0 36.0
2 159170495 T N,G 0/0 0 68 68.0 68.0 0.0 0/2 2 0.1087 46 0,41,0,5 46.0 41.0 5.0
2 170070247 T G 0/0 0 149 150,0 149.0 150.0 0.0 0/1 2 0.1158 190 68,100,13,9 169,22 190.0 169.0 22.0
2 220479255 G A 0/0 0 0.007 148 63,84,1,1 146,0 148.0 146.0 0.0 0/1 2 0.237 262 94,105,29,34 199,62 262.0 199.0 62.0
2 232121173 A C 0/0 114 111,1 114.0 111.0 1.0 0/1 2 120 115,5 120.0 115.0 5.0
2 239073046 C T 0/0 0 1 1,0,0,0 1.0 1.0 0.0 1/1 2 1 4 0,0,2,2 0,4 4.0 0.0 4.0
2 240982228 C T 0/1 1 0.7977 414 67,18,145,184 414.0 85.0 329.0 1/1 3 0.855 669 54,23,261,325 86,572 669.0 86.0 572.0
3 10108898 A G 0/0 120 120,0 120.0 120.0 0.0 0/1 2 133 127,6 133.0 127.0 6.0
3 15345924 G A 0/0 0 0 5 5.0 5.0 0.0 0/1 2 0.6667 6 0,2,1,3 2,4 6.0 2.0 4.0
3 39145186 G A 0/0 0 0 8 0,8,0,0 8.0 8.0 0.0 0/1 2 0.625 8 0,3,0,5 3,5 8.0 3.0 5.0
3 42687278 C T 0/0 0 12 8,0,4,0 12.0 8.0 4.0 0/1 2 0.357 28 18,0,10,0 18,10 28.0 18.0 10.0
3 64084857 C A 0/0 92 92,0 92.0 92.0 0.0 0/1 2 125 118,6 125.0 118.0 6.0
3 108229122 C G 0/0 0 0 6 5,0,1,0 6.0 5.0 1.0 1/1 2 1 5 0,0,4,1 0,5 5.0 0.0 5.0
3 135820792 C A 0/0 0 55 78,7 55.0 78.0 7.0 0/1 2 0.1316 38 24,9,3,2 45,33 38.0 45.0 33.0
3 146243308 G A 0/0 0 0 50 45,5,0,1 49,0 50.0 49.0 0.0 0/1 2 0.378 45 25,3,13,4 28,17 45.0 28.0 17.0
3 188478225 C T 0/0 0 23 0,23,0,0 22,0 23.0 22.0 0.0 0/1 2 0.25 16 0,11,0,4 12,4 16.0 12.0 4.0
3 193177124 T C 0/0 0 0 6 2,4,0,0 6.0 6.0 0.0 0/1 2 0.667 6 0,2,0,4 2,4 6.0 2.0 4.0
4 952210 C T 0/0 0 2 0,2,0,0 2,0 2.0 2.0 0.0 1/1 2 0.941 17 0,1,3,13 1,16 17.0 1.0 16.0
4 15067943 A G 0/0 0 0 194 36,158,1,0 191,0 194.0 191.0 0.0 0/1 2 0.23 209 35,126,11,37 161,48 209.0 161.0 48.0
4 25032135 C T 0/0 0 6 6.0 6.0 0.0 0/1 2 0.5 22 6,5,6,5 11,11 22.0 11.0 11.0
4 78677973 A G 0/0 0 0 117 91,25,1,0 116,1 117.0 116.0 1.0 0/1 2 0.331 148 86,13,40,9 99,49 148.0 99.0 49.0
4 119609200 G T 0/0 68 68,0 68.0 68.0 0.0 0/1 2 58 53,4 58.0 53.0 4.0
4 151821369 C A 0/0 0 0 92 18,74,0,0 91,0 92.0 91.0 0.0 0/1 2 0.227 88 11,57,4,16 68,20 88.0 68.0 20.0
5 848578 G A 0/0 0 0 18 18.0 18.0 0.0 0/1 2 0.4615 13 7,0,6,0 13.0 7.0 6.0
5 6312879 C G 0/0 0 20 20.0 20.0 0.0 0/1 2 0.375 16 0,10,0,6 38,21 16.0 38.0 21.0
5 13810149 G A 0/0 0 0 3 3.0 3.0 0.0 1/1 2 0.75 12 2,1,7,2 3,9 12.0 3.0 9.0
5 76349716 A C 0/0 0 37 33,1,3,0 34,3 37.0 34.0 3.0 0/1 2 0.686 51 14,2,35,0 16,35 51.0 16.0 35.0
5 112364613 G A 0/0 0 0 158 96,61,1,0 157,0 158.0 157.0 0.0 0/1 2 0.245 159 75,47,28,11 120,39 159.0 120.0 39.0
5 131320961 C G 0/0 0 11 11.0 11.0 0.0 0/1 2 0.4286 14 8,0,6,0 13,13 14.0 13.0 13.0
6 31238992 G C 0/0 0 0 5 5.0 5.0 0.0 0/1 2 0.5455 22 4,6,2,10 11,14 22.0 11.0 14.0
6 33415553 A G 0/0 0 0 25 25,0,0,0 25,0 25.0 25.0 0.0 0/1 2 0.24 25 19,0,6,0 19,6 25.0 19.0 6.0
6 41712443 G A 0/0 0 0 64 38,26,0,0 64,0 64.0 64.0 0.0 0/1 2 0.282 117 47,37,23,10 84,33 117.0 84.0 33.0
6 44114773 G T 0/0 0 0 27 1,26,0,0 27,0 27.0 27.0 0.0 0/1 2 0.3 20 0,14,1,5 14,6 20.0 14.0 6.0
6 51612753 G T 0/0 94 94,0 94.0 94.0 0.0 0/1 2 143 138,5 143.0 138.0 5.0
6 55623942 C A 0/0 0 17 1,16,0,0 17,0 17.0 17.0 0.0 0/1 2 0.211 19 1,14,2,2 15,4 19.0 15.0 4.0
6 75864107 C T 0/0 0 0 130 116,14,0,0 130,0 130.0 130.0 0.0 0/1 2 0.217 157 98,25,30,5 123,34 157.0 123.0 34.0
6 152763259 G A 0/0 0 40 32,8,0,0 39,0 40.0 39.0 0.0 0/1 2 0.217 92 60,12,18,2 72,20 92.0 72.0 20.0
6 155109182 T G 0/0 197 192,2 197.0 192.0 2.0 0/1 2 224 216,7 224.0 216.0 7.0
6 159653544 G A 0/0 0 0 7 2,5,0,0 7.0 7.0 0.0 0/1 2 0.368 19 8,3,2,6 11,7 19.0 11.0 7.0
7 1976432 C T 0/0 0 0 4 3,1,0,0 4.0 4.0 0.0 0/1 2 0.483 29 10,5,9,5 15,14 29.0 15.0 14.0
7 2691610 G A 0/0 0 0 3 2,1,0,0 3.0 3.0 0.0 1/1 2 1 4 0,0,2,2 0,4 4.0 0.0 4.0
7 22200248 C T 0/0 0 96 96,0 96.0 96.0 0.0 0/1 2 0.1062 113 33,68,2,10 101,13 113.0 101.0 13.0
7 43622806 T C 0/0 0 0 4 2,2,0,0 4.0 4.0 0.0 0/1 2 0.667 9 1,2,2,4 3,6 9.0 3.0 6.0
7 44580876 G T 0/0 0 0 7 4,2,1,0 7.0 6.0 1.0 0/1 2 0.727 11 1,2,3,5 3,8 11.0 3.0 8.0
7 45717850 T G 0/0 274 272,1 274.0 272.0 1.0 0/1 2 392 382,10 392.0 382.0 10.0
7 47894517 G T 0/0 112 112,0 112.0 112.0 0.0 0/1 2 98 94,4 98.0 94.0 4.0
7 96339155 C A 0/0 0 0 44 10,34,0,0 43,0 44.0 43.0 0.0 0/1 2 0.246 65 5,44,2,14 49,16 65.0 49.0 16.0
7 105636709 G A 0/0 0 0 27 25,2,0,0 27,0 27.0 27.0 0.0 0/1 2 0.25 40 20,10,9,1 30,10 40.0 30.0 10.0
7 122769396 G C 0/0 0 88 88.0 88.0 0.0 0/1 2 0.1101 109 89,8,10,2 109.0 97.0 12.0
7 138391207 G A 0/0 0 0 4 4,0,0,0 4.0 4.0 0.0 0/1 2 0.857 7 1,0,6,0 1,6 7.0 1.0 6.0
7 150915788 A C 0/0 152 151,1 152.0 151.0 1.0 0/1 2 228 198,29 228.0 198.0 29.0
8 22974325 G A 1/1 1 0.9296 90 8,4,46,32 90.0 12.0 78.0 0/1 2 0.782 165 23,10,73,54 36,129 165.0 36.0 129.0
8 30705004 G A 0/0 232 232,0 232.0 232.0 0.0 0/1 2 283 276,7 283.0 276.0 7.0
8 67753176 C T,A 0/0 56 56,0 56.0 56.0 0.0 0/2 2 0.082 70 64,5 70.0 64.0 5.0
8 121344960 G A 0/0 0 0 183 30,153,0,0 182,0 183.0 182.0 0.0 0/1 2 0.393 280 21,149,17,93 170,110 280.0 170.0 110.0
8 143400081 C T 0/0 0 0 11 0,11,0,0 11,0 11.0 11.0 0.0 0/1 2 0.224 49 2,36,1,10 38,11 49.0 38.0 11.0
8 144649690 C T 0/0 0 4 4.0 4.0 0.0 1/1 2 0.8571 7 1,0,6,0 1,8 7.0 1.0 8.0
9 2718534 C G 0/0 0 0 4 4,0,0,0 4,0 4.0 4.0 0.0 1/1 2 1 6 0,0,5,1 0,6 6.0 0.0 6.0
9 14737583 G A 0/0 0 0 87 87,0 87.0 87.0 0.0 0/1 2 0.3108 76 9,42,4,19 52,24 76.0 52.0 24.0
9 18889789 G A 0/0 0 0 8 2,5,0,1 8.0 7.0 1.0 0/1 2 0.684 19 3,3,3,10 6,13 19.0 6.0 13.0
9 34564705 C T 0/0 0 0 55 13,41,0,1 54,0 55.0 54.0 0.0 0/1 2 0.147 143 38,84,9,13 121,21 143.0 121.0 21.0
9 68427793 G T 0/0 287 283,1 287.0 283.0 1.0 0/1 2 392 379,13 392.0 379.0 13.0
9 115934061 A N,C 0/0 0 59 59.0 59.0 0.0 0/2 2 0.1053 57 0,51,0,6 57.0 51.0 6.0
10 24498096 G T 0/0 93 93,0 93.0 93.0 0.0 0/1 2 87 83,4 87.0 83.0 4.0
10 46961964 G A 0/0 0 0.05 20 9,0 20.0 9.0 0.0 0/1 2 0.2836 67 43,5,15,4 19,10 67.0 19.0 10.0
10 61834851 G C 0/0 0 0 217 155,62,0,0 217,0 217.0 217.0 0.0 0/1 2 0.45 378 141,66,104,68 207,170 378.0 207.0 170.0
10 89692904 C T 0/0 195 193,0 195.0 193.0 0.0 0/1 2 249 233,16 249.0 233.0 16.0
10 96448129 A G 0/1 1 0.5 4 0,2,0,2 4.0 2.0 2.0 1/1 3 1 16 0,0,1,15 0,16 16.0 0.0 16.0
10 118387282 A G 0/0 0 0 5 2,3,0,0 5,0 5.0 5.0 0.0 1/1 2 0.895 19 0,2,9,8 2,17 19.0 2.0 17.0
10 123310734 A C 0/0 0 0 41 30,10,1,0 40,0 41.0 40.0 0.0 0/1 2 0.389 54 26,6,16,5 32,21 54.0 32.0 21.0
11 1958016 C T 0/0 0 0 3 3.0 3.0 0.0 0/1 2 0.7 10 2,1,6,1 3,7 10.0 3.0 7.0
11 4945468 G T 0/0 99 98,0 99.0 98.0 0.0 0/1 2 78 74,4 78.0 74.0 4.0
11 48453787 G A 1/1 1 0.812 121 20,2,91,8 121.0 22.0 99.0 0/1 2 0.708 130 27,2,81,13 38,92 130.0 38.0 92.0
11 58381738 T A 0/0 0 0 146 79,67,0,0 145,0 146.0 145.0 0.0 0/1 2 0.354 127 49,33,25,20 82,45 127.0 82.0 45.0
11 63523458 T G 0/0 0.0125 80 80.0 80.0 0.0 0/1 2 0.1111 36 32,0,4,0 36.0 32.0 4.0
11 65655337 G T 0/0 0 47 47,0 47.0 47.0 0.0 0/1 2 0.0909 46 23,17,2,2 42,4 46.0 42.0 4.0
11 68331663 G A 0/0 0 0 6 6,0,0,0 6.0 6.0 0.0 0/1 2 0.5 10 5,0,4,1 5,5 10.0 5.0 5.0
11 69466115 C A 0/0 0 3 3.0 3.0 0.0 1/1 2 0.8333 6 0,1,0,5 1,5 6.0 1.0 5.0
11 108119638 T G 0/0 0 37 37.0 37.0 0.0 0/1 2 0.1905 21 17,0,4,0 21.0 17.0 4.0
11 117063930 A G 0/0 0 0 131 72,58,0,1 129,0 131.0 129.0 0.0 0/1 2 0.307 179 55,71,27,29 124,55 179.0 124.0 55.0
11 124972208 A G 0/0 0 0 5 0,5,0,0 5,0 5.0 5.0 0.0 0/1 2 0.909 11 0,1,0,10 1,10 11.0 1.0 10.0
12 11461706 G T 0/0 0 0.15 273 140,87,16,31 273.0 227.0 47.0 0/1 2 0.263 483 224,121,54,75 356,127 483.0 356.0 127.0
12 39155920 T C 0/0 165 165,0 165.0 165.0 0.0 0/1 2 234 225,9 234.0 225.0 9.0
12 53581370 T C 0/0 0 0 80 33,47,0,0 78,0 80.0 78.0 0.0 0/1 2 0.265 162 40,79,16,27 119,43 162.0 119.0 43.0
12 69979115 G C 0/0 0 0 4 4,0,0,0 4.0 4.0 0.0 0/1 2 0.429 14 8,0,6,0 8,6 14.0 8.0 6.0
12 101490434 C T 0/0 0 0 133 50,83,0,1 132,0 133.0 132.0 0.0 0/1 2 0.239 188 58,87,12,33 143,45 188.0 143.0 45.0
12 104181420 A T 0/0 0 0 6 0,6,0,0 6.0 6.0 0.0 0/1 2 0.5 12 0,6,0,6 6,6 12.0 6.0 6.0
12 112622620 C T 0/0 0 0.0172 61 15,45,0,2 59,0 61.0 59.0 0.0 0/1 2 0.22 168 29,102,10,27 131,37 168.0 131.0 37.0