Skip to content
Snippets Groups Projects
Commit cf714845 authored by Gauthier Roy's avatar Gauthier Roy
Browse files

pull

parent 97ca2183
No related branches found
No related tags found
No related merge requests found
......@@ -29,13 +29,12 @@ class Individu():
last_seq = self.brin[-numb_ajout:]
traj.compute(last_seq + self.brin + fisrt_seq, self.table)
traj_array = np.array(traj.getTraj())
traj_array = traj.getTraj()
list_distance = []
begining = traj_array[0:2*numb_ajout, 0:3]
end = traj_array[-2*numb_ajout:, 0:3]
begining = np.array(traj_array[0:2*numb_ajout])
end = np.array(traj_array[-2*numb_ajout:])
for i in range(numb_ajout):
nuc_coordonate_beg = begining[i]
......@@ -116,10 +115,10 @@ class Individu():
# print(individu1.table.rot_table)
# individu1.mutation()
#table = RotTable()
#test = Individu(table)
#test.evaluate("AAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCCAGTAAACGAAAAAACCGCCTGGGGAGGCGGTTTAGTCGAA")
#print(test.score)
table = RotTable()
test = Individu(table)
test.evaluate()
print(test.score)
# qqun=Individu(RotTable())
......
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment