Skip to content
Snippets Groups Projects
Commit 60ed81cb authored by Santos Garcia Carlos's avatar Santos Garcia Carlos
Browse files

Score initialisé à None

parent 140c4d57
No related branches found
No related tags found
No related merge requests found
......@@ -15,7 +15,7 @@ class Individu():
lineList = [line.rstrip('\n') for line in open("plasmid_8k.fasta")]
self.brin = ''.join(lineList[1:])
#self.brin = "AAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCCAGTAAACGAAAAAACCGCCTGGGGAGGCGGTTTAGTCGAA"
self.score = self.evaluate()
self.score = None
def evaluate(self):
''' Evalue le score d'un individu sur un nombre numb_ajout de points'''
......
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment